ID: 906817981

View in Genome Browser
Species Human (GRCh38)
Location 1:48898947-48898969
Sequence CTGAGAGTAAGGAGGTACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 1, 2: 1, 3: 14, 4: 235}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906817981_906817990 27 Left 906817981 1:48898947-48898969 CCATGGTACCTCCTTACTCTCAG 0: 1
1: 1
2: 1
3: 14
4: 235
Right 906817990 1:48898997-48899019 GATTGCGCTGCTTCCTCCAGAGG 0: 1
1: 1
2: 0
3: 4
4: 84
906817981_906817991 28 Left 906817981 1:48898947-48898969 CCATGGTACCTCCTTACTCTCAG 0: 1
1: 1
2: 1
3: 14
4: 235
Right 906817991 1:48898998-48899020 ATTGCGCTGCTTCCTCCAGAGGG 0: 1
1: 1
2: 1
3: 12
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906817981 Original CRISPR CTGAGAGTAAGGAGGTACCA TGG (reversed) Intronic
900161855 1:1227655-1227677 CTGAGTGCAAGTAGGTTCCAGGG + Intronic
900658077 1:3770020-3770042 CTGAGAGAAAGGAGGGTCCTGGG - Intronic
902657623 1:17880248-17880270 CTGACAGTCAGTAGGTGCCAGGG - Intergenic
905514588 1:38552922-38552944 CTGAGATCAAGGTGGCACCATGG + Intergenic
906056660 1:42923413-42923435 CTGAGAGAAATGAGGAACCCAGG + Intergenic
906384000 1:45351686-45351708 CTGGGAGCACGGAGGTTCCAAGG + Intronic
906817981 1:48898947-48898969 CTGAGAGTAAGGAGGTACCATGG - Intronic
908170429 1:61499014-61499036 CTGAGAATCAGGAGTGACCAAGG + Intergenic
908739966 1:67317469-67317491 CAGAGAGATATGAGGTACCAAGG - Intronic
908863540 1:68519246-68519268 CTGAGAATAAGGGGGAACTATGG - Intergenic
908868270 1:68576737-68576759 CTGAGGGTGTGGAAGTACCAGGG - Intergenic
910459601 1:87434895-87434917 CAGAGAGTAGGGAGCAACCATGG + Intergenic
911730167 1:101284138-101284160 CTGTGAGGAAGGAGGTGCCTCGG + Intergenic
912717554 1:111992479-111992501 CTGAAAGTCAGGAGCTGCCAGGG + Intergenic
914316827 1:146521207-146521229 CAGAGAGTAGGGAGCAACCATGG + Intergenic
914497528 1:148212153-148212175 CAGAGAGTAGGGAGCAACCATGG - Intergenic
915545169 1:156592890-156592912 CAGAGTGGAAGGAGGGACCAGGG - Intronic
916873378 1:168941311-168941333 CTAAGAATAAGGAGGGACCAAGG - Intergenic
920339583 1:205267598-205267620 CTGAGAGGAACCAGGCACCAGGG + Intronic
920647487 1:207814179-207814201 CTGGGAGTCAGGAGGCAGCATGG - Intergenic
921445938 1:215247785-215247807 CTGAGATTAAGGTGTTAGCAGGG + Intergenic
921984964 1:221303061-221303083 CTGACATTAATGAGGTAGCAAGG - Intergenic
1063085739 10:2816168-2816190 CTAAGAGTATTGAGGCACCAGGG + Intergenic
1068668582 10:59701423-59701445 CTGTGGGTAATGAGGAACCATGG - Intronic
1069127093 10:64649451-64649473 ATGAGATTCAGGAGGTACAATGG - Intergenic
1070010763 10:72471803-72471825 GTGAGAGTTAGTATGTACCAGGG - Intronic
1070402625 10:76066803-76066825 CTGAGGGTGAGGAGGAACCTTGG + Intronic
1071449061 10:85777268-85777290 CTGGGAGAAAGGAGGGCCCAGGG - Intronic
1072088959 10:92108242-92108264 CTGGGAGCAAGGAAGCACCATGG + Intronic
1072291021 10:93964782-93964804 CTGAGACTAAGGAGTTTGCAAGG - Intergenic
1073348664 10:102803234-102803256 CTGAGAGCAAGGAAGGGCCAGGG + Intronic
1073600336 10:104840198-104840220 CTGAGAGGAAGGAGAAACTAAGG + Intronic
1074774919 10:116760492-116760514 CTGGGAGCAAGGAGATTCCAGGG - Intergenic
1076721409 10:132395014-132395036 CAGAGGGGCAGGAGGTACCATGG + Intergenic
1077986019 11:7351824-7351846 CTGAGAGTAAGGAGAAAGGAAGG + Intronic
1078912677 11:15747607-15747629 TTGAGAGTAGAGAGGTAACAAGG + Intergenic
1080622476 11:33998071-33998093 CTGAGAGTATGGGGGTGGCAGGG + Intergenic
1081941073 11:46942518-46942540 GTGAGAATAAGCAGGTTCCATGG - Intronic
1082175736 11:49056815-49056837 CAGAGAGTGAGGAGGAACTAGGG + Intronic
1085228331 11:74942871-74942893 CTGAGAGGAAGGAGACAGCAAGG + Intronic
1086094656 11:83038220-83038242 CTGAGAGGTAGGACATACCAAGG - Intronic
1089825407 11:121271411-121271433 CTGAGACTATGGAGATGCCAAGG + Intergenic
1091305617 11:134534163-134534185 CTGAGGGTAATGAGGCACAATGG + Intergenic
1095921833 12:47539529-47539551 CTGAGGAAAGGGAGGTACCAAGG + Intergenic
1098572449 12:72003965-72003987 CAGAGAATAAAGAGTTACCAAGG - Intronic
1098824426 12:75275616-75275638 CTGAGAGATATGAGGTATCAGGG + Intergenic
1099004884 12:77224393-77224415 CAGAGAAAAAGGAGGAACCAGGG - Intergenic
1099674560 12:85742345-85742367 ATGAGAGTTGGGAGGTGCCAAGG - Intergenic
1099800677 12:87452468-87452490 ATGAGATTTAGGAGGTGCCAGGG + Intergenic
1101451064 12:104779733-104779755 CTCAGAGTCAGCAGGTACAATGG + Intergenic
1103018535 12:117514921-117514943 CTTAGAGGTAGGAGGTAGCAAGG - Intronic
1104074577 12:125377850-125377872 GTGAGATTTAGGAGGCACCAAGG + Intronic
1106125791 13:26899042-26899064 CTGAGACTAAGGATGGAGCATGG + Intergenic
1106159151 13:27185072-27185094 CTGAGAGTAGGGAAGAAGCATGG + Intergenic
1107084298 13:36409090-36409112 CTTACATTAAGGAGATACCATGG - Intergenic
1108104964 13:46998793-46998815 CTGAGACTAAGGTGTTAACAGGG - Intergenic
1109269777 13:60241885-60241907 CTGAAATTAAGGAGATATCAGGG + Intergenic
1110065998 13:71106080-71106102 CTGAGAGGAAGGAGCTTCCCAGG + Intergenic
1110547389 13:76770659-76770681 CTTAGGGTAAGGAGGAACTAAGG + Intergenic
1111337776 13:86845894-86845916 CTGAGAGCAACAAGGAACCAGGG + Intergenic
1111716549 13:91886421-91886443 ATGAGATTCAGGAGGTGCCATGG - Intronic
1112143295 13:96670530-96670552 TGGAGAGAAAGGAGGTTCCAGGG + Intronic
1114489515 14:23090028-23090050 CTGAAAGTCAGGAGGCAGCAGGG + Exonic
1116284417 14:42953561-42953583 CTGAGAGTAAGAAGGAACCCTGG + Intergenic
1116737692 14:48714395-48714417 ATGAGGGTACGGAGGTAGCATGG + Intergenic
1116742849 14:48778315-48778337 GAGAGAGTAAGAAGGTACCTTGG + Intergenic
1119494360 14:75065926-75065948 CTTAGAGTAATGTAGTACCATGG + Intronic
1121086038 14:91146825-91146847 TTCAGAGCAAGTAGGTACCATGG + Intronic
1121892210 14:97604837-97604859 CTGAGAAACAGGAGGTAGCAGGG + Intergenic
1122284582 14:100643121-100643143 CTGAGATTGAGGTGTTACCAGGG - Intergenic
1124294567 15:28489213-28489235 ATGAGATTCAGGAGGCACCAGGG + Intergenic
1125481855 15:40086655-40086677 CAGAGAGAAAGGAGGGAACAAGG + Intergenic
1126373163 15:47968025-47968047 CTCAGAGTAAGAAGGTGTCAGGG - Intergenic
1126676549 15:51163687-51163709 CTGAGATCAAGGAGGTTCAAAGG - Intergenic
1128283498 15:66416870-66416892 CAGAAGGAAAGGAGGTACCATGG - Intronic
1130250076 15:82294338-82294360 CTGAGAGTCAGGAGGTTGGATGG - Intergenic
1132708391 16:1256087-1256109 CTGAGAGTAGGGACTTACCCTGG - Intronic
1133704078 16:8336828-8336850 ATGAGGGTAACGAGGTGCCAGGG + Intergenic
1135358361 16:21789873-21789895 ATGAGTCTAAGGAGGAACCAGGG + Intergenic
1135456864 16:22605998-22606020 ATGAGTCTAAGGAGGAACCAGGG + Intergenic
1135460663 16:22639753-22639775 CTGAGTGTAAGGATGTAGCTTGG - Intergenic
1136710069 16:32229597-32229619 ATGAGATTCAGGAGGTGCCAGGG + Intergenic
1136757840 16:32699814-32699836 ATGAGATTCAGGAGGTGCCAGGG - Intergenic
1136810266 16:33170561-33170583 ATGAGATTCAGGAGGTGCCAGGG + Intergenic
1136816742 16:33280641-33280663 ATGAGATTCAGGAGGTGCCAGGG + Intronic
1138507633 16:57486163-57486185 CCGAGAGTAGGAAGGTCCCATGG + Intronic
1140526471 16:75627144-75627166 CTGAGGGAAATGAGATACCATGG - Intergenic
1203059990 16_KI270728v1_random:960163-960185 ATGAGATTCAGGAGGTGCCAGGG - Intergenic
1144629991 17:16866387-16866409 TTGACAGGAAGGAGGCACCAGGG + Intergenic
1146585311 17:34077081-34077103 CTGTGAGTAAGGGAGTACCTGGG + Intronic
1146769229 17:35553335-35553357 CTGAGAACAAGGATGTATCAGGG + Exonic
1148725726 17:49788698-49788720 CTGAGAGGCAGGAGGCACTAGGG + Exonic
1149640684 17:58200464-58200486 CAGTCAGAAAGGAGGTACCAGGG - Intronic
1149683448 17:58521211-58521233 CTGAGGGCAAGGAGATACCCTGG + Intronic
1149798280 17:59541988-59542010 CAGGGAGTAAGGAAGTAGCATGG - Intergenic
1151112609 17:71696770-71696792 CAGAAAGTAAGGAAGTACAAAGG + Intergenic
1151355545 17:73555894-73555916 CAGAGAGTCAGGGGGGACCAGGG + Intronic
1158203968 18:54970416-54970438 CTGAGAGTCAGGAGATAACATGG + Intergenic
1159138038 18:64360560-64360582 CTGAGATTTGGGAGGTGCCATGG - Intergenic
1161465593 19:4428604-4428626 ATGGGAGAAAGGAGGCACCATGG - Intronic
1162373079 19:10290402-10290424 CACAGCGTAAGGAGGTACCCGGG - Intronic
1163160051 19:15458793-15458815 CTAAAAGCAAGGAGGTGCCATGG - Intronic
1164296805 19:23917906-23917928 ATGAGAGTAAGCAGGAACAAAGG + Intronic
1166209791 19:41298967-41298989 CTCAGAGTAGGTAGGTGCCAGGG - Intronic
1166295737 19:41888400-41888422 AGGTGAGGAAGGAGGTACCAGGG - Intronic
1166894955 19:46017224-46017246 CTGAGAAAAAGGAGTAACCAAGG - Intronic
1167104758 19:47423723-47423745 GAGAGAGTGAGGAGGTACCTTGG + Intergenic
1168435682 19:56315181-56315203 CTGGGAATAAGGCGGGACCAGGG + Intronic
925790880 2:7487277-7487299 CTAACAGTAAGGAGTTAGCAAGG + Intergenic
926339697 2:11894846-11894868 CTGAGGGTAAGGAGGTGGGAAGG + Intergenic
927487157 2:23496468-23496490 GGGAGAGGGAGGAGGTACCAGGG - Intronic
927544386 2:23940219-23940241 CTGAGGCTGAGGAGGTACCCAGG + Intronic
929897135 2:45971165-45971187 CTGGGAGAAAGGAGGAATCAGGG - Intronic
929904888 2:46036970-46036992 CTGAGAGTCAGCATCTACCAGGG - Intronic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
932092310 2:68817426-68817448 ATGAGAGCAAGGAGGCACCATGG + Intronic
934113126 2:88760428-88760450 ATGAGATTTGGGAGGTACCAGGG + Intergenic
934156626 2:89207195-89207217 CTGAAAGAAAGGAGGGGCCAAGG - Intergenic
934210689 2:89975556-89975578 CTGAAAGAAAGGAGGGGCCAAGG + Intergenic
934584087 2:95474340-95474362 CTGAGAGTAATATGGTATCATGG - Intergenic
934595365 2:95602374-95602396 CTGAGAGTAATATGGTATCATGG + Intergenic
934650120 2:96085836-96085858 CAGAGAGGCAGGAGGGACCAAGG + Intergenic
934787406 2:97023160-97023182 CTGAGAGTAATATGGTATCATGG - Intergenic
934902097 2:98167576-98167598 CTGAGGGTCTGGAGGGACCAAGG + Intronic
934910726 2:98251917-98251939 CTGAGAGGAAAGAAGAACCAAGG + Intronic
935341674 2:102064677-102064699 CTGAGAGCAAGGAGGCAGCTAGG - Intronic
935848486 2:107193016-107193038 CTGAGGGAAAGGAGGAAACAAGG + Intergenic
936531772 2:113281178-113281200 CAGAGAATTAGGAAGTACCAAGG - Intergenic
937572082 2:123376180-123376202 CTGGGAGTAGGGAGGTGTCAGGG + Intergenic
938670312 2:133580225-133580247 CAGAGAGTCAGGAGGTAGAATGG - Intergenic
941439132 2:165511655-165511677 CTGAGAGTGAGGAGGTGGGAAGG + Intronic
942490281 2:176483075-176483097 GGGAAAGTAAGGAGGCACCAAGG + Intergenic
943059944 2:183031864-183031886 CTGAGAGCAAATAAGTACCATGG + Intronic
943621672 2:190155179-190155201 GAGAGAGTAAGGAGGTATCTGGG + Intronic
944208325 2:197180492-197180514 CTGGGAGTAAGGAGGCTGCAGGG - Intronic
945136373 2:206632501-206632523 CTGAGAATAAAGAAGTTCCATGG + Intergenic
945940150 2:215941247-215941269 CTGAAAGTAAGGAGATGACAGGG + Intergenic
948251278 2:236531850-236531872 CTGCCAATAAGGAGGGACCATGG - Intergenic
1170099714 20:12685627-12685649 CAGAAAGTTGGGAGGTACCAAGG - Intergenic
1172197112 20:33099550-33099572 CAGAGAGCAAGGAGGTAAAAGGG - Intronic
1172501794 20:35432936-35432958 CTGTGAGTATGGGGGTAGCAGGG + Intergenic
1174768126 20:53272912-53272934 CTGAGAATGAGGGGCTACCAAGG + Intronic
1176055150 20:63141350-63141372 CTGAGAGGAGAGAGGTGCCAGGG + Intergenic
1177515774 21:22148971-22148993 ATGAGATTCAGGAGGGACCAGGG + Intergenic
1178340195 21:31779443-31779465 CTGAGAGAATGGAGGAGCCAGGG - Intergenic
1183178939 22:36245479-36245501 GTGAGAGGAGGGAGGCACCAAGG + Intergenic
1183239949 22:36650289-36650311 ATGAGACTAATGAGGTATCAGGG - Intronic
1183336737 22:37252496-37252518 CTGAAAGTAATAAGGTATCAAGG - Intergenic
953116069 3:39993616-39993638 CTGAGAGTGAGGAGGTGACAAGG - Intronic
956534934 3:70265474-70265496 CAGGGAGTATGGAGGTAGCATGG - Intergenic
958445849 3:94213989-94214011 TTGAGAGTAATTAGGTATCAAGG + Intergenic
959336942 3:105078986-105079008 ATGAGATTTAGGAGGGACCAGGG - Intergenic
960825580 3:121780145-121780167 CTGAGAGTCAGGTGACACCAAGG - Intronic
961517727 3:127448688-127448710 CAGAGAGTAAGGAGGGAGCGTGG - Intergenic
961671406 3:128534312-128534334 CTGAGAGAGAGGAGGAACCAGGG + Intergenic
968544711 4:1192885-1192907 CCGAGTGGAAGGAGGTGCCAGGG + Intronic
970167218 4:13251499-13251521 CTGAGAGTTTGGAGAGACCAAGG + Intergenic
971059265 4:22949092-22949114 CTGAGTATAAGGAGGTAAAAAGG - Intergenic
972105779 4:35485014-35485036 CTGAGAGAATGGAAGTACCTGGG + Intergenic
972333954 4:38089161-38089183 CAGTGAGTAAGGAGGTACACCGG - Intronic
973717285 4:53689749-53689771 CTGATAGTAAGGAAGTAGAAGGG - Intronic
974872603 4:67661236-67661258 ATGAGATTCAGGGGGTACCAGGG + Intronic
975661654 4:76694926-76694948 CTGAGGGCATGGAGGTGCCAGGG + Intronic
976563230 4:86525374-86525396 ATGAGAGTGAGGAGGTTCCCAGG + Intronic
978256076 4:106694208-106694230 ATGAGATTTAGGAGGGACCAGGG + Intergenic
980958661 4:139453748-139453770 CTGAGAGGAAGGAGGTACCACGG - Intronic
981609424 4:146577674-146577696 ATGAGAGTAAGCAGGTAGGAGGG + Intergenic
984043156 4:174762865-174762887 CTGATTGTGAGGAGGTACCACGG - Intronic
985834000 5:2257389-2257411 GGGAGAGTAAGGAGGCACCCAGG + Intergenic
986504024 5:8430312-8430334 CTGAGAGCACGGGGGTGCCAGGG + Intergenic
988996739 5:36722234-36722256 CTGAGAGAATGGTGGGACCAGGG - Intergenic
989615275 5:43332166-43332188 CAGAGACTAGGGAGGGACCAAGG + Intergenic
990789108 5:59456138-59456160 ATGAGATTTGGGAGGTACCAGGG + Intronic
991100105 5:62782539-62782561 CTAAGAATAATGAGGTACAAAGG + Intergenic
994755522 5:103789756-103789778 ATGAGATTTGGGAGGTACCAGGG - Intergenic
996278488 5:121697543-121697565 CACAGGGTAAAGAGGTACCAAGG - Intergenic
998385412 5:141754510-141754532 CTGGGGGTATGGAGGAACCAAGG - Intergenic
998872393 5:146565694-146565716 CTGAGAGTAAGGAAGCACTTAGG - Intergenic
999065222 5:148678496-148678518 CTGAGAATGAGGAGGGCCCAAGG - Intergenic
1001141492 5:169147722-169147744 ATGAGAGTATAGAGATACCAGGG + Intronic
1001442138 5:171751132-171751154 CTAAGAGGAAGGAGGGATCATGG - Intergenic
1002367227 5:178723079-178723101 CTGAGAGTGAAGAGGTAGCCAGG + Intronic
1003390227 6:5707323-5707345 CTGAGAATAAAGTGGTACCAGGG + Intronic
1003476452 6:6488193-6488215 CTGAGACTAAGGAGGTTCTTGGG + Intergenic
1004491658 6:16122961-16122983 CTAAGACTAAGGAATTACCAAGG - Intergenic
1006450964 6:34105499-34105521 CTGAGAGGAAGGAGGGGACAAGG - Intronic
1006690174 6:35876898-35876920 CTGAGAGTCTGGAGAGACCAAGG + Intronic
1008851945 6:56033035-56033057 CACAGAGAAAGGAGGTAACAGGG - Intergenic
1010253455 6:73732156-73732178 CTGAGACTAAGGAGGTTCCCAGG - Intronic
1010725387 6:79327117-79327139 CTGAAAATAAGGAAGTAGCACGG - Intergenic
1012676683 6:102122540-102122562 CTGAGAGTGAGGATGTAGAAGGG - Intergenic
1013149163 6:107427021-107427043 ATGAGATTTAGGAGGGACCAGGG + Intronic
1015757950 6:136627204-136627226 GTGAGAATAAGGAGGTAAAATGG - Intronic
1022311581 7:29201186-29201208 CTGAGAGCAAGGAGGAACCTTGG + Intronic
1022644171 7:32215525-32215547 CTCAGAGTAAGTAGTTGCCATGG + Intronic
1023682011 7:42696828-42696850 CAGAGAGTGAGAGGGTACCAGGG + Intergenic
1024385313 7:48744509-48744531 CTGAGAGTGAGTAGGTACCAGGG + Intergenic
1028015199 7:85701246-85701268 CTTAAAGTGAGGAGGTAGCATGG + Intergenic
1028184521 7:87767548-87767570 CTGAGAGTGTGTAGGTCCCAGGG + Intronic
1031920252 7:127595153-127595175 CTGACAGCAAGGAGATACCAGGG + Intronic
1032546033 7:132743484-132743506 CTTAGAGTAAGAAGGTGGCAGGG + Intergenic
1032839060 7:135699606-135699628 ATGAGAGGCAGGAGGCACCATGG + Intronic
1034079308 7:148261698-148261720 GTGAGAGTGAGGGGCTACCAGGG + Intronic
1036475846 8:9092637-9092659 CTGAGAGCAGGAAGGAACCAGGG + Intronic
1036685143 8:10904589-10904611 AGGAGAGCAAGGAGGTGCCACGG + Intronic
1039439794 8:37587175-37587197 CTGAGTCTGAGGAGGAACCAAGG - Intergenic
1043373095 8:79615285-79615307 CTGTGAGCAATGAGCTACCAAGG - Intronic
1044066472 8:87705613-87705635 ATGAGAGTTGGGAGGGACCAGGG - Intergenic
1046551914 8:115728825-115728847 GTGAGAGTAAAGAGGACCCAGGG + Intronic
1047505279 8:125474805-125474827 CTGAGATTAAGTAATTACCAAGG + Intergenic
1047803637 8:128335732-128335754 CTGAGAGTGAGCAGGAACTAAGG + Intergenic
1048205792 8:132414283-132414305 CAGAGAGTCAGGAGGGAGCAGGG + Intronic
1050697007 9:8290769-8290791 CTGAGAGAAAGGAGGCTACAGGG + Intergenic
1051453369 9:17223292-17223314 CTGAGGGTAAGGGGGAACTACGG + Intronic
1052428730 9:28338500-28338522 ATGAGATTTGGGAGGTACCAGGG + Intronic
1053522092 9:38790808-38790830 CTGAGAGGAACCAGGAACCACGG + Intergenic
1054194319 9:62015272-62015294 CTGAGAGGAACCAGGAACCACGG + Intergenic
1054644088 9:67573418-67573440 CTGAGAGGAACCAGGAACCACGG - Intergenic
1054730779 9:68700974-68700996 CTGAGAGGAAAGAGGAACAAGGG + Intergenic
1055999185 9:82195614-82195636 CTGAGAGTAATGTGGTATCAAGG + Intergenic
1057949388 9:99357751-99357773 CTGAGGGGAAGGAGGCTCCAGGG - Intergenic
1058380181 9:104368954-104368976 CTGAGAGGTAGGAGCTCCCAGGG - Intergenic
1061268302 9:129521328-129521350 CTGGCAGTAAGTAGGCACCAGGG + Intergenic
1062561629 9:137144744-137144766 GTGAGAGGAAGGGGGTCCCAGGG + Intronic
1062561691 9:137144920-137144942 GTGAGAGGAAGGGGGTCCCAGGG + Intronic
1062561711 9:137144977-137144999 GTGAGAGGAAGGGGGTCCCAGGG + Intronic
1062561731 9:137145034-137145056 GTGAGAGGAAGGGGGTCCCAGGG + Intronic
1062561754 9:137145091-137145113 GTGAGAGGAAGGGGGTCCCAGGG + Intronic
1062561776 9:137145148-137145170 GTGAGAGGAAGGGGGTCCCAGGG + Intronic
1062561798 9:137145205-137145227 GTGAGAGGAAGGGGGTCCCAGGG + Intronic
1062561818 9:137145262-137145284 GTGAGAGGAAGGGGGTCCCAGGG + Intronic
1062561838 9:137145319-137145341 GTGAGAGGAAGGGGGTCCCAGGG + Intronic
1186535466 X:10342476-10342498 CTGAGACTAATTAGGTCCCATGG + Intergenic
1186564138 X:10644364-10644386 CTGAGAGGAAGGAGGAATGAAGG - Intronic
1187154542 X:16711604-16711626 TTGACAGAAAGGAGGTACCAGGG + Exonic
1187362798 X:18643743-18643765 CTAAGAGTAAGGAGTTCCCCAGG - Intronic
1188515144 X:30977402-30977424 CTGAGAGTGAGGAGGCAGAAAGG - Intergenic
1188594023 X:31874768-31874790 CTGAGGGTGATCAGGTACCAAGG - Intronic
1190353376 X:49581998-49582020 ATGAGAGAATGGAGGTGCCAGGG + Intronic
1190354481 X:49591550-49591572 ATGAGAGAATGGAGGTGCCAGGG + Intronic
1190397646 X:50000976-50000998 CTGAGAGTGAGGAGGAAGGAAGG - Intronic
1192306448 X:69965240-69965262 CTTAGAGTAAAGAGGGAGCATGG + Intronic
1194645139 X:96450247-96450269 CTGAGAGTAAGGAAATACACTGG + Intergenic
1195499048 X:105573016-105573038 CTGAGAGTAGTGAGAAACCATGG + Intronic
1197799011 X:130329514-130329536 ATGAGATCAGGGAGGTACCAGGG - Intergenic
1200094012 X:153648853-153648875 CTGAGAGTCAGGAGATGCCCAGG + Intronic
1201860585 Y:18593348-18593370 CTGAGAATAATGCAGTACCAAGG - Intergenic
1201872738 Y:18727033-18727055 CTGAGAATAATGCAGTACCAAGG + Intergenic
1202165464 Y:21982674-21982696 CTGAGAATAACGCAGTACCAAGG + Intergenic
1202225893 Y:22603698-22603720 CTGAGAATAACGCAGTACCAAGG - Intergenic
1202317220 Y:23591963-23591985 CTGAGAATAACGCAGTACCAAGG + Intergenic
1202553545 Y:26078095-26078117 CTGAGAATAACGCAGTACCAAGG - Intergenic