ID: 906816303

View in Genome Browser
Species Human (GRCh38)
Location 1:48883373-48883395
Sequence TAGGCAAGGAAGGATGTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 5, 3: 14, 4: 206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906816303 Original CRISPR TAGGCAAGGAAGGATGTAGC AGG (reversed) Intronic
900397823 1:2460437-2460459 CAGGCAAGGAAGGACGCAGAGGG + Intronic
905731216 1:40300643-40300665 GAGGCAGGGAAGGAAGTAGTGGG + Exonic
905795939 1:40816686-40816708 TAGAGAAGGAATGATGCAGCAGG - Intronic
905876378 1:41434383-41434405 CAGTCAAGGAAGGAGGCAGCAGG - Intergenic
906580424 1:46930942-46930964 AGGGCAAGGAAGGATGTTTCTGG - Intronic
906816303 1:48883373-48883395 TAGGCAAGGAAGGATGTAGCAGG - Intronic
907569850 1:55473101-55473123 TAGGCAGGGAAGCATGTAATTGG - Intergenic
909664744 1:78120685-78120707 TAGGCAAGAAAGCATGTACAGGG + Intronic
911518691 1:98901416-98901438 ACGCCAAGGAAGGATGTATCAGG + Intronic
916969072 1:169989947-169989969 TAGACAAGGAATTATGTAGTAGG + Intronic
921720897 1:218469949-218469971 TGGGCAAGGATGGGGGTAGCTGG - Intergenic
923334915 1:232959906-232959928 TGGGGAAGTAAGGATGTGGCTGG + Intronic
923522968 1:234750346-234750368 CAGGCCTGGAAGGATGAAGCAGG - Intergenic
1063249915 10:4263591-4263613 TAGGAGAGGCAGGCTGTAGCCGG - Intergenic
1063604028 10:7507392-7507414 CAGACTAAGAAGGATGTAGCAGG + Intergenic
1066442303 10:35450121-35450143 GAAGAAAGCAAGGATGTAGCAGG + Intronic
1066507147 10:36057223-36057245 AAGGCAAGGCAGCATGGAGCTGG - Intergenic
1067247340 10:44557914-44557936 TGTGCAAGGAAGGCTGGAGCAGG - Intergenic
1069714569 10:70512426-70512448 TAGGCCAGGAAGGGGGAAGCAGG + Intronic
1071210287 10:83333984-83334006 TAAGAAAAGAAGGATGGAGCTGG - Intergenic
1071829859 10:89360910-89360932 GAGGCAAGGAAGGATGCTGCGGG - Intronic
1071877937 10:89862692-89862714 TTGGCAGGGAAGGATGGAGGAGG - Intergenic
1073683070 10:105725985-105726007 AAGGGAAGGGTGGATGTAGCAGG + Intergenic
1073881829 10:107990864-107990886 GGGGCAAGGAGGGATGTAGAGGG - Intergenic
1074941880 10:118244443-118244465 AAGGCAAGGAAGCACGTGGCTGG - Intergenic
1075924517 10:126239980-126240002 TTGGCACGGAAGGATGGAGGAGG - Intronic
1076663072 10:132068318-132068340 CAGGCAAGCTAGGATGTGGCTGG + Intergenic
1080740374 11:35058384-35058406 AAGGGAATGAAGAATGTAGCTGG - Intergenic
1081501324 11:43669601-43669623 GAGGCAAGGAAGGATGCTTCTGG - Intronic
1083199269 11:61110012-61110034 GAGGCTAGGAAGGATGGTGCAGG + Intronic
1083520479 11:63306240-63306262 TAGGGAAGGAAGAAGGTAGGGGG - Intronic
1087596776 11:100263969-100263991 TAGCGAAGCATGGATGTAGCAGG - Intronic
1090715473 11:129426726-129426748 CAGGCAAGGAAGGATGGAGTTGG - Intronic
1090753899 11:129771829-129771851 TAGGCAATGACAGAGGTAGCTGG + Intergenic
1090902562 11:131045880-131045902 CAGGGAAGGAAGGAGGTGGCGGG + Intergenic
1091098672 11:132848910-132848932 TACGAAAGGCAGGATGTTGCTGG + Intronic
1091190719 11:133693411-133693433 TAGGCCAGGAATGATGCAGGTGG - Intergenic
1091405670 12:207872-207894 TAGGCTGGGAAGGAGGTAACCGG + Intronic
1096098983 12:48957425-48957447 GAGGGAAGGAAGGAGGGAGCCGG - Exonic
1096968474 12:55647244-55647266 TAGGCAAGGCAAGATGAAGAAGG + Intergenic
1097604197 12:61732277-61732299 TAAGCAAGGAAGAAAGTAGTAGG + Intronic
1098483409 12:70992522-70992544 TAGTCAAGGAAGGATGGAACTGG + Intergenic
1100107607 12:91196002-91196024 TAGGCAAGGAAGAATGTAGTGGG - Intergenic
1100898064 12:99206962-99206984 TAGACAAAGAAAGATGTAGGTGG - Intronic
1101847218 12:108372198-108372220 TGGGCAAGGAATGAAGGAGCAGG + Intergenic
1101917959 12:108910992-108911014 TAGACAAGGAGGGAGGAAGCTGG - Exonic
1104653552 12:130556480-130556502 TAGACAAGGAACAATGTAGAGGG + Intronic
1106366911 13:29090511-29090533 CAGTGAAGGAAGGCTGTAGCTGG + Intronic
1107905743 13:45059505-45059527 GAAGCAAGAAAGGATGTAGCAGG - Intergenic
1110112451 13:71765255-71765277 TAGGCAAGGATAGATGGAACAGG - Intronic
1110646263 13:77888449-77888471 TAGTCATGGAAAGATGTAGCTGG - Intergenic
1113618373 13:111696725-111696747 TAGTCAAGGAAGGCTGTTTCTGG + Intergenic
1113623905 13:111781986-111782008 TAGTCAAGGAAGGCTGTTTCTGG + Intergenic
1117684343 14:58238086-58238108 TAGGAGAGAAAGGAAGTAGCTGG + Intronic
1117940305 14:60957418-60957440 AAGGCAAGAAAGCATGTGGCAGG + Intronic
1119487741 14:75002835-75002857 TCGGCAACGAAGGGCGTAGCCGG + Intergenic
1119740268 14:77009497-77009519 TAGGCAAAGAGGGTTGAAGCAGG - Intergenic
1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG + Intronic
1119911024 14:78349379-78349401 TAGGCACTGAAGGCTGGAGCAGG - Intronic
1123774633 15:23566263-23566285 AAGGAAAGGGAGGATGCAGCCGG - Exonic
1123946938 15:25243365-25243387 TATGTAGGGAAGGAAGTAGCGGG - Intergenic
1123986300 15:25649297-25649319 TAGGGTAGGAAGGAAGCAGCAGG - Intergenic
1126207404 15:46060964-46060986 AAGGCAAGGAAGGAGGGAGGGGG - Intergenic
1128898322 15:71395854-71395876 TGGAAAAGGAAGGTTGTAGCAGG - Intronic
1128935753 15:71745208-71745230 TGGGCAAGGGAAGATGTTGCAGG - Exonic
1130038469 15:80383001-80383023 GAGGCTAGGAAGGGTGGAGCAGG + Intronic
1130461390 15:84160086-84160108 CAGGCAAGGCAGGAGGTGGCCGG - Intergenic
1131237457 15:90709292-90709314 TTCACAAGGAAGGATGTAGTAGG - Intergenic
1131324949 15:91433625-91433647 TTGGCCAGGAAGGATGTACTAGG - Intergenic
1131604981 15:93893935-93893957 TTGTCATGGAAGGATGGAGCAGG + Intergenic
1131807619 15:96138982-96139004 TAGGCAAGGCTGGGTGTAGAAGG - Intergenic
1132708707 16:1257174-1257196 GAGGCCAGGATGGATGGAGCAGG + Intronic
1132941776 16:2512130-2512152 TAGGCCAGGAAGGCTGTGCCTGG - Intronic
1133287976 16:4699331-4699353 CAGGCAGGGCAGGATGTTGCAGG + Intronic
1133309542 16:4835187-4835209 GAGGCAGGGATGGAGGTAGCAGG - Intronic
1133674117 16:8053787-8053809 GAAGTGAGGAAGGATGTAGCGGG + Intergenic
1136140236 16:28283664-28283686 TGGGTAGGGAAGGATGTATCAGG + Intergenic
1139331983 16:66200014-66200036 TAGGCAAAGAAGGAAGAAGTGGG + Intergenic
1141810714 16:86373608-86373630 TCAGCAAGGACGGATGTGGCGGG + Intergenic
1142776592 17:2144855-2144877 TAGGTGAGGAATGATGTAGGAGG - Intronic
1143639377 17:8187038-8187060 GAGGAAAGGATGGATGCAGCTGG - Intergenic
1143901208 17:10176117-10176139 AAGGCAGGGAAGGATGAAGGAGG + Intronic
1144873036 17:18382234-18382256 CAGACAAGGCAGGATGGAGCTGG + Intronic
1147167950 17:38603357-38603379 TAGGCAAGGAGGCAAGTAGAGGG + Intronic
1148206167 17:45781575-45781597 GAGGGAAGGAAGGGTGTAGGAGG + Intergenic
1148649402 17:49238865-49238887 CAGGGAAGGAGGGATGTAGATGG - Intergenic
1149277508 17:55059792-55059814 TAGGCAATGGAGGATTTAACTGG + Intronic
1151445864 17:74163511-74163533 AAAGCAAGGGAGGCTGTAGCTGG + Intergenic
1151748208 17:76022766-76022788 CAGACAAGGCAGGATGGAGCTGG - Intronic
1154302736 18:13208476-13208498 TAGAAAAGGCAGGATGAAGCTGG + Intergenic
1155875323 18:31079805-31079827 TAGCCAAGGAAGTATGTAGCTGG + Intronic
1162450109 19:10749382-10749404 CAGGCAGGGAAGGGTGCAGCTGG - Intronic
1163109885 19:15153235-15153257 TAGGGAAGGAGGGATGGAGAAGG - Intergenic
1165263615 19:34641832-34641854 TAGACTAGGAAAGATCTAGCAGG - Intronic
1168077179 19:53987442-53987464 AGGGGAAGGAAGGAGGTAGCGGG + Exonic
1168344450 19:55643600-55643622 TAGGGAAGGAAGGTTGGGGCGGG - Intronic
1168546907 19:57260300-57260322 TAGGCAAGGAAGGGTGAAATAGG - Intergenic
925245879 2:2382514-2382536 TATGCACAGAAGGATGTTGCTGG - Intergenic
925411505 2:3642499-3642521 TAGGGAGGGAGGGATGAAGCCGG - Intronic
925439884 2:3876359-3876381 AAGGCAAGAAAGGATATGGCTGG + Intergenic
925804898 2:7638927-7638949 TAGGCCAGGTAGGATATGGCAGG + Intergenic
926317555 2:11722238-11722260 AAGGCTAGGAAGGATGGAGCTGG - Intronic
926975793 2:18515579-18515601 TAGGCAGGAAAAGATGAAGCTGG + Intergenic
928331847 2:30363893-30363915 TAGACAAGGAACCAGGTAGCTGG - Intergenic
928635667 2:33243533-33243555 TAGTGAAAAAAGGATGTAGCAGG - Intronic
932776643 2:74531805-74531827 CAGGGAAGGAAGGATGTAGCTGG + Intronic
933276950 2:80294092-80294114 AAGGAAAGGAAGGTGGTAGCGGG + Intronic
933604967 2:84372968-84372990 TAGGCAAGAAAGGAAGTAAAAGG + Intergenic
934487451 2:94729152-94729174 GAGACAAGGAAGGATGCATCAGG - Intergenic
939581959 2:143961155-143961177 TAGCCAAGGAGAGATATAGCTGG + Intronic
940132832 2:150403502-150403524 TTGACAAGTAAGGATGTGGCAGG - Intergenic
940165410 2:150765073-150765095 TAGGCAAGGCATGAAATAGCAGG - Intergenic
940357779 2:152764520-152764542 TAAGCAAGGAAGAATATAGAAGG - Intergenic
942492714 2:176506053-176506075 GAGGCAAGGAAGCATGTTGGGGG + Intergenic
942676379 2:178430704-178430726 TACAGAAGGAAGCATGTAGCAGG - Intergenic
944377946 2:199070029-199070051 TAGGTAAGCCAGGAAGTAGCAGG - Intergenic
945336227 2:208595708-208595730 TAGGCAAGGACGAAGGCAGCAGG + Intronic
945529206 2:210928920-210928942 TATGCCAGGAATGATTTAGCAGG + Intergenic
947652652 2:231800131-231800153 TAGCCAAGGAAGTATGAGGCTGG + Intronic
1170353909 20:15471299-15471321 AATGCAGGGAAGGATGTAGTAGG - Intronic
1170827514 20:19809284-19809306 CAGGCAAAGAAGGCTGAAGCAGG + Intergenic
1172210380 20:33193813-33193835 TAGCCAAGGAAGGAGATGGCAGG - Intergenic
1173258375 20:41411350-41411372 TACTCCAGGAAAGATGTAGCTGG + Intronic
1174096082 20:48090695-48090717 AAGGCAAGGAGGGATGAAGATGG + Intergenic
1178350518 21:31870058-31870080 AAGGGAAGGAAGGAAGCAGCTGG + Intergenic
1180316758 22:11283323-11283345 TGGGCAAGGGAGGGTGGAGCGGG - Intergenic
1180701260 22:17782602-17782624 TAGGAAAGGAAGGATGCCACGGG - Intergenic
1180937715 22:19637070-19637092 TAGGCACGGAAGCATGAAGTAGG - Intergenic
1182895140 22:33853230-33853252 TAGGGAAGGAAGCTTGTGGCAGG - Intronic
1183701933 22:39456070-39456092 TCAGCAAGGATGGATGAAGCTGG + Intergenic
949205880 3:1438921-1438943 AAGACAAGGAAGGGTGTGGCTGG - Intergenic
951855348 3:27190364-27190386 TGGGGAAGGAAGGAAGTAGGTGG + Intronic
954467224 3:50662794-50662816 TAGGCTAGGAAGGATGAATCAGG + Intergenic
956245917 3:67182838-67182860 CATGCAAGGAAGTATGTAACTGG + Intergenic
958124490 3:89338151-89338173 TAAGGAAGGAAGGATTTGGCTGG + Intronic
962425539 3:135266110-135266132 AAGAAAAGTAAGGATGTAGCTGG + Intergenic
964212668 3:154245722-154245744 AAGGAAAGGAAGGATGTAGCAGG - Intronic
965032420 3:163390055-163390077 GAGGCTAGGAAGTATGTAGATGG + Intergenic
965835038 3:172842029-172842051 TAGGAATGGTAGGATGAAGCTGG + Intergenic
966234168 3:177682430-177682452 GAGTCAAGCAAGGATGTAGTTGG + Intergenic
966591394 3:181687337-181687359 TAGGCAAGACAGTATGTGGCAGG + Intergenic
966842895 3:184103853-184103875 GAGGAAAGGAAGGAAGGAGCTGG + Intronic
971501585 4:27324227-27324249 TAGGCAAGGAATGATATATTTGG - Intergenic
972221335 4:36959300-36959322 AAGGCAAGGAAGGAAGTAGAGGG - Intergenic
972612169 4:40666184-40666206 CAGGCAAGGATGGAGGTACCTGG - Intergenic
974676495 4:65096439-65096461 TGGGCAAGGAGGGAGGTAGGGGG + Intergenic
974871659 4:67651709-67651731 TAAGCAAGACAGGATGGAGCTGG + Intronic
976124090 4:81815005-81815027 GAGGAAAGGAGGGATGTGGCGGG + Intronic
977278201 4:95005612-95005634 TAGGAAAGAAAGGAAGGAGCCGG - Intronic
982435572 4:155381208-155381230 GAGGCAATGAAGAAAGTAGCAGG - Intergenic
984787862 4:183585428-183585450 GAGGCAAGGAAGGAGGGAGATGG + Intergenic
988325909 5:29767280-29767302 TAGACAAGGAAGGAAGAAGGGGG + Intergenic
989221919 5:38976088-38976110 TTGTCAAGGAAGAAAGTAGCTGG - Intronic
989641721 5:43589411-43589433 TATGCAAGGAGAAATGTAGCTGG + Intergenic
991299859 5:65119825-65119847 GAGGGAAGGAAGGAGGTAGCAGG - Intergenic
991501726 5:67283510-67283532 TAGGCAAGGACTTATGTAACAGG + Intergenic
994131481 5:96234196-96234218 TATGGAAGAAAGGATGTATCAGG + Intergenic
994303399 5:98173802-98173824 TGAGGAAGGAAGGAGGTAGCAGG - Intergenic
995260286 5:110096035-110096057 GAGGGAAGGAAGGAGGTACCAGG + Intergenic
995894313 5:116994717-116994739 CAGTCAAGGATGGATGAAGCTGG + Intergenic
996403365 5:123086051-123086073 TGGGAGGGGAAGGATGTAGCTGG - Intergenic
997346863 5:133198411-133198433 AAGGCAGGGAAGGATATAGTTGG + Exonic
998308287 5:141101204-141101226 TAGGGACGGAAGGAAGTACCCGG + Exonic
998489053 5:142530104-142530126 TAAACAAGGAAGCATCTAGCAGG + Intergenic
998849691 5:146340957-146340979 TAGGCAAGGAAGGGAGTATAAGG - Intergenic
999204643 5:149839421-149839443 CAGGCAAGGAAGGCTGCAGGTGG + Intronic
999931840 5:156441972-156441994 TATCCAAGGAAGGAGGTAGCAGG + Intronic
1000531834 5:162431896-162431918 TATGCAAGGAAGGACATACCTGG - Intergenic
1001851633 5:174972667-174972689 CAGGCAAGGGAGCATGGAGCTGG - Intergenic
1002783420 6:383859-383881 TAGGCAGGGCAGGATGTGGGGGG - Intergenic
1003342962 6:5239591-5239613 TAGGGAAGGAAGAAAGAAGCTGG + Intronic
1005669881 6:28094529-28094551 TAGGCAAGGAATAAGATAGCTGG - Intergenic
1006717983 6:36132184-36132206 CAGGCAAGGATGGATGTGGCTGG + Intronic
1008148736 6:47924077-47924099 CAGGGAATAAAGGATGTAGCCGG - Intronic
1010772371 6:79846011-79846033 AAGGGAAGGAAGGATGGATCTGG + Intergenic
1012964163 6:105655621-105655643 AAGGCAATGTAGCATGTAGCAGG - Intergenic
1014024512 6:116629850-116629872 TAGGGAGTGAAGAATGTAGCTGG + Intronic
1015606797 6:134965410-134965432 TAGGAAAGGAAGAAAGTTGCAGG - Intronic
1016116777 6:140296160-140296182 GAGGCAGGGAAGGATGTAGCAGG + Intergenic
1017125620 6:151061545-151061567 TAGGAAAGAAATAATGTAGCAGG - Intronic
1018163817 6:161075020-161075042 TAGAGAAGGAAGAATGTGGCTGG + Intronic
1018412342 6:163563671-163563693 TACTCAAGGATTGATGTAGCTGG - Exonic
1020777735 7:12475880-12475902 TAGGCAGGGACGGATTTACCAGG - Intergenic
1021746970 7:23751026-23751048 GAGGCTAGGAAGGATGTGGTAGG - Intronic
1023028223 7:36071072-36071094 TAGACAATGAAGGATGGAGTGGG + Intergenic
1023376498 7:39561337-39561359 TAGGGAAGGGAGGAAGAAGCAGG - Intergenic
1023876770 7:44290482-44290504 CAGGCAAGAAAGGACGTAGGTGG - Intronic
1025152380 7:56568839-56568861 TAGTCAATGAAGAAAGTAGCAGG - Intergenic
1025764818 7:64433937-64433959 TAGTCAATGAAGAAAGTAGCAGG + Intergenic
1028360467 7:89961137-89961159 GAGGTAAGGAAGAATGTATCAGG - Intergenic
1028891619 7:95994403-95994425 CAGGCAAGGAAGGAAGTGGTTGG + Intronic
1032263741 7:130356228-130356250 TGGGCAGGGGAGGAGGTAGCAGG - Intronic
1034490947 7:151392747-151392769 AGGGCAAGGAAGGAGCTAGCAGG - Intronic
1038360806 8:26874039-26874061 AAGGCAAGGAGGGAGGGAGCTGG - Intergenic
1038412470 8:27368884-27368906 TGGGCTAGGAAGGAGGAAGCAGG + Intronic
1038446476 8:27607874-27607896 AAGGCAAGGAAGTAGGTAGCAGG - Intronic
1040636555 8:49281188-49281210 TAGGCAGAGAAGGATGTGGAGGG + Intergenic
1041745617 8:61206327-61206349 TAGGCAAGGAAGTGTGCAGTAGG + Intronic
1047733985 8:127749957-127749979 TAGGAAAGGAAGGATGACGGAGG - Intergenic
1049081540 8:140446975-140446997 AAGGCAAGGAATGCTGGAGCTGG - Intronic
1049632040 8:143664172-143664194 TAGCCAAGGAAGGGTGAAGACGG + Intergenic
1050943622 9:11490320-11490342 TAGACATGAAAGGAAGTAGCTGG + Intergenic
1052895394 9:33742869-33742891 TAGGCAATGACAGAGGTAGCTGG + Intergenic
1053623445 9:39843977-39843999 CAGTGAAGGAAGGATGTAGAGGG + Intergenic
1053670354 9:40355278-40355300 GAGACAAGGAAGGATGCATCAGG + Intergenic
1053881423 9:42599251-42599273 CAGTGAAGGAAGGATGTAGAGGG - Intergenic
1053891239 9:42695061-42695083 CAGTGAAGGAAGGATGTAGAAGG + Intergenic
1053920144 9:42981541-42981563 GAGACAAGGAAGGATGTATCAGG + Intergenic
1054220454 9:62406722-62406744 CAGTGAAGGAAGGATGTAGAGGG - Intergenic
1054230261 9:62502450-62502472 CAGTGAAGGAAGGATGTAGAGGG + Intergenic
1054381474 9:64495263-64495285 GAGACAAGGAAGGATGCATCAGG + Intergenic
1054514258 9:66021022-66021044 GAGACAAGGAAGGATGCATCAGG - Intergenic
1055357623 9:75453890-75453912 TTGGCAAGCAAGGATAAAGCCGG + Intergenic
1058847066 9:108971577-108971599 TAGGCAAGAAAGTATGTACAGGG - Intronic
1059183221 9:112239879-112239901 GAGGCAAGGAAGGATCGATCAGG + Intronic
1060224574 9:121783163-121783185 AAGGCAGGGAAGAAGGTAGCAGG - Intronic
1060423542 9:123486483-123486505 GAGGCCAGGAAGGAAGCAGCTGG + Intronic
1061270916 9:129541676-129541698 TAGGCAAGAAAGCCTGGAGCAGG + Intergenic
1186306101 X:8259820-8259842 TAGCCAAGAAAAGATGCAGCTGG + Intergenic
1186439386 X:9572402-9572424 CAGGAAAGGAAGGTTGTAGAGGG - Intronic
1187500019 X:19832130-19832152 TAGGGCAGAAAGGATGTAGCAGG - Intronic
1188421490 X:29995127-29995149 TAGGCGCTGAAGGATGTAGATGG + Intergenic
1190029327 X:46956686-46956708 AAGGGAAGGAAGAAAGTAGCTGG - Intronic
1192938976 X:75893006-75893028 CAGGCAAGAAAGGATGTCCCAGG + Intergenic
1194725638 X:97392967-97392989 TTGGAAAGGTAGGATGGAGCCGG + Intronic
1199442190 X:147881000-147881022 TGGGCCAGGGAGGATGTATCGGG - Intergenic