ID: 906814872

View in Genome Browser
Species Human (GRCh38)
Location 1:48868326-48868348
Sequence CTGCTTAAGCAGAAAGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 317}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906814867_906814872 -1 Left 906814867 1:48868304-48868326 CCAAGAATGGCTTCCTAAAATTC 0: 1
1: 0
2: 0
3: 16
4: 240
Right 906814872 1:48868326-48868348 CTGCTTAAGCAGAAAGGGGAAGG 0: 1
1: 0
2: 1
3: 26
4: 317
906814864_906814872 19 Left 906814864 1:48868284-48868306 CCTCTTTATCTTGCCTCTATCCA 0: 1
1: 0
2: 1
3: 28
4: 314
Right 906814872 1:48868326-48868348 CTGCTTAAGCAGAAAGGGGAAGG 0: 1
1: 0
2: 1
3: 26
4: 317
906814861_906814872 30 Left 906814861 1:48868273-48868295 CCCTGCATTTCCCTCTTTATCTT 0: 1
1: 0
2: 8
3: 62
4: 704
Right 906814872 1:48868326-48868348 CTGCTTAAGCAGAAAGGGGAAGG 0: 1
1: 0
2: 1
3: 26
4: 317
906814866_906814872 6 Left 906814866 1:48868297-48868319 CCTCTATCCAAGAATGGCTTCCT 0: 1
1: 0
2: 1
3: 11
4: 131
Right 906814872 1:48868326-48868348 CTGCTTAAGCAGAAAGGGGAAGG 0: 1
1: 0
2: 1
3: 26
4: 317
906814863_906814872 20 Left 906814863 1:48868283-48868305 CCCTCTTTATCTTGCCTCTATCC 0: 1
1: 0
2: 1
3: 37
4: 433
Right 906814872 1:48868326-48868348 CTGCTTAAGCAGAAAGGGGAAGG 0: 1
1: 0
2: 1
3: 26
4: 317
906814862_906814872 29 Left 906814862 1:48868274-48868296 CCTGCATTTCCCTCTTTATCTTG 0: 1
1: 0
2: 5
3: 51
4: 387
Right 906814872 1:48868326-48868348 CTGCTTAAGCAGAAAGGGGAAGG 0: 1
1: 0
2: 1
3: 26
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906814872 Original CRISPR CTGCTTAAGCAGAAAGGGGA AGG Intronic
903298065 1:22358459-22358481 GAGCTTAAGCAAAAAGGGGAAGG - Intergenic
904758418 1:32782904-32782926 CTGAGTAAGAAGAAAGAGGAAGG + Intronic
906243383 1:44256421-44256443 CAGCTAAAGCAGCAAAGGGATGG + Intronic
906814872 1:48868326-48868348 CTGCTTAAGCAGAAAGGGGAAGG + Intronic
906822563 1:48944727-48944749 TTGATCAAGAAGAAAGGGGAAGG - Intronic
907857812 1:58321247-58321269 CTGCTGCAGCATAAAGAGGAAGG - Intronic
908656068 1:66390147-66390169 ATGCCTAAGCAGATAGGGGCAGG - Intergenic
909364409 1:74802612-74802634 CTACATAATCAGAAAGGAGAGGG - Intergenic
910349360 1:86277909-86277931 CTCCTTAAGCAGAAAGAGAAAGG + Intergenic
911330952 1:96525225-96525247 ATGTTTAAGCTGAAAGGTGAAGG + Intergenic
911770567 1:101735664-101735686 CTGCTGGAGCATAAAGGGCAAGG + Intergenic
912738664 1:112173683-112173705 CTGCTGAAGCAGAGTGGGAAAGG - Intergenic
913452754 1:119003259-119003281 CTGCTTAATCAGGAGGGTGATGG - Intergenic
914764098 1:150622752-150622774 CTGCAAAAGCAGGAAGGGGCAGG + Exonic
914998646 1:152566501-152566523 CTGCCTGAGTAGAAAGAGGATGG + Intronic
915251352 1:154591249-154591271 CTTCTTAAGCAGAAATCAGAAGG + Intronic
916446009 1:164872361-164872383 CTTCTTAAACAGAAAGGAGCTGG + Intronic
916686571 1:167152563-167152585 CTGGTGAAGCAGCAAAGGGATGG - Intergenic
917250428 1:173053639-173053661 CTGTTTAAGAAGAGAGAGGAGGG + Intergenic
917743457 1:177984321-177984343 CTGCTGAAGCAGAAAGGTTCTGG - Intergenic
917779047 1:178371665-178371687 TAGCTAAAGCAGGAAGGGGAAGG + Intronic
917956437 1:180103447-180103469 TTACTTAAGCAGATAGGGTAAGG - Intronic
918639321 1:186819870-186819892 CTGCTTATGCAAAATGGTGAAGG + Intergenic
919037843 1:192338951-192338973 TTGCATAACTAGAAAGGGGAAGG - Intronic
1063474320 10:6315209-6315231 CTCCTTAAACAAACAGGGGAGGG + Intergenic
1063977519 10:11429225-11429247 CTGATGAAACAGAAATGGGAGGG + Intergenic
1064745897 10:18477839-18477861 CTGCTTAGGAACAAAAGGGAAGG + Intronic
1065341106 10:24706702-24706724 CTGCTTAGACAGGAAAGGGAGGG - Intronic
1065984500 10:30936324-30936346 ATGCTTAACCAGAAAGTGGATGG - Intronic
1067600102 10:47590241-47590263 CTGCTCAAGCAGAAAAGGATTGG - Intergenic
1070527374 10:77306831-77306853 CAGCTTACGCAAAAAGGGCAGGG + Intronic
1071278698 10:84079732-84079754 CTGCTTAAGTAGATCTGGGATGG + Intergenic
1071896737 10:90076048-90076070 CTGCTTGAGGAAAAAGGAGAAGG - Intergenic
1072022004 10:91411010-91411032 CTGTTTAATCTGAAGGGGGAAGG - Intronic
1073315668 10:102579042-102579064 CTGCTTAAAAAGAAAAGTGAAGG + Intronic
1073494718 10:103880475-103880497 ATGCCTAGGCAGAGAGGGGAGGG - Intergenic
1073532209 10:104243185-104243207 CTACTTAAGGAGTATGGGGAGGG - Intronic
1073739056 10:106385353-106385375 CTACTTCCCCAGAAAGGGGAAGG + Intergenic
1075817361 10:125275175-125275197 CTGCTTTAGCAGATTTGGGAAGG + Intergenic
1076606764 10:131694533-131694555 CTGCTTACAGAGACAGGGGAAGG - Intergenic
1077035157 11:490946-490968 CTGACCAGGCAGAAAGGGGAGGG - Exonic
1078102310 11:8337138-8337160 CTGCTTAGGAAGCAAGGGAAAGG - Intergenic
1078249721 11:9607141-9607163 CAGTTAAAGCAGAAAGTGGAGGG + Intergenic
1078450307 11:11436071-11436093 CTGCGTGAGCAGAGAGGCGAGGG + Intronic
1079384117 11:19963754-19963776 GTGCTTATGCAGAAAGTGAATGG + Intronic
1080944134 11:36951840-36951862 GTACTTAAGCAGAAATGTGAAGG + Intergenic
1081343416 11:41955000-41955022 ATGTTTAATGAGAAAGGGGAAGG + Intergenic
1084952521 11:72674443-72674465 CTGATAATGCAGAAGGGGGAGGG + Exonic
1085063051 11:73466124-73466146 CTGCTTCAGAGGAAATGGGATGG - Intronic
1086781784 11:90916035-90916057 CTGCATAAACAGAAGGTGGAAGG - Intergenic
1087039267 11:93783160-93783182 CTGCTGAAGAAGAAAGTAGATGG - Intronic
1087125485 11:94621832-94621854 CTGATGATGCAGAAAGGAGAAGG - Intergenic
1088289304 11:108219221-108219243 CTACTGAGGCAGAAAGGGAATGG - Intronic
1088409446 11:109517525-109517547 CTGCTGAGGCAGATAGGAGAAGG - Intergenic
1089233851 11:117005796-117005818 ATGCTTCAGCAGAAAGAGGCAGG + Intronic
1089460224 11:118648697-118648719 CTGTTTAAGGAGAAAGGGTAGGG - Intronic
1089624765 11:119744296-119744318 GTGATGAAGAAGAAAGGGGATGG - Intergenic
1090639975 11:128721908-128721930 CTTCTTAGGCAGGAAGAGGAGGG - Intronic
1090722628 11:129490299-129490321 CTGCTTAAGTGGAAATGCGAGGG - Intergenic
1091229240 11:133977148-133977170 CCACTTGAGCAGAAAGGGGAGGG + Intergenic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1092085364 12:5753426-5753448 CTGCTTAGGAACAAAAGGGAGGG + Intronic
1093707261 12:22288275-22288297 CATCTTTAGCTGAAAGGGGACGG + Intronic
1096109379 12:49020119-49020141 AAGCTTGGGCAGAAAGGGGAAGG + Exonic
1098498063 12:71159994-71160016 CTGCCTAGGAAGAAAGGGGAGGG - Intronic
1099043737 12:77689035-77689057 CTGCATAAGCAGAAGGGTTAAGG + Intergenic
1099081350 12:78186462-78186484 CAGCTCAAGCAGAAAGTTGATGG - Intronic
1099402358 12:82215803-82215825 ATGCCTAGGCAGATAGGGGAGGG + Intergenic
1099817495 12:87668155-87668177 CTGCATACGCAGTAAGGAGAGGG + Intergenic
1100491171 12:95079666-95079688 CTGCTATGACAGAAAGGGGATGG + Exonic
1100736754 12:97543536-97543558 CAGCTTCAGCACAAAGGGAAGGG - Intergenic
1100862582 12:98822110-98822132 TGGCTTAAGCAGAAAAGGGCAGG - Intronic
1101670649 12:106869069-106869091 CTGCTCAGGCAAGAAGGGGATGG - Intronic
1101994511 12:109515212-109515234 CCCCTTAAGAAGAAAGGGGATGG - Intronic
1102542204 12:113629390-113629412 CTGCTTTAGAAGAAAGGGGTTGG + Intergenic
1104293249 12:127488083-127488105 CTGCATAGGTAGAGAGGGGAAGG + Intergenic
1104923353 12:132302794-132302816 CTGTGGCAGCAGAAAGGGGACGG + Intronic
1106010093 13:25812278-25812300 GTGCTTCAGAAGGAAGGGGAAGG - Intronic
1106769853 13:32951577-32951599 CTTCCTAAGGAGAAAGGGGAGGG + Intergenic
1108212751 13:48154872-48154894 CTGGTTGTGCAGAGAGGGGAGGG + Intergenic
1108357882 13:49643569-49643591 CTGCCTAAGTAAAATGGGGAAGG - Intergenic
1108761396 13:53570165-53570187 ATGGATATGCAGAAAGGGGAAGG - Intergenic
1111218462 13:85175369-85175391 CTGCTGAAGAAGAATGAGGAAGG + Intergenic
1111254310 13:85645536-85645558 ATGCCTAGGCAGATAGGGGAGGG - Intergenic
1111739715 13:92188788-92188810 ATGCTGAACCAGAAAGTGGAAGG - Intronic
1112215770 13:97430482-97430504 CTGATTAAACATAAAGGGGAAGG - Intergenic
1113220242 13:108092544-108092566 CTGTATGAGCAGAAGGGGGATGG - Intergenic
1113266065 13:108619643-108619665 CTGGCCAAGAAGAAAGGGGAAGG + Intronic
1113271719 13:108682011-108682033 CTGCTAAATCAGAAACTGGAGGG + Intronic
1114656695 14:24319991-24320013 CTGTTTAAGAAGAATTGGGAAGG + Intronic
1115123386 14:29964402-29964424 CTTCTTTATCTGAAAGGGGAAGG - Intronic
1115221225 14:31060597-31060619 CTGCTTGAGGAGACAGGAGAAGG - Intronic
1117084649 14:52187015-52187037 CTGCTTAAGAACAAAAGGAAAGG + Intergenic
1119433785 14:74585009-74585031 CTTCTTAAGCAGAAAGCGAATGG + Intronic
1121081936 14:91115312-91115334 CTGAGGAAGCAGGAAGGGGAAGG + Intronic
1121402567 14:93693066-93693088 GTTCTTAATTAGAAAGGGGATGG + Intronic
1121599286 14:95191155-95191177 CTGCTTAATGAGAAAGAGGGTGG - Exonic
1125833158 15:42730240-42730262 GGGTTTGAGCAGAAAGGGGAAGG + Intronic
1125925675 15:43560842-43560864 ATGCTCAAGGAGCAAGGGGAAGG - Intronic
1125938625 15:43659060-43659082 ATGCATAATCAGGAAGGGGATGG + Intronic
1125938820 15:43660393-43660415 ATGCTCAAGGAGCAAGGGGAAGG - Intronic
1126055810 15:44728810-44728832 CTGCTTTCCGAGAAAGGGGAAGG - Intergenic
1127220214 15:56872262-56872284 CTGCTTGAGAAGAAAAGGAAAGG + Intronic
1127225259 15:56920106-56920128 CTGCTTAAGCAGAAAGCAGATGG - Intronic
1129114941 15:73360075-73360097 CTGCATCTTCAGAAAGGGGAAGG + Intronic
1129148483 15:73671296-73671318 CTTCTTAAGAAGAAAAGGGAGGG - Intergenic
1129275327 15:74441683-74441705 CTGGGTAAGCAGAAAGAGGGAGG + Intergenic
1130017442 15:80198552-80198574 CTGCTGAAGCATAGAGGAGATGG - Intergenic
1130984311 15:88834645-88834667 CTTCTTAAACCAAAAGGGGAGGG + Intronic
1131067221 15:89442226-89442248 CTGGAAAAGCAGAAAGGGGCGGG + Intergenic
1131172090 15:90185576-90185598 CTGGTCTAGCAGAAAGGCGAAGG + Intronic
1131302929 15:91215349-91215371 CTGCTAAAACAGAAGGAGGAGGG - Intronic
1131670524 15:94614974-94614996 CTGGACAAGAAGAAAGGGGAGGG - Intergenic
1131781612 15:95865813-95865835 CTGCTGCAGGAGAAAGGGCATGG - Intergenic
1132242196 15:100266500-100266522 GGGCTTAAGCAGAAGAGGGATGG - Intronic
1132327364 15:100982817-100982839 CTGCTTCATGAGGAAGGGGACGG - Intronic
1135730372 16:24890142-24890164 CTTCTTAAGGAAAAAGGAGATGG + Intronic
1137466483 16:48714476-48714498 CTGCTTACCTATAAAGGGGATGG + Intergenic
1138144385 16:54595645-54595667 CTGACTAAGCATTAAGGGGAGGG - Intergenic
1138349136 16:56337274-56337296 CTGCTGAAGCAGCATGGGGCCGG + Intronic
1140024101 16:71267886-71267908 CTGCATAAGGAGAAAGTGTAAGG + Intergenic
1140337108 16:74118012-74118034 GTGCTCAAGCAGAAAGGGGCAGG + Intergenic
1140585979 16:76292261-76292283 ATTCTTGAGCAGGAAGGGGAGGG - Intronic
1140855780 16:78976495-78976517 CTGCTTAAGCAAGAACGTGAGGG + Intronic
1141508208 16:84494929-84494951 CTGCTTAGGAACAAAGGGAAAGG - Intronic
1143214163 17:5211707-5211729 CTCTCTAAGAAGAAAGGGGATGG + Intronic
1143520414 17:7441185-7441207 CAGCTCAACCAGAAGGGGGAAGG - Intronic
1144018075 17:11215666-11215688 CTGCCTAAGCAGAAATTGCAAGG - Intergenic
1144118205 17:12122106-12122128 CTGCTTAAGAACAAAAGGAAAGG - Intronic
1144306509 17:13973488-13973510 CTGCATAAGCAGTAAGGACAGGG - Intergenic
1146043994 17:29486884-29486906 CTGTTTAAGCAGAGAGAAGATGG + Intronic
1149964198 17:61145667-61145689 CAGCTTAAGTAAAAAGGGGAGGG - Intronic
1150613013 17:66748899-66748921 CAGCTTCAGGAGGAAGGGGAGGG + Intronic
1150851983 17:68712173-68712195 CTGCTTGTGCTGAGAGGGGATGG + Intergenic
1150920193 17:69474868-69474890 CTTCTAAAGAAAAAAGGGGATGG - Intronic
1151388187 17:73768147-73768169 CTGCATAAGAGGAAAGGGCAAGG + Intergenic
1152136172 17:78505057-78505079 ATCCTTAGGGAGAAAGGGGAGGG - Intronic
1152571002 17:81121248-81121270 CTGCTTCTGCAGAGAGCGGAAGG + Exonic
1153568862 18:6448106-6448128 CTGCTTCAGCAGAGTGTGGAAGG + Intergenic
1155167234 18:23241046-23241068 TTGCTTTTGCAGGAAGGGGATGG - Intronic
1155244605 18:23895117-23895139 CTCCATAAGCAGGAAGGGAAAGG + Intronic
1155760249 18:29556340-29556362 CTGGTTTATCATAAAGGGGATGG + Intergenic
1155806631 18:30178341-30178363 CTGCCTAAGGACATAGGGGAAGG + Intergenic
1156608989 18:38703977-38703999 GTGGTTAAGTGGAAAGGGGATGG - Intergenic
1156993666 18:43440184-43440206 ATGCCTAGGCAGATAGGGGAGGG + Intergenic
1157314614 18:46577219-46577241 ATGCTTAAGCAAAAAGAGAAAGG + Intronic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1158815462 18:61089750-61089772 CTGCTTAAATATAAAGGGAAAGG + Intergenic
1158883387 18:61802808-61802830 CTGCTTTAGCAATAAGGGTATGG - Intergenic
1160266580 18:77343989-77344011 CTGCTGAAGCAGAAACGTGGGGG + Intergenic
1162940580 19:14006552-14006574 CTGGTTAAGAATAAAGGGGTAGG + Intronic
1163224711 19:15950066-15950088 GAGCTTAAGCAAAAAGGGAAGGG - Intergenic
1163609316 19:18292824-18292846 AAGCTGAAGCAGGAAGGGGAGGG - Intergenic
1165817987 19:38654747-38654769 TTGTTTATGGAGAAAGGGGAGGG - Intronic
926111662 2:10187823-10187845 CTGCAGAAGCAGGAAGCGGATGG - Intronic
927660935 2:24992092-24992114 ATGCCTAAGCAGATAGGGGTGGG + Intergenic
929445852 2:42000647-42000669 CTGCTAAAGCAGAACCAGGAAGG + Intergenic
929991569 2:46793904-46793926 CTGTTGAAACTGAAAGGGGAGGG + Intergenic
931121257 2:59222842-59222864 CTGCAAAAGCAAAGAGGGGAAGG + Intergenic
931509503 2:62975247-62975269 CAGCTTAGGCAGAAAGGGTATGG + Intronic
935443951 2:103136999-103137021 CTACTTCAGCAGGATGGGGATGG + Intergenic
935962945 2:108445301-108445323 ATGCCTAAGCAGATAGGGAAGGG + Intergenic
936838619 2:116740889-116740911 CTGGCAAAGGAGAAAGGGGAAGG + Intergenic
937388660 2:121462845-121462867 CTGTTTAAGCAGGGAGGGTATGG + Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942455133 2:176132788-176132810 CTGTTTAATAAGAAAGGGGTGGG + Intergenic
945159384 2:206873692-206873714 CTGTTTAAAGAGAAAGAGGATGG + Intergenic
946598936 2:221338306-221338328 CTGCTAAACAAGAATGGGGAGGG + Intergenic
947235374 2:227935926-227935948 TTGCTTAAGGAGGAAGAGGAGGG + Intergenic
947483560 2:230525742-230525764 CTGCTGAAGCAGGCATGGGAGGG - Intronic
947774767 2:232698799-232698821 GTGCTTCACCAGAAAGGAGAGGG + Intronic
1169447930 20:5688052-5688074 TTGCATGAGCAGGAAGGGGAAGG - Intergenic
1169755964 20:9043565-9043587 CTGCTTAAGAACAAAAGGAAAGG + Intergenic
1169864981 20:10190355-10190377 CTGCTGAAGTATAATGGGGAAGG - Intergenic
1170199291 20:13725145-13725167 CTGCATGAGCAGATAGGGTAGGG - Intronic
1170704535 20:18733320-18733342 GTCCTTAAGCAGAAAGGGGCAGG + Intronic
1172113891 20:32562774-32562796 CTGCAGGAGCAGAATGGGGAGGG - Intronic
1173018818 20:39249976-39249998 CTTCTTTAGCAGATATGGGAAGG + Intergenic
1173058130 20:39636007-39636029 ATGCCTAAGCAGATAGGGGTGGG + Intergenic
1173527852 20:43746605-43746627 CTGCTTAGGCACAAAAGGGAAGG + Intergenic
1174454893 20:50642004-50642026 CTGCGGAAGCAGAAGGGGGTGGG - Intronic
1174471909 20:50767726-50767748 CTGCGGAAGCAGAAGGGGGTGGG + Intergenic
1177397666 21:20558327-20558349 CTGCATAACCAGAATGGAGATGG - Intergenic
1177719775 21:24891044-24891066 CTTCTTAAGCAGACAGGCTATGG - Intergenic
1177933611 21:27316323-27316345 TTCTTTTAGCAGAAAGGGGATGG + Intergenic
1178477192 21:32947295-32947317 CTAGGTAAGCAGAAAGGGGCTGG + Intergenic
1181335643 22:22125836-22125858 CAGCTTGGGCCGAAAGGGGAGGG + Intergenic
1181413797 22:22745281-22745303 GTGCTTAACCAGGATGGGGAGGG - Intronic
1181641586 22:24203244-24203266 CTGCTTAGGAACAAAGGGAAAGG - Intergenic
1183397094 22:37577914-37577936 CTGCTGAAGGCGCAAGGGGAGGG - Intronic
1183536095 22:38402287-38402309 CTGCTTCAGCCAGAAGGGGAAGG - Intergenic
1183886056 22:40883286-40883308 CTGATTCAGTAGATAGGGGATGG - Intronic
1184275628 22:43408031-43408053 CAGCTCGAGGAGAAAGGGGATGG - Intergenic
1184418293 22:44364561-44364583 CTGCTTAAGGAGAAGGATGAGGG + Intergenic
1185080909 22:48708854-48708876 CTGCTCAGGCAGCAAGGGGAAGG - Intronic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
950045707 3:9947520-9947542 CGCCGTAAGCAGCAAGGGGAAGG + Exonic
951822084 3:26825064-26825086 TTGCCTAGGCAGATAGGGGAGGG + Intergenic
951909522 3:27735082-27735104 CTACTTAAGTAGGAAGGTGAAGG - Intergenic
952339086 3:32430342-32430364 AGGCATAAGCAGAATGGGGATGG - Intronic
953337115 3:42102847-42102869 CTTCCTAGGCAGACAGGGGAGGG - Intronic
954578047 3:51687618-51687640 CTGCCAAAGCAGAAAGCTGACGG - Intronic
954848154 3:53577808-53577830 TTCCTTAAGCAGTAAAGGGAAGG - Intronic
955421270 3:58740373-58740395 CTGCTCAAGGAGCAAGAGGATGG - Intronic
956226218 3:66961999-66962021 CAGCCCAAGCAGAATGGGGAGGG - Intergenic
957425567 3:80034961-80034983 CTGCTGAAGGAGGAAGGTGAAGG - Intergenic
957586991 3:82145800-82145822 CTCTTTTAGCAGAAAAGGGATGG - Intergenic
958593373 3:96189713-96189735 ATTCTTAGGCAGAAAGGGGTGGG + Intergenic
958950527 3:100411016-100411038 CTCCTTAAGCTGAAGGGGCAAGG + Intronic
959693586 3:109225111-109225133 ATGCCTAGGCAGAAAGGGGAGGG - Intergenic
961349406 3:126290088-126290110 CTGCTTAGGAACAAAGGGAAAGG + Intergenic
961645340 3:128389797-128389819 CTGCTCCAGCAGAATGGGCAGGG + Intronic
963878748 3:150504371-150504393 CAGCTTTAGCACAAGGGGGAAGG - Intergenic
963900450 3:150727948-150727970 CTGCTCCAGCAGATAGGAGAGGG + Intergenic
965920778 3:173910225-173910247 CTGCTTCATCAGAACTGGGATGG + Intronic
966881393 3:184353148-184353170 CTGCATAGGCAGGAAGGGGCTGG + Intronic
968076318 3:195817564-195817586 CTGCTTAAGGAGAAGGAGGCCGG - Intergenic
968297799 3:197591085-197591107 CTGTTAGAGCAGGAAGGGGAGGG - Intergenic
970289391 4:14554893-14554915 CCTGTAAAGCAGAAAGGGGAGGG + Intergenic
972250520 4:37295128-37295150 CTGCTTAAGAGGAAAAGGTAAGG + Intronic
972613170 4:40673837-40673859 CTGCTAAAGCAGAAAGCGGCAGG - Intergenic
973618816 4:52707288-52707310 TTGATTAAGCAGCAAGGTGAGGG - Intergenic
974113202 4:57549259-57549281 GTGCTTAAGGGCAAAGGGGATGG + Intergenic
974203344 4:58669022-58669044 ATGCCTAGGCAGATAGGGGAGGG + Intergenic
977209180 4:94198574-94198596 ATGCATAAGCAGAAAAAGGAAGG + Intergenic
977919924 4:102631784-102631806 CTGCTAAAGCTGAGAGGTGAAGG + Intronic
978234485 4:106442225-106442247 TTGATAAAGTAGAAAGGGGAAGG + Intergenic
978745654 4:112191139-112191161 CTGCTTGAGCAGTTAGGGAAAGG - Exonic
978842644 4:113232901-113232923 CTGCCTAAGCAAAAATGAGAGGG - Intronic
979682909 4:123481159-123481181 CTGCTTGAGCATAATGGAGATGG + Intergenic
980198860 4:129627535-129627557 CTGCTTCAGGAGAAAAGGGTGGG - Intergenic
981262629 4:142739958-142739980 CTGATTTAGCCGAAAGAGGATGG + Intronic
984400464 4:179257520-179257542 ATGCCTAGGCAGATAGGGGAAGG - Intergenic
984582951 4:181531816-181531838 CTGCTTAAGCAGAAAACTGAAGG + Intergenic
984876333 4:184371257-184371279 CTGGTAAAACAGAAAGGGAAGGG - Intergenic
985869725 5:2544796-2544818 CTGCTTAAGAGGGAAGGGGTAGG + Intergenic
986257320 5:6111024-6111046 CCCCTTATGGAGAAAGGGGATGG - Intergenic
987229859 5:15882534-15882556 CTGTGTAAGAAGAATGGGGAAGG - Intronic
988776623 5:34482847-34482869 AGGGTTAAGGAGAAAGGGGAAGG + Intergenic
989157606 5:38359075-38359097 ATTCTTAGGCAGAAGGGGGAAGG - Intronic
990308521 5:54517282-54517304 CTCCTTGAGCAGAAGAGGGAAGG + Intergenic
990768277 5:59212924-59212946 CAGCTTGAGAAGAAAGGGAAAGG - Intronic
991479465 5:67061704-67061726 CTTGTTAAGCAGAAAGAGGGAGG - Intronic
992624142 5:78621864-78621886 CAGCTTAGGGGGAAAGGGGAAGG - Intronic
992791910 5:80221151-80221173 CTGCTTCAGCAGATCTGGGATGG - Intronic
993224732 5:85153304-85153326 CTGCCTGAGCAGGATGGGGAAGG - Intergenic
993977347 5:94498604-94498626 CTTCTTATGCAGAAAAGGGAAGG - Intronic
995856070 5:116593649-116593671 CTGCTTAAGCTGAAAAAGCAGGG + Intergenic
999954636 5:156687147-156687169 CAGATTAAGCAGAAAAGGCAGGG + Intronic
1000087574 5:157901411-157901433 CTCCTGAAGCAGAAACTGGAGGG + Intergenic
1001469517 5:172000867-172000889 ATGGTTTAGCAGAAAGGGCATGG - Intronic
1001607184 5:172969865-172969887 CTGATGAAGTAGAAAGGGCAGGG + Intergenic
1001960596 5:175878499-175878521 CTGCTGGAGGAGAAAGGAGATGG - Intronic
1002638775 5:180620716-180620738 CTGCGTGGGCAGAAAGGGGCCGG + Intronic
1003201880 6:3969017-3969039 CTGCTTAGGAAGAAAAGGAAAGG - Intergenic
1004376181 6:15092667-15092689 CTGCTTCAGCAGGGAGGGCAAGG - Intergenic
1004993522 6:21165163-21165185 CTCCTGAAACAGAAAGTGGAAGG - Intronic
1006748096 6:36359143-36359165 CAGATTAAACAGAAAGGGGATGG + Intronic
1007127021 6:39433866-39433888 CTGAACAAGCAGAATGGGGATGG - Intronic
1007694039 6:43720274-43720296 CTGCTTGAGTGGAAAGAGGATGG + Intergenic
1007876810 6:45112530-45112552 CTGATTAAGAATAGAGGGGAAGG + Intronic
1009369900 6:62886124-62886146 GTGCAAAAGCAGAAAAGGGAGGG + Intergenic
1011285859 6:85721932-85721954 CTGCTTAAGAACAAAAGGAAAGG + Intergenic
1011991173 6:93519441-93519463 ATGCCTATGCAGAGAGGGGAAGG - Intergenic
1011991180 6:93519486-93519508 ATGCCTATGCAGAGAGGGGAAGG - Intergenic
1012316922 6:97791872-97791894 ATTCGTAAGCAGACAGGGGAGGG - Intergenic
1012686094 6:102251685-102251707 CTACTTAAGGAGAAATGTGATGG + Intergenic
1012873290 6:104696523-104696545 CTGCAGAAGAGGAAAGGGGAAGG + Intergenic
1013335943 6:109161378-109161400 CTGCTGGAGCAGAAAGCAGAGGG + Intronic
1013351705 6:109311802-109311824 GTGATGAAGCAGAAAGAGGAAGG - Intergenic
1013617881 6:111861560-111861582 CTGCTGCAGCTGAAAGGGGGAGG - Intronic
1013899080 6:115131602-115131624 ATGCCTAGGCAGATAGGGGACGG + Intergenic
1014265993 6:119278430-119278452 CTGCTTAAACAAAAAGCAGAGGG - Intronic
1015516748 6:134090019-134090041 AAGCTCCAGCAGAAAGGGGAAGG + Intergenic
1015681095 6:135809432-135809454 ATGTTTAGGCAGATAGGGGAGGG - Intergenic
1015754534 6:136594250-136594272 CTGCTACAGCAGAAAGGAAATGG + Intronic
1016199887 6:141394571-141394593 CTGCCAACTCAGAAAGGGGAGGG - Intergenic
1016206534 6:141473848-141473870 ATGCCTAAGCAGATAGGGGCTGG - Intergenic
1016354095 6:143198990-143199012 CTGCAGTAGCAGAAAAGGGAAGG + Intronic
1016644826 6:146394515-146394537 CTCCAGAAGCAGAAAGGGCATGG - Intronic
1016850768 6:148616535-148616557 GTGATGAAGCAGAGAGGGGAAGG + Intergenic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1018219726 6:161565987-161566009 CTGATGATGCAGAAGGGGGAAGG - Intronic
1019768776 7:2870466-2870488 CTGCTCAGGCAGAGAGGGGCAGG - Intergenic
1021115793 7:16745065-16745087 ATGCCTAGGCAGATAGGGGAGGG - Intergenic
1022176044 7:27872861-27872883 CTGCATAAAAAGATAGGGGATGG + Intronic
1022194842 7:28054798-28054820 CTGCTCAGGAAGGAAGGGGAGGG + Intronic
1022659791 7:32356111-32356133 CAGCTCAATCAGAAAGTGGATGG + Intergenic
1023355994 7:39367545-39367567 CTGTTTAAGAAGGCAGGGGATGG - Intronic
1024130130 7:46343052-46343074 CTGCTGAAGAAGAATGAGGAAGG - Intergenic
1024863962 7:53881246-53881268 CTTCTTATGCAGAGAGGGCATGG + Intergenic
1024915363 7:54493104-54493126 TTGCTTAATCTGAAAGGGGTGGG - Intergenic
1025110183 7:56209931-56209953 TTCCTTAAGCAGAAAGGTTAAGG - Intergenic
1026900405 7:74033818-74033840 CTGCTTTTGCTGAAAGGGGCCGG - Intronic
1026995347 7:74612440-74612462 GTGCTTAAGCAGGAACGGGCAGG - Intergenic
1027343764 7:77236891-77236913 CTGCTTAAGCCTAAAGAGAATGG + Intronic
1027801801 7:82762255-82762277 CTGCTTAAGCTGAAACCAGAAGG + Intronic
1028858961 7:95625692-95625714 CTGCTAAAACAAATAGGGGAAGG + Intergenic
1030511833 7:110492314-110492336 CTTCTTAATCTGAAAGGAGAAGG + Intergenic
1030568175 7:111187218-111187240 CTGCTTGGCCAGAAAGGGAAGGG - Intronic
1032167457 7:129556646-129556668 CTGATAAAGAAGAAAGGGGGTGG + Intergenic
1034437715 7:151071049-151071071 CTGCCAAAGCAGCATGGGGATGG - Intronic
1034636926 7:152575053-152575075 CTGTTCAAGCAGGAAGGGAATGG + Intergenic
1034851312 7:154496634-154496656 CCTCTTCAACAGAAAGGGGAAGG + Intronic
1035259206 7:157650769-157650791 CAGCTGCAGCAGAAAGGGGCTGG - Intronic
1038370419 8:26983612-26983634 CTGCTTAGGAACAAAAGGGAAGG + Intergenic
1038887210 8:31676567-31676589 CTGATTAAGCAGATATGGGGTGG - Intronic
1038887216 8:31676578-31676600 CTGCTTAATCAGAAAGGCCTGGG + Intronic
1041360553 8:57049224-57049246 ATGCCTAAGCAGATAGGGGTGGG + Intergenic
1041755145 8:61305338-61305360 GTGGTTAATCAGAGAGGGGAAGG - Intronic
1042087921 8:65128850-65128872 TTCCTACAGCAGAAAGGGGATGG - Intergenic
1042454883 8:68989494-68989516 CTGCTTAGGCAGAAAGGGCCTGG - Intergenic
1043917368 8:85938490-85938512 CTGTTAAAGAAGAAAGAGGAAGG - Intergenic
1044376044 8:91472300-91472322 CTGCAAAATCAGAAAGGAGATGG - Intergenic
1044708964 8:95036947-95036969 ATGCTCCAGCAGAATGGGGAAGG - Intronic
1045559075 8:103243644-103243666 CTGCTTAGGCAGAAGGAGCAGGG + Intergenic
1045938011 8:107705490-107705512 CTGCTTATGCAGATAAGGAAGGG - Intergenic
1046178796 8:110614869-110614891 ATCCTTAAGAAGAATGGGGATGG + Intergenic
1050691325 9:8230294-8230316 CTGCTTAAGTATACAAGGGAAGG - Intergenic
1051553488 9:18356346-18356368 ATGCTTAGGCAGACAGGGGCGGG - Intergenic
1055011034 9:71565804-71565826 CTGCTTAGGAACAAAGGGAAAGG - Intergenic
1055224432 9:73977188-73977210 CTACATAAGTAGAAAGAGGAAGG + Intergenic
1055420672 9:76137894-76137916 TTTCCTAAGCAGAAAGGGAAGGG - Intronic
1055791338 9:79926220-79926242 CCACTTCAGGAGAAAGGGGAAGG + Intergenic
1058694181 9:107545451-107545473 CTGTTTAAGCAGAACCGGGGTGG - Intergenic
1060022038 9:120140120-120140142 CAGCCTACCCAGAAAGGGGAAGG - Intergenic
1060608824 9:124941762-124941784 CTTCCTAAGCAGAAAGGAGACGG - Intronic
1061602140 9:131677754-131677776 CTGCTCAAGCAGACCAGGGAAGG + Intronic
1061752194 9:132786818-132786840 CTGGTTATGCAGAAAGGAAAAGG + Intronic
1187034280 X:15521631-15521653 CTGGTTCTGCAGACAGGGGAAGG - Intronic
1187370268 X:18699667-18699689 CTTCATCAGCAGAAAGGGAAAGG - Intronic
1188495445 X:30779059-30779081 ATGCCTAAGCAGATAGGGGTAGG + Intergenic
1190007466 X:46754472-46754494 CTGATTAACCAGGAAGGAGATGG + Intronic
1191900020 X:66031297-66031319 CTGGTCAAGCAGAGAGGGCAGGG - Intronic
1192016198 X:67334244-67334266 TTTCTTCACCAGAAAGGGGAAGG + Intergenic
1192366462 X:70477817-70477839 TTGCTAAAGCCTAAAGGGGAAGG - Intronic
1192873228 X:75204771-75204793 CTGCGCCAGCAGAGAGGGGAGGG + Intergenic
1192924155 X:75737986-75738008 ATGCTGAAGTAAAAAGGGGAAGG + Intergenic
1194633198 X:96311970-96311992 TAGCTTGAGCTGAAAGGGGAGGG + Intergenic
1196655498 X:118213536-118213558 CTGCTTACACAGAAAGGTGAAGG + Intergenic
1196974794 X:121147530-121147552 CTGCCTCAGCAGAAAATGGAAGG + Intergenic
1197651442 X:129069417-129069439 CTGCTTAACAAGATGGGGGAAGG + Intergenic
1199093955 X:143719242-143719264 CGGCTCCGGCAGAAAGGGGAGGG - Intronic
1199704886 X:150415509-150415531 TTGCATAAGCAAAAAGAGGAAGG + Intronic
1201010424 Y:9545471-9545493 CTGATCAAGGAGAAAGAGGAGGG + Intergenic