ID: 906815307

View in Genome Browser
Species Human (GRCh38)
Location 1:48872838-48872860
Sequence CCTTCCTGTTAGGCCCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 303}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906815307_906815314 14 Left 906815307 1:48872838-48872860 CCCCCAGGGGCCTAACAGGAAGG 0: 1
1: 0
2: 0
3: 20
4: 303
Right 906815314 1:48872875-48872897 AAAGGAAGAATCACTCTAAACGG 0: 1
1: 0
2: 2
3: 34
4: 388
906815307_906815317 17 Left 906815307 1:48872838-48872860 CCCCCAGGGGCCTAACAGGAAGG 0: 1
1: 0
2: 0
3: 20
4: 303
Right 906815317 1:48872878-48872900 GGAAGAATCACTCTAAACGGGGG 0: 1
1: 0
2: 0
3: 2
4: 63
906815307_906815318 26 Left 906815307 1:48872838-48872860 CCCCCAGGGGCCTAACAGGAAGG 0: 1
1: 0
2: 0
3: 20
4: 303
Right 906815318 1:48872887-48872909 ACTCTAAACGGGGGAGCAACAGG 0: 1
1: 0
2: 0
3: 1
4: 41
906815307_906815313 -4 Left 906815307 1:48872838-48872860 CCCCCAGGGGCCTAACAGGAAGG 0: 1
1: 0
2: 0
3: 20
4: 303
Right 906815313 1:48872857-48872879 AAGGCGAAGCAAAGAGAAAAAGG 0: 1
1: 0
2: 4
3: 68
4: 741
906815307_906815315 15 Left 906815307 1:48872838-48872860 CCCCCAGGGGCCTAACAGGAAGG 0: 1
1: 0
2: 0
3: 20
4: 303
Right 906815315 1:48872876-48872898 AAGGAAGAATCACTCTAAACGGG 0: 1
1: 0
2: 3
3: 21
4: 268
906815307_906815316 16 Left 906815307 1:48872838-48872860 CCCCCAGGGGCCTAACAGGAAGG 0: 1
1: 0
2: 0
3: 20
4: 303
Right 906815316 1:48872877-48872899 AGGAAGAATCACTCTAAACGGGG 0: 1
1: 0
2: 2
3: 15
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906815307 Original CRISPR CCTTCCTGTTAGGCCCCTGG GGG (reversed) Intronic
900597789 1:3490397-3490419 CCTTCCTTTGAGGGCCGTGGAGG - Exonic
900700607 1:4046582-4046604 ACTTCCTGTGAGGACACTGGCGG + Intergenic
900752418 1:4407029-4407051 CCTGCCTGTTTGGCCCCTTGGGG - Intergenic
901539950 1:9909618-9909640 CCTTCCTGGAAGGTACCTGGTGG - Intronic
901716785 1:11161504-11161526 CCTCCCAGTTAGGCTACTGGGGG - Intronic
901848792 1:12001925-12001947 CCTTGGTTGTAGGCCCCTGGTGG + Intronic
902893653 1:19463642-19463664 CTTTCCTTTGAGGCCCCAGGAGG + Intronic
903554954 1:24186770-24186792 CGTTCCTGCCAGGCCTCTGGTGG - Intronic
904377421 1:30090533-30090555 GCTTCCAGAGAGGCCCCTGGGGG + Intergenic
905888505 1:41504845-41504867 CCCTCCTTTTAGGCCACTGTGGG + Intergenic
906815307 1:48872838-48872860 CCTTCCTGTTAGGCCCCTGGGGG - Intronic
917117635 1:171618498-171618520 TCTTCCTGTAAGGCCCATGAGGG + Intergenic
917496948 1:175549123-175549145 CCTTCCTATCAGGGGCCTGGGGG - Intronic
918087631 1:181258994-181259016 CTTGCCTGTTTGGCCACTGGTGG + Intergenic
918461144 1:184778015-184778037 CTTTCATGTTAGGCCTCTTGGGG + Intergenic
918855865 1:189755507-189755529 CCTCCCAGTTAGGCCCCTCGGGG - Intergenic
921844530 1:219864279-219864301 CCTCCCAGTTAGGCTGCTGGAGG - Intronic
924164161 1:241264907-241264929 ACTTGCAGTTAGGCCGCTGGAGG - Intronic
1062879571 10:967033-967055 CCTTCCTGTTAGGATCTTTGTGG - Intergenic
1067390180 10:45856526-45856548 CCTTCCTGCAAATCCCCTGGAGG - Intergenic
1067873097 10:49979541-49979563 CCTTCCTGCAAATCCCCTGGAGG + Intergenic
1069558712 10:69414929-69414951 TCCTCCTGTAAGGCCTCTGGGGG - Exonic
1069599775 10:69696381-69696403 CCTTGCACTGAGGCCCCTGGGGG - Intergenic
1069617500 10:69815445-69815467 CCTTCCTGTTTTGCCCCTGCTGG - Intronic
1070427513 10:76304033-76304055 CCTTCCCCTTTGGTCCCTGGAGG + Intronic
1070669756 10:78369586-78369608 CCTGCCTGTAAGGCCCCTTCAGG + Intergenic
1070723212 10:78770952-78770974 CCATACTGTTAGTCCTCTGGAGG - Intergenic
1070852437 10:79576826-79576848 TCATCCTGTCTGGCCCCTGGAGG - Intergenic
1070917823 10:80166315-80166337 CTTTTCTCTCAGGCCCCTGGGGG - Intronic
1071999149 10:91177327-91177349 CCTTCCAGTTAGGCTACTCGGGG + Intronic
1072364603 10:94696201-94696223 CCTCCCAGTTAGGCTACTGGGGG - Intronic
1072405478 10:95148083-95148105 CCTTCCAGTTAGGCTCCTCAGGG - Intergenic
1073588196 10:104731179-104731201 CCTTCTTGTGAGGACCCTGGAGG + Intronic
1074783043 10:116815914-116815936 CCTTCCTCTTAGGGCCGCGGGGG - Intergenic
1076475333 10:130747848-130747870 CATGTCTGTTAGGTCCCTGGTGG - Intergenic
1077058812 11:608882-608904 CCTTCCTGTCTGGCCGCTCGTGG - Exonic
1077907918 11:6548034-6548056 CCATCCTGGTAGGTACCTGGAGG - Exonic
1077980267 11:7292925-7292947 CCTTCCTGTTAGGCAGCAAGTGG + Intronic
1078242747 11:9545631-9545653 CCTCCCAGTTAGGCTGCTGGGGG + Intergenic
1078726714 11:13938786-13938808 CCTTCCAGTTAGGCTACTCGGGG + Intergenic
1079037507 11:17033923-17033945 CCTCCCAGTTAGGCCACTTGGGG + Intergenic
1080081332 11:28221974-28221996 CCTTCCAGTTAGGCTACTGAGGG + Intronic
1081564183 11:44247014-44247036 CATCCCAGTTAGGCCCCTGGGGG - Intergenic
1081623099 11:44630758-44630780 CCATCCTTTTGGGCCACTGGTGG - Intergenic
1081719044 11:45273308-45273330 CCTCCCTGCTAGGTGCCTGGGGG - Intronic
1081783113 11:45727261-45727283 TCTACCTGTGAGGCCCCTGCTGG + Intergenic
1081937670 11:46916756-46916778 CTTTCCTCTCAGCCCCCTGGAGG - Intronic
1082103138 11:48191165-48191187 CCTTCCAGTTAGGCTACTTGGGG + Intergenic
1082970559 11:59015950-59015972 CCTTCCAGTTAGGCTGCTCGGGG - Intronic
1083829288 11:65221089-65221111 CCTACCTGATTCGCCCCTGGCGG + Intergenic
1084028956 11:66469651-66469673 CCCTCCTGTCAGCCCCCTTGGGG + Intronic
1085966992 11:81539708-81539730 CCTCCCAGTTAGGCCACTCGGGG + Intergenic
1086102469 11:83115745-83115767 CCCGCCTGTTTGCCCCCTGGAGG + Intergenic
1087451533 11:98330192-98330214 CCTCCCAGTTAGGCTGCTGGAGG + Intergenic
1088391433 11:109319238-109319260 CCATGCTGTTAGGCCCATGTAGG - Intergenic
1089012724 11:115143905-115143927 CCCCCCTCTCAGGCCCCTGGTGG + Intergenic
1089602309 11:119623581-119623603 CCTTCCTGTAAGGGCACTTGTGG - Intronic
1091185335 11:133641512-133641534 CCTCCCAGTTAGGCTGCTGGGGG - Intergenic
1091654217 12:2333503-2333525 CCTTCCCCTTAGGCCACTGTGGG - Intronic
1095089685 12:38092037-38092059 CCTCCCTGTTAGGCTACTTGGGG - Intergenic
1095191298 12:39261123-39261145 CCTCCCAGTTAGGCCACTCGGGG - Intergenic
1095483374 12:42658789-42658811 CCTTCCAGTTAGGCTACTTGGGG + Intergenic
1095937674 12:47703658-47703680 CCTCCCTGTTAGTCACTTGGCGG - Intronic
1096030304 12:48408591-48408613 CCTCCCTGTTAGGCTGCTCGGGG + Intergenic
1096092496 12:48912486-48912508 CATGACTGTTAGGCTCCTGGAGG + Intronic
1096111776 12:49033226-49033248 CCTGTCTGTGAGGGCCCTGGGGG + Exonic
1096962189 12:55590648-55590670 CCTCCCTGTTAGGCTGCTCGGGG - Intergenic
1098683944 12:73395520-73395542 CCTCCCAGTTAGGCCGCTCGGGG - Intergenic
1099146070 12:79044921-79044943 CCTCCCAGTTAGGCCGCTCGGGG + Intronic
1099258199 12:80342770-80342792 CCTTCCTACTAGGCTCCTTGAGG - Intronic
1101345291 12:103880589-103880611 ACTTGCTGAGAGGCCCCTGGGGG + Intergenic
1101376743 12:104177898-104177920 CCCTCCTGTTACAGCCCTGGTGG + Intergenic
1105420065 13:20243985-20244007 CCTTCCAGTTAGGCTACTCGGGG - Intergenic
1106494241 13:30260070-30260092 CCTCCCAGTTAGGCTGCTGGGGG - Intronic
1108105042 13:46999506-46999528 CCTTCCTGTTAGGTAACTGATGG + Intergenic
1108681902 13:52787742-52787764 ATTTCCTGTGAGGCCCCAGGGGG - Intergenic
1110586540 13:77199740-77199762 CCTCCCAGTTAGGCTGCTGGAGG - Intronic
1113437980 13:110307679-110307701 GCCTCCCGTTAGGCCCCTGTGGG - Intronic
1113681229 13:112246308-112246330 CATTCCAGTCAGCCCCCTGGAGG + Intergenic
1113964416 13:114144549-114144571 CCTTCCTGCACAGCCCCTGGGGG + Intergenic
1114765832 14:25369960-25369982 CCTCCCAGTTAGGCTACTGGGGG + Intergenic
1116038402 14:39656589-39656611 CCTCCCAGTTAGGCTGCTGGGGG - Intergenic
1116042537 14:39703006-39703028 CCTCCCTGTTAGGCTGCTTGGGG + Intergenic
1117852732 14:59992032-59992054 CCTCCCAGTTAGGCTCCTCGGGG - Intronic
1117945441 14:61014805-61014827 CCTCCCAGTTAGGCTCCTCGGGG + Intronic
1118321033 14:64753547-64753569 CCTTCTTGTTGGGCCCCTCCAGG + Exonic
1118887132 14:69877031-69877053 CCATCCTGTTGAGCCCCTGGAGG + Intronic
1119097572 14:71848263-71848285 CCTTCCAGTTAGGCTGCTCGGGG + Intergenic
1119111731 14:71981553-71981575 CCTCCCAGTTAGGCCGCTCGGGG + Intronic
1119918175 14:78422064-78422086 CCTTCCTCACAGGTCCCTGGAGG + Intronic
1122853557 14:104548958-104548980 CCTCCCAGTTCGGCCCTTGGAGG + Intronic
1122929629 14:104927387-104927409 CCTTCCCTTTATGCCCCTGCTGG + Intronic
1122943978 14:104996658-104996680 CCGTCCTTTTTGGCCACTGGAGG - Intronic
1122981666 14:105194980-105195002 CCTGCCTCTGAGGCTCCTGGGGG - Intergenic
1123113716 14:105884449-105884471 CCTGCCTGTTGGGAGCCTGGCGG + Intergenic
1123115943 14:105894088-105894110 CCTGCCTGTTGGGAGCCTGGCGG + Intergenic
1123117970 14:105903198-105903220 CCTGCCTGTTGGGAGCCTGGCGG + Intergenic
1123120184 14:105912801-105912823 CCTGCCTGTTGGGAGCCTGGGGG + Intergenic
1124569946 15:30854027-30854049 CCTCCCAGTTAGGCCACTCGGGG + Intergenic
1125485116 15:40106128-40106150 CCTTCCAGGTATGGCCCTGGTGG - Intronic
1126034759 15:44536389-44536411 CCTTCCTGTGAGCCCCTTTGAGG - Intergenic
1126171736 15:45700919-45700941 GCTTCCTGTTGGGACCCCGGCGG + Intergenic
1126376985 15:48006688-48006710 CCTTACTGTCAGGTCCCTGATGG - Intergenic
1130315978 15:82797044-82797066 CCTTCCATTTAGTCCCCTGGAGG - Intronic
1130818324 15:87464437-87464459 CCTCCCAGTTAGGCTGCTGGGGG - Intergenic
1131220824 15:90582701-90582723 CCATCCTGTAAATCCCCTGGGGG + Intronic
1131422295 15:92317212-92317234 CCTTGCTCTTGGGGCCCTGGTGG - Intergenic
1131891879 15:96981722-96981744 CCTACCTGTCAAGACCCTGGAGG - Intergenic
1132374292 15:101318585-101318607 CCTTCCTGCTGGGCCCCCAGCGG - Intronic
1134096300 16:11421057-11421079 CCTGCCTGCTAGGCCTCTGCTGG + Intronic
1135042874 16:19131299-19131321 CCTTTCCATTAGGCCACTGGGGG + Intronic
1136545114 16:30950141-30950163 ACTTCCTGTGAGGCCACTGCTGG - Intronic
1137582302 16:49640810-49640832 CCGTCATGTGAGGCCCCCGGGGG - Intronic
1138475627 16:57269217-57269239 CCTCCCTTTGGGGCCCCTGGAGG - Intronic
1138762780 16:59564585-59564607 CCTTCCAGTTAGGCTGCTCGGGG + Intergenic
1138842230 16:60523470-60523492 CCTTCCAGTTAGGCTGCTCGGGG - Intergenic
1139591773 16:67936880-67936902 CCTTCCTCAAAGGCCCGTGGCGG + Exonic
1140053247 16:71501754-71501776 CCTTCCTGGGAGGTCCCTAGTGG - Intronic
1141146305 16:81532679-81532701 CCTTCCTTGGAGGCTCCTGGAGG - Intronic
1141252136 16:82368629-82368651 CCTTCCGATGAGGCACCTGGTGG + Intergenic
1141716915 16:85732158-85732180 CCTTCCTGCCAAGCTCCTGGTGG - Intronic
1142020507 16:87779320-87779342 CCTTCCTCTTAGACCCCGCGAGG - Intergenic
1142514655 17:419569-419591 TCTTCCTGTGGGGCCCATGGTGG - Intronic
1142624105 17:1181091-1181113 CCTTCCTGGTAGGCCTCTGTAGG - Intronic
1145378754 17:22375603-22375625 CCCTCCTCTTATGCCCGTGGCGG + Intergenic
1145379230 17:22377973-22377995 CCCTCCTCTTATGCCCGTGGCGG + Intergenic
1145379708 17:22380343-22380365 CCCTCCTCTTATGCCCGTGGCGG + Intergenic
1145380187 17:22382718-22382740 CCCTCCTCTTATGCCCGTGGCGG + Intergenic
1145380667 17:22385065-22385087 CCCTCCTCTTATGCCCGTGGCGG + Intergenic
1145381145 17:22387440-22387462 CCCTCCTCTTATGCCCGTGGCGG + Intergenic
1145381628 17:22389793-22389815 CCCTCCTCTTATGCCCGTGGCGG + Intergenic
1145381747 17:22390486-22390508 CCCTCCTCTTATGCCCGTGGCGG + Intergenic
1145381881 17:22391215-22391237 CCCTCCTCTTATGCCCGTGGCGG + Intergenic
1145382354 17:22393579-22393601 CCCTCCTCTTATGCCCGTGGCGG + Intergenic
1145383208 17:22397765-22397787 CCCTCCTCTTATGCCCGTGGCGG + Intergenic
1145384159 17:22402435-22402457 CCCTCCTCTTATGCCCGTGGCGG + Intergenic
1145385083 17:22406896-22406918 CCCTCCTCTTATGCCCGTGGCGG + Intergenic
1145385266 17:22407968-22407990 CCCTCCTCTTATGCCCGTGGCGG + Intergenic
1145385714 17:22410326-22410348 CCCTCCTGTTATGCCCGTGGCGG + Intergenic
1147185711 17:38712126-38712148 CCTTCCTCTGAGGCCACTGAGGG + Intronic
1148571877 17:48677021-48677043 CCTCCCTGCTCAGCCCCTGGTGG + Intergenic
1149576174 17:57715276-57715298 CCTCTCTGTGTGGCCCCTGGGGG - Intergenic
1149657219 17:58316537-58316559 CCTTTCTGTTTGCCCCCAGGTGG - Exonic
1149971858 17:61226977-61226999 CCTTCCTGATGGGACCCTCGAGG + Intronic
1151219646 17:72603013-72603035 ACTTCCAGTTAACCCCCTGGAGG - Intergenic
1152137591 17:78513978-78514000 CGTTCCTGTTAGCCTTCTGGAGG + Intronic
1153296642 18:3552538-3552560 CCTTGCTGTCGGGACCCTGGGGG + Intronic
1155451181 18:25964164-25964186 CCTTCCTGCCATGCCCCTGGAGG - Intergenic
1156725257 18:40119482-40119504 CCTCCCAGTTAGGCCACTCGGGG + Intergenic
1158074460 18:53512159-53512181 CCTCCCAGTTAGGCTGCTGGGGG - Intronic
1158347083 18:56526276-56526298 CCTCCCAGTTAGGCTCCTCGGGG - Intergenic
1161588619 19:5118622-5118644 CCTTCCTGGAAAGACCCTGGAGG + Intronic
1163655717 19:18543672-18543694 CCTTCCTGCTTGGCCCCGCGGGG + Intronic
1163826388 19:19527087-19527109 CCCTCCTCTCAGGCTCCTGGTGG + Intronic
1165011066 19:32846738-32846760 CCTCCCAGTTAGGCTGCTGGGGG - Intronic
1166882369 19:45937403-45937425 CCTTCCTCATAGGGTCCTGGGGG + Exonic
1167781754 19:51602854-51602876 TCTTTCTGTAAGGACCCTGGAGG - Intergenic
926383529 2:12314448-12314470 CCTTCCTGTTTGGTCTCGGGTGG + Intergenic
932077541 2:68679341-68679363 CCTCCCTGTTAGGCTGCTTGGGG + Intergenic
932497337 2:72152922-72152944 CCTTTCTGTTTGGCTCCGGGTGG - Intergenic
932520268 2:72404428-72404450 CCTTCCAGTTAGGCTACTCGGGG - Intronic
933794226 2:85906927-85906949 CCTTCCAGGCAGGTCCCTGGAGG - Intergenic
936068474 2:109349676-109349698 TCCTCCTGTGAGGCCCCTGGAGG - Intronic
937324112 2:120978732-120978754 CCTGCCTGTTTGGGTCCTGGAGG + Intronic
939859140 2:147396852-147396874 CCCTCCTGGGAAGCCCCTGGAGG - Intergenic
940226737 2:151408933-151408955 TTCTTCTGTTAGGCCCCTGGGGG - Intergenic
941553110 2:166940867-166940889 CCTCCCTGTTAGGCTACTCGGGG + Intronic
942241324 2:173965483-173965505 GCTTCCTGTTTGCCCCCGGGTGG + Exonic
942508807 2:176673752-176673774 CCTTCCTGATTGGCCCCTGTTGG - Intergenic
942717045 2:178904894-178904916 CCTTCCAGTTATGACCTTGGTGG - Intronic
943383210 2:187174952-187174974 CCTTCCTGAGAGGCCCCTCATGG + Intergenic
945957032 2:216096011-216096033 CCTTCCTGAGAGAGCCCTGGTGG - Exonic
946622911 2:221577674-221577696 CCTCCTTCTTGGGCCCCTGGTGG - Intergenic
946841518 2:223824823-223824845 CCTTCCTTTTAGGCCAGTTGCGG - Intronic
948653241 2:239462124-239462146 CCTTCCTGGACGGCACCTGGAGG + Intergenic
1169154329 20:3316631-3316653 CCTCTTTGTTGGGCCCCTGGTGG - Intronic
1169608891 20:7356330-7356352 CCTTCCGTTTATACCCCTGGAGG + Intergenic
1169829133 20:9803990-9804012 CCTTCCAGGTAGGCCTCTGGAGG - Intronic
1170476031 20:16715273-16715295 CTTTCATTTTAGGCCACTGGAGG - Intergenic
1174784369 20:53418831-53418853 CCTTAGTGTTAGGCCTTTGGCGG - Intronic
1176004423 20:62852447-62852469 TCTTCCTTTTAGGCCACTGAGGG + Intronic
1176057698 20:63157479-63157501 CTGCCCTGTTAGGCTCCTGGGGG + Intergenic
1176635422 21:9188505-9188527 CCTCCCTGTTAGGCTACTCGGGG + Intergenic
1176938071 21:14889558-14889580 CCTTCCTGCAAGTTCCCTGGTGG - Intergenic
1177273198 21:18875371-18875393 CCTTCCAGTTAGGCTGCTCGGGG + Intergenic
1178760195 21:35394825-35394847 CCTTGCTGTGTGGCCCCTGTAGG - Intronic
1179137010 21:38688322-38688344 GCTCCCTGTTAGACTCCTGGAGG + Intergenic
1180506960 22:16021726-16021748 CCTTCCAGTTAGGCTGCTCGGGG - Intergenic
1180575236 22:16767079-16767101 CCTTCCAGTTAGGCTGCTCGGGG - Intergenic
1180699057 22:17771945-17771967 CACACCTGTTAGGCCACTGGGGG - Intronic
1182289103 22:29265374-29265396 CATCCCTGTTTGACCCCTGGAGG + Intronic
1182707939 22:32299948-32299970 CCTTCCAGTTAGGCTGCTCGGGG + Intergenic
1183578605 22:38708566-38708588 CCTTCCTGTTAAGCAGCAGGAGG + Intronic
1184784237 22:46664128-46664150 CCACCCTGCTCGGCCCCTGGAGG - Intronic
1203331696 22_KI270739v1_random:42-64 CCTTCCAGTTAGGCTGCTCGGGG + Intergenic
949678910 3:6490200-6490222 CCTCCCTATTAGGCTGCTGGGGG + Intergenic
949717498 3:6950477-6950499 CCTCCCAGTTAGGCTGCTGGGGG + Intronic
950147098 3:10657817-10657839 CCTCCCAGTTAGGCTCCTTGGGG - Intronic
951198930 3:19855760-19855782 CCTCCCAGTTAGGCTGCTGGGGG - Intergenic
952893325 3:38059224-38059246 CCTTCATCTTAGACCCCAGGGGG - Intronic
954537091 3:51368774-51368796 CCTCCCAGTTAGGCTCCTGAGGG - Intronic
955606551 3:60710995-60711017 CCTCCCTGTTAGGCTGCTCGGGG - Intronic
955756269 3:62228049-62228071 CCTGCCTGTTTGGCCCCTGTGGG + Intronic
957061857 3:75488885-75488907 CCTTCCAGTTAGGCTACTCGGGG + Intergenic
959063159 3:101633875-101633897 TCTTCCTCTTAGACCCGTGGTGG + Intergenic
959295495 3:104530093-104530115 CATTGCTGTTGGCCCCCTGGAGG - Intergenic
961810348 3:129518458-129518480 CCTCCCAGTGTGGCCCCTGGGGG - Intronic
963109093 3:141670614-141670636 CCTCCCAGTTAGGCTACTGGGGG - Intergenic
963847698 3:150176533-150176555 CATTCCTGTTAGAAACCTGGAGG + Intergenic
967088522 3:186115473-186115495 GCTTCCTTTTATGCCCATGGTGG + Intronic
968157093 3:196390426-196390448 CTTACCTGTTAGGACCCTGTAGG - Intronic
968480136 4:829554-829576 CCCTCCTGCTGGGCCCATGGGGG - Intergenic
969222020 4:5767193-5767215 CCTCCCAGTTAGGCTCCTCGGGG + Intronic
969876116 4:10136763-10136785 CCTTACTGTGTGGCCACTGGAGG + Intergenic
971053898 4:22891573-22891595 CCTCCCAGTTAGGCTACTGGGGG + Intergenic
972921790 4:43951651-43951673 CCTCCCAGTTAGGCTACTGGGGG - Intergenic
974703912 4:65487068-65487090 GCTTCTTGTGAGGCCCCAGGAGG - Intronic
974723472 4:65771561-65771583 CCTCCCTGTTAGGCTACTCGGGG + Intergenic
975062370 4:70018942-70018964 CCTCCCAGTTAGGCTCCTCGGGG + Intergenic
975181289 4:71348599-71348621 CCTTCCTGAGAGGCACATGGAGG + Intronic
977191568 4:94007448-94007470 CTTTCCTGTTGTGCCCCTAGAGG - Intergenic
977492946 4:97736931-97736953 CCTCCCTGTTAGGCTGCTGGGGG - Intronic
982310816 4:153983497-153983519 CCTTCCAGTTAGGCTACTCGGGG + Intergenic
982820117 4:159934492-159934514 CCTCCCTGTTAGGCTACTCGGGG + Intergenic
983140401 4:164142520-164142542 CCTCCCAGTTAGGCTGCTGGGGG - Intronic
985234884 4:187862185-187862207 CCTTCCAGTTAGGCTGCTCGGGG + Intergenic
985651866 5:1111361-1111383 CCTTCCTGTTCCGCCTCTGGGGG + Intronic
985776470 5:1846640-1846662 CCTTCATGTTGGGGGCCTGGAGG + Intergenic
988646521 5:33101320-33101342 CCTTCCAGTTAGGCTGCTCGGGG + Intergenic
990437549 5:55808737-55808759 CCTCCCAGTTAGGCTCCTTGGGG + Intronic
990860333 5:60319904-60319926 CCTCCCAGTTAGGCTACTGGGGG + Intronic
992659477 5:78944699-78944721 CCTCCCTGTTAGGCTACTCGGGG + Intronic
993864087 5:93171966-93171988 CCTCCCTGTTAGGCTACTTGAGG + Intergenic
994290452 5:98023299-98023321 CCTCCCAGTTAGGCTGCTGGGGG - Intergenic
994925944 5:106117472-106117494 CCTTCCTTTTCAGCCCCTGAGGG - Intergenic
994948845 5:106430677-106430699 CCTCCCAGTTAGGCTGCTGGGGG + Intergenic
995338540 5:111030437-111030459 CCTTCCAGTTAGGCTACTCGGGG - Intergenic
997797793 5:136828434-136828456 CCTCCCAGTTAGGCCACTCGGGG + Intergenic
998836003 5:146203605-146203627 AGTTCCTGTTAGGCCCCGGCCGG + Exonic
999265706 5:150265472-150265494 CCTTAGTCTCAGGCCCCTGGCGG + Intronic
999947196 5:156610463-156610485 CCTCCCAGTTAGGCTCCTCGGGG + Intronic
1000033663 5:157425045-157425067 TCTCCCAGTTAGGCTCCTGGGGG - Intronic
1202775456 5_GL000208v1_random:65989-66011 CCTCCCAGTTAGGCTTCTGGGGG - Intergenic
1003370583 6:5522197-5522219 CCTTGCTGTGAGGGCCTTGGTGG - Intronic
1005622775 6:27635395-27635417 AAGTCCTGGTAGGCCCCTGGAGG - Intergenic
1005989264 6:30893104-30893126 CCTTCCCGCCAGCCCCCTGGTGG + Exonic
1008262808 6:49387592-49387614 CCTCCCAGTTAGGCTGCTGGGGG - Intergenic
1008561832 6:52731817-52731839 CCTTGCTGCTAGGCACATGGCGG - Intergenic
1008566752 6:52776646-52776668 CCTCCCAGTTAGGCTCCTCGGGG + Intergenic
1009191503 6:60635209-60635231 CCTCCCTGTTAGGCTACTTGGGG + Intergenic
1010031091 6:71271219-71271241 CCTCCCAGTTAGGCCACTCGGGG - Intergenic
1010692010 6:78921644-78921666 CCTCCCAGTTAGGCCACTCGTGG - Intronic
1010828068 6:80497564-80497586 CCTCCCTGTTAGGCTGCTCGGGG + Intergenic
1010876859 6:81117470-81117492 CCTCCCTGTTAGGCTACTTGGGG + Intergenic
1010957060 6:82102010-82102032 CCTCCCAGTTAGGCTGCTGGGGG - Intergenic
1011306727 6:85935862-85935884 CCTCCCAGTTAGGCTCCTCGGGG + Intergenic
1011711074 6:90054693-90054715 CCTCCCAGTTAGGCTCCTCGGGG - Intronic
1012429762 6:99152230-99152252 ACTTCCTCTTTGGCCGCTGGAGG + Intergenic
1013704263 6:112813732-112813754 CCTCCCAGTTAGGCTGCTGGGGG - Intergenic
1016520283 6:144939050-144939072 CCTTTCTGTAAGGTTCCTGGGGG + Intergenic
1017254163 6:152314448-152314470 CTTTCCTCTTAAACCCCTGGTGG + Intronic
1017725468 6:157273783-157273805 CCTCCCTGTGAGCCTCCTGGGGG - Intergenic
1018974592 6:168555431-168555453 CTTCCCTGCTTGGCCCCTGGTGG - Intronic
1019577402 7:1744121-1744143 CCTTCCTCAGAAGCCCCTGGGGG - Intronic
1019653054 7:2171079-2171101 CCTTGCTGCTACGCCACTGGTGG + Intronic
1019695475 7:2443716-2443738 CCCTCCTGTTGGGTCTCTGGCGG + Intergenic
1019894328 7:3972021-3972043 CCTTCCTATTAGTGCACTGGGGG - Intronic
1019996264 7:4726312-4726334 CCTTCCTGGCAGGCCCCTCCTGG + Intronic
1022738930 7:33102880-33102902 CCTGCCTGCCAGGCCCCTGAGGG - Intronic
1024694237 7:51838755-51838777 CCTCCCAGTTAGGCTGCTGGGGG + Intergenic
1025593902 7:62900564-62900586 CCTTCCAGTTAGGCTACTTGGGG - Intergenic
1025737203 7:64161229-64161251 CCTCCCAGTTAGGCCACTCGGGG - Intronic
1028041755 7:86062372-86062394 CCTTCCTCTTATGCCCCTTTTGG - Intergenic
1029811980 7:103058432-103058454 CCTTTTTGTTAGGTCCCTGTAGG - Intronic
1029951620 7:104592528-104592550 TCTCCCAGTTAGGCCACTGGGGG + Intronic
1034260060 7:149749657-149749679 CCTTCCTGTCATCCCCCTGGGGG + Intergenic
1034415213 7:150961020-150961042 CCTGCCTGGTGGGTCCCTGGGGG - Intronic
1035655205 8:1300312-1300334 CCTTCCCCTCAGTCCCCTGGAGG - Intergenic
1036139301 8:6191787-6191809 CCTCCCAGTTAGGCCACTCGGGG - Intergenic
1037801884 8:22040447-22040469 CCTTCCTGTTGGGCACCTGCAGG - Intergenic
1037942684 8:22964605-22964627 CCTTCATGTGAGTCCCCTGAGGG - Intronic
1038226165 8:25660217-25660239 CCTCCCAGTTAGGCTCCTCGGGG + Intergenic
1038317946 8:26503382-26503404 CCTCCCTGTGCAGCCCCTGGAGG - Intronic
1044211612 8:89557632-89557654 CCTCCCAGTTAGGCTGCTGGGGG + Intergenic
1044403059 8:91794264-91794286 CCTTCCAGTTAGGCTGCTGGGGG - Intergenic
1044909763 8:97044905-97044927 CCTCCCAGTTAGGCTGCTGGGGG + Intronic
1045901197 8:107282264-107282286 ACTTTCTGTTAGGTCCCTGCAGG + Intronic
1046704488 8:117435022-117435044 CCTCCCAGTTAGGCTACTGGGGG - Intergenic
1048134529 8:131735818-131735840 CCTTTCTGTCCTGCCCCTGGAGG + Intergenic
1049574074 8:143382449-143382471 CCGTCCTGCTGGGCCCCAGGGGG + Exonic
1050628266 9:7531367-7531389 CTTTCCTGCTAGGACTCTGGTGG + Intergenic
1050787750 9:9426626-9426648 CCTTCCAGTTAGGCGACTCGGGG - Intronic
1052700981 9:31937641-31937663 CCTCCCAGTTAGGCTGCTGGGGG + Intergenic
1053718052 9:40916497-40916519 CCTCCCTGTTAGGCTGCTAGAGG - Intergenic
1055548610 9:77409015-77409037 CCTCCCAGTTAGGCTCCTTGGGG - Intronic
1055745514 9:79439674-79439696 CCTCCCAGTTAGGCTCCTCGGGG - Intergenic
1056284751 9:85076955-85076977 CCTCCCAGTTAGGCTCCTCGGGG + Intergenic
1056439957 9:86611329-86611351 CCTCCCAGTTAGGCTCCTCGGGG + Intergenic
1056582583 9:87902836-87902858 CCTCCCAGTTAGGCTCCTCGGGG - Intergenic
1056951453 9:91043552-91043574 CCTTCCAGCCATGCCCCTGGTGG + Intergenic
1057391652 9:94645826-94645848 CCTTCCTGTTCTGGACCTGGTGG + Intergenic
1057839556 9:98474732-98474754 CCTTCCACTTAGGCTCCAGGAGG + Intronic
1059865086 9:118505227-118505249 CCTCCCAGTTAGGCCACTCGGGG - Intergenic
1062251983 9:135602864-135602886 CCTTCCTGTTCGCCCTCTGGTGG - Intergenic
1062274579 9:135724781-135724803 CCTTCATGTTGGGCCTCTCGGGG - Intronic
1062464534 9:136675313-136675335 CCTACCTGCTGGCCCCCTGGAGG - Intronic
1203758199 Un_GL000218v1:155811-155833 CCTCCCTGTTAGGCTACTCGGGG + Intergenic
1187426378 X:19181067-19181089 CCTTCCTGTAAGGTGCCTGTTGG + Intergenic
1190291977 X:48999356-48999378 CCTTCCTGCCAGGCCTCTGAGGG + Intronic
1191187061 X:57624281-57624303 CCTCCCAGTTAGGCTACTGGGGG - Intergenic
1191687189 X:63904101-63904123 CCTCCCTGTTAGGCTGCTCGGGG + Intergenic
1191935512 X:66423422-66423444 CCTTCCAGTTAGGCTACTTGGGG + Intergenic
1194068718 X:89293340-89293362 CCTTCCAGTTAGGCTGCTTGGGG - Intergenic
1194951813 X:100135650-100135672 CCTCCCAGTTAGGCTGCTGGGGG - Intergenic
1195764113 X:108277712-108277734 CCTTCCAGTTAGGCTGCTCGGGG - Intronic
1197859984 X:130959639-130959661 CCTCCCAGTTAGGCTCCTCGGGG - Intergenic
1197877700 X:131128512-131128534 CCTCCCAGTTAGGCTCCTCGGGG + Intergenic
1198474453 X:136982545-136982567 CCTCCCAGTTAGGCTACTGGGGG + Intergenic
1198928933 X:141831297-141831319 CCTCCATGTGAGGCCCCAGGAGG + Intergenic
1199609922 X:149604474-149604496 CCTTCCTTTCAGGCTCCTTGAGG + Intronic
1200722866 Y:6627495-6627517 CCTTCCAGTTAGGCTGCTTGGGG - Intergenic
1201425953 Y:13851348-13851370 CCTTCCAGTTAGGCTGCTCGGGG + Intergenic
1201867934 Y:18674111-18674133 CTTTCCTGTTAGGCCTCTTAGGG + Intergenic
1201945870 Y:19509502-19509524 CCTCCCAGTTAGGCAACTGGGGG + Intergenic