ID: 906818500

View in Genome Browser
Species Human (GRCh38)
Location 1:48903899-48903921
Sequence GGATGGAGCAAGTGACAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 451
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 413}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906818495_906818500 6 Left 906818495 1:48903870-48903892 CCTTTAATAACCTCATGCTTCTG 0: 1
1: 0
2: 2
3: 17
4: 238
Right 906818500 1:48903899-48903921 GGATGGAGCAAGTGACAGGAAGG 0: 1
1: 0
2: 4
3: 33
4: 413
906818497_906818500 -4 Left 906818497 1:48903880-48903902 CCTCATGCTTCTGAGATTAGGAT 0: 1
1: 0
2: 0
3: 9
4: 173
Right 906818500 1:48903899-48903921 GGATGGAGCAAGTGACAGGAAGG 0: 1
1: 0
2: 4
3: 33
4: 413

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906818500 Original CRISPR GGATGGAGCAAGTGACAGGA AGG Intronic
900420671 1:2554683-2554705 GCATGGAGGAAGGGGCAGGAGGG + Intergenic
900592352 1:3465697-3465719 GGATGGCAGAAGTGACGGGAGGG - Intronic
900689627 1:3972687-3972709 AGAAGGATCAAGAGACAGGAGGG + Intergenic
901049189 1:6417978-6418000 GGATGGAGCAGGTTAAAGAATGG - Exonic
901120296 1:6886135-6886157 GGATGGGGGAAGTGACAGTGGGG + Intronic
901215778 1:7554592-7554614 GGGTGGAGGCAGTGACAGGAGGG - Intronic
902834328 1:19036869-19036891 GAACGGAGCAAGAGACAGGCTGG - Intergenic
903004415 1:20289335-20289357 GAATGGAGGAGGTGAGAGGAAGG - Intergenic
904224706 1:29006629-29006651 GGTTGGAGGTAGTGACTGGAAGG - Intronic
904269818 1:29342641-29342663 GGTTGGAGCAGATGACAGGGAGG - Intergenic
904270779 1:29348690-29348712 GGAAGGAGAAAGAGAGAGGAAGG - Intergenic
904700049 1:32352447-32352469 GGAGGGGGCCAGGGACAGGAAGG + Intronic
904851012 1:33459720-33459742 GGATGGAGCAACTAAGTGGATGG + Intergenic
905106557 1:35566453-35566475 GGCTGGAGCCAGGAACAGGAGGG + Exonic
905733357 1:40311179-40311201 GGGTGGTGCAGGTGACAGGAGGG - Intronic
905971888 1:42147868-42147890 GGATTGAGAGAGTGACAGGACGG - Intergenic
906151453 1:43590152-43590174 ACATGGAGCCAGTGACAGAAGGG - Intronic
906788562 1:48638206-48638228 GGATGGAGGAAGTAACTGGGAGG - Intronic
906818500 1:48903899-48903921 GGATGGAGCAAGTGACAGGAAGG + Intronic
907325454 1:53635182-53635204 GCTTTGAGCAAGTGAAAGGAGGG + Intronic
908053781 1:60260799-60260821 TGATGGAGAAAGTGTCATGATGG + Intergenic
908447500 1:64214559-64214581 GGAAGGAACAAGTTACAGAAAGG + Intronic
911426733 1:97724873-97724895 GGAAGGAGGAAGTGACAGAGTGG + Intronic
911458926 1:98163951-98163973 GGATGGGACAAGGGACAGGAAGG - Intergenic
911732364 1:101304412-101304434 GAATGGAGCAAGTGCCAGTAGGG + Intergenic
911799549 1:102118386-102118408 GATTGGAACAAGTGAAAGGAGGG + Intergenic
913140916 1:115940702-115940724 GGCAGGAGCAAGTGAGAGGGTGG + Intergenic
915269443 1:154743202-154743224 GGCTGGAGCAGGTAAGAGGATGG - Intronic
916000723 1:160612687-160612709 GGTTGGACCAAATGACTGGAAGG - Intronic
917153350 1:171967787-171967809 GGATGGAACAAGTTATGGGAAGG - Intronic
918886314 1:190198808-190198830 GGAGGGATCAAAAGACAGGAAGG - Intronic
919775112 1:201189369-201189391 GGAAGGAGAAAGTGAGAGGCAGG - Intergenic
920867267 1:209763409-209763431 GGATGGAGGAACTGAGGGGAGGG - Intronic
921155484 1:212434953-212434975 GGAAGGAGCCAGAGAGAGGAGGG + Intronic
921268107 1:213442851-213442873 AGATGGATCAAGTGCCTGGAAGG - Intergenic
921979137 1:221236034-221236056 GGAGGGAGGAAGAGAAAGGAAGG + Intergenic
922791600 1:228314175-228314197 GGAGGAAGCAGGTGACAGCAGGG - Intronic
1063081969 10:2775886-2775908 GCACAGAGCAGGTGACAGGACGG + Intergenic
1067520066 10:46993245-46993267 GCATGGTGCCAGTGACTGGAGGG - Intronic
1067874160 10:49988814-49988836 GGCAGGAGCTAGGGACAGGATGG + Exonic
1069217683 10:65842509-65842531 GGATGGAGCAGGAGAAAGGAGGG + Intergenic
1069630843 10:69896226-69896248 GGGTGGAGCAAGGAAAAGGAAGG - Intronic
1069788537 10:71004957-71004979 GCAAGGAGCTGGTGACAGGAAGG + Intergenic
1069863257 10:71484327-71484349 AGATGGAGGAAGAGAGAGGACGG - Intronic
1070677334 10:78421073-78421095 GGATGTGGGAAGTGAGAGGAGGG + Intergenic
1071290741 10:84187279-84187301 GGATGCAGCAAGGGCCAGGCAGG + Intergenic
1072181337 10:92983906-92983928 TGATGGAGCAAAGGAGAGGAAGG - Intronic
1072544984 10:96430283-96430305 GGAGGGAGCAAGAGAGAGGTGGG - Intronic
1074609193 10:115004601-115004623 GGAGGGAGGAAGGGAAAGGAAGG - Intergenic
1074626092 10:115188080-115188102 GGAGGGAGAAAGGGAGAGGAAGG + Intronic
1075549377 10:123380832-123380854 TGCTGGAGAAAGTGAGAGGAAGG - Intergenic
1075925854 10:126251574-126251596 GGATGGATGAACGGACAGGATGG + Intronic
1076152066 10:128170421-128170443 GGGTGGACCAAGTGCCTGGAAGG + Intergenic
1076258850 10:129050126-129050148 GGCTGGAGCATGGGCCAGGAGGG - Intergenic
1076530524 10:131141595-131141617 GGAGGGAGCAAGGGAAGGGAGGG - Intronic
1076579360 10:131496327-131496349 GGATGGAGTCAGGGACAGGGTGG + Intergenic
1076934511 10:133558517-133558539 GGATGGGGCATGTGACCAGATGG + Intronic
1077234822 11:1475700-1475722 GGGTGGAGGAGGTGAGAGGATGG - Intronic
1078248790 11:9600376-9600398 GGATGGCGCAGGAGACATGAGGG - Intergenic
1078248892 11:9601240-9601262 GGATGGTGCAGGGGACATGAGGG - Intergenic
1079189350 11:18264975-18264997 GGAAGGAGAAAGAGAGAGGAAGG + Intergenic
1079189353 11:18264996-18265018 GGAAGGAGAAAGAGAGAGGAAGG + Intergenic
1079189395 11:18265189-18265211 GGAAGGAGAAAGAGAGAGGAAGG + Intergenic
1079504611 11:21139449-21139471 GGAGAAAGCAAGTGACAGTAGGG - Intronic
1080239044 11:30105335-30105357 TGATGGAGGAAGTCACTGGAGGG + Intergenic
1081022202 11:37960103-37960125 GGATGGAGGACCTGTCAGGAGGG + Intergenic
1083256833 11:61501719-61501741 AGAGGGAGCAAGAGATAGGAGGG + Intergenic
1083264781 11:61541703-61541725 GGATAGAGGAAGTGAGAGGGAGG + Intronic
1083796265 11:65018544-65018566 GCAAGGAGCGGGTGACAGGAGGG - Intronic
1084885567 11:72203773-72203795 GGAGGGAGCAAGGGACAGGGAGG + Intergenic
1085897894 11:80661694-80661716 GGATGGATCCAGGGACAAGATGG + Intergenic
1087044806 11:93836068-93836090 GGAAGGAGAAGGTGTCAGGATGG - Intronic
1088158738 11:106842206-106842228 TGATGGAGCAAGGGAAGGGATGG - Intronic
1088452130 11:109993655-109993677 GAATTGAGCAAGTGGAAGGATGG - Intergenic
1088661596 11:112052830-112052852 GGATGGCGCCAGTCACTGGAAGG - Intronic
1089319675 11:117616647-117616669 GGAGGGAGTTAGTGACTGGAAGG + Intronic
1089401719 11:118168300-118168322 GGTTGGAGCAAGGGACAGGATGG + Intronic
1090264716 11:125346772-125346794 GGAGGGAAGAAGGGACAGGAAGG + Intronic
1090376677 11:126294409-126294431 GGAGGGAGCAAGTGAAGAGATGG + Exonic
1091282853 11:134391752-134391774 ATATGGTGCAAGTGTCAGGATGG - Exonic
1091461638 12:647531-647553 GGTTGGAGCAGGTGCCAGGGAGG - Intronic
1093643238 12:21552582-21552604 GTATGTAGCAAATGTCAGGAAGG + Intronic
1093780376 12:23128752-23128774 AGATGGAAAAAGTGAGAGGAAGG - Intergenic
1094728609 12:33148450-33148472 GGAAGGAGAAAGTGAAAAGATGG + Intergenic
1096006458 12:48177016-48177038 GGAGGCAGCAAGGGACAAGAAGG + Intronic
1100712700 12:97275224-97275246 GCATGGAGGAGGAGACAGGAGGG + Intergenic
1100963947 12:99992051-99992073 AAAAGGAGCAGGTGACAGGAGGG + Intergenic
1101761849 12:107665158-107665180 GGGTGCAGCAAATCACAGGAAGG + Intergenic
1101836560 12:108299701-108299723 GGATGGAGGCAGAGATAGGAGGG + Intronic
1102163533 12:110788083-110788105 GAATGGAGCAGGTGAAAGAAGGG + Intergenic
1102573256 12:113840526-113840548 GGATGGAGCAGGACAGAGGATGG - Intronic
1103520710 12:121535897-121535919 GGAAGGGGCAAGTGGCAGGGAGG - Intronic
1103711810 12:122918260-122918282 GGAAGGAGGAGGGGACAGGAAGG - Intergenic
1105415809 13:20210536-20210558 GGGTGGAGGAAGGGACAGGCAGG + Intergenic
1105727730 13:23182448-23182470 GGAGGGAGGGAGAGACAGGAAGG - Intronic
1106146359 13:27053273-27053295 GCAGGGAGCAAGTGAAGGGAGGG - Intergenic
1108433220 13:50375656-50375678 GGATGGAGGAAGGGAAGGGAAGG - Intronic
1108515128 13:51194302-51194324 GGAAGGAGCATGTGAAAGAAAGG - Intergenic
1109029475 13:57174706-57174728 GGATGCAACAAGTGTCAGTAAGG + Intergenic
1109279995 13:60344928-60344950 AGAGGGAGCAAGAGACAGAAAGG - Intergenic
1112176508 13:97030667-97030689 TGATGGAGTAAGTTTCAGGAGGG + Intergenic
1112396765 13:99040787-99040809 GGATGGAGCAGGAGTCAGGAAGG - Intronic
1112879544 13:104088748-104088770 GTATGAAGCAATTGACGGGAAGG - Intergenic
1113250888 13:108451093-108451115 GGATGGAGCAGTGGACAGAAAGG + Intergenic
1115493018 14:33977017-33977039 GGATGTAGCAGGGGATAGGAGGG - Intronic
1118837241 14:69485616-69485638 GGAGGGAGGAAGGGCCAGGAAGG + Intronic
1119163506 14:72472800-72472822 CGCTGGAGCAAGTGTCAGAAGGG + Intronic
1119568688 14:75650725-75650747 GGAATGAGCAAATGACAGTAAGG + Exonic
1120692346 14:87606379-87606401 GGCTGGAGCAGGTGACATGCAGG + Intergenic
1120783848 14:88512144-88512166 GGAGGGGGCAAAGGACAGGATGG - Intronic
1120897951 14:89551193-89551215 GTAAGCAGCAAGTGATAGGATGG + Intronic
1121381528 14:93474218-93474240 GGAGGGAGCGAGTAACAGTAGGG - Intronic
1121423458 14:93832039-93832061 GGATGGCGGGGGTGACAGGAGGG - Intergenic
1121554655 14:94827215-94827237 GGATGGAGAGAAGGACAGGAGGG - Intergenic
1125004274 15:34799888-34799910 GAAAGGAGAAAGTGACATGATGG + Intergenic
1125456721 15:39867629-39867651 TGGAGGAGCAAGAGACAGGAGGG + Intronic
1127289257 15:57555476-57555498 GGGAGGAGCAAATGAGAGGAAGG + Intergenic
1128549116 15:68586406-68586428 GGAGGTAGCAGGTGAAAGGAGGG + Intronic
1128677979 15:69625799-69625821 GGATGGAGGGAGAGAGAGGAAGG - Intergenic
1128677988 15:69625829-69625851 GGATGGAGGGAGAGAGAGGAAGG - Intergenic
1129319899 15:74768682-74768704 GCAAGGAGCACGTGACAGCATGG - Intergenic
1129869011 15:78929083-78929105 GGATGGCGCTCGTGGCAGGAGGG + Intronic
1130261953 15:82361993-82362015 GGAAGGAGCATATTACAGGAAGG - Intergenic
1130279279 15:82507014-82507036 GGAAGGAGCATATTACAGGAAGG + Intergenic
1130691537 15:86085646-86085668 GGATGAGGTAAGCGACAGGAGGG - Intergenic
1130755144 15:86755176-86755198 GGAGGGAGCAAAAAACAGGAAGG + Intronic
1131005296 15:88972803-88972825 GGCTGGAGCAAGTGGCTGAAGGG + Intergenic
1132347849 15:101119166-101119188 GACTGGAGCAAGGGACAGCAGGG - Intergenic
1132709166 16:1258860-1258882 GGATGGAGGAGGGGGCAGGATGG - Exonic
1134028223 16:10970942-10970964 GCATGTAGAAAGGGACAGGAAGG - Intronic
1134066229 16:11230191-11230213 GGAGGAAGCAGGTGAGAGGAAGG + Intergenic
1136016960 16:27406464-27406486 GGCTGGAAGAAGTGCCAGGAGGG + Intronic
1136298788 16:29319539-29319561 CGGCGGAGCAGGTGACAGGATGG - Intergenic
1136608882 16:31354462-31354484 GGATGAGGCAGGGGACAGGAGGG - Intergenic
1140864083 16:79044487-79044509 GGCAGGAGCAAGAGACAGGGTGG - Intronic
1141088072 16:81110791-81110813 GGATGGAGCCAGGGTGAGGATGG + Intergenic
1141856381 16:86683851-86683873 GGAGGGAGGAAGAGACAGGTAGG - Intergenic
1142060456 16:88026037-88026059 CGGCGGAGCAGGTGACAGGAGGG - Intronic
1142157303 16:88538421-88538443 GGATGGGGCCAGTAACAGAAGGG - Intergenic
1143484078 17:7243366-7243388 GGAAGGGCCGAGTGACAGGATGG - Intronic
1143713287 17:8748851-8748873 GGATGCAGCAAGGGACAGGAAGG + Intergenic
1144586136 17:16488954-16488976 GCCTGGAGCAAGTCACAGCAGGG + Intronic
1144629988 17:16866376-16866398 GGATGGGGTTATTGACAGGAAGG + Intergenic
1144933983 17:18882996-18883018 GGATGGACAGAGAGACAGGATGG - Intronic
1145060352 17:19729338-19729360 GGATTGAGCCCATGACAGGAAGG + Intergenic
1146126008 17:30232330-30232352 GGAGGGAAGAGGTGACAGGAGGG - Intronic
1146820610 17:35981282-35981304 GGATGGAGCAGCTGGCAGGGAGG - Intronic
1147429940 17:40364713-40364735 GGATGGAGGACAGGACAGGATGG + Intergenic
1147856628 17:43485285-43485307 GGAAGGGGCAGGTGACAGGAGGG + Intronic
1147869688 17:43578657-43578679 GAATGCAGCAAGGGAGAGGATGG - Intronic
1148197566 17:45725650-45725672 AGAAGGAGCAAGAGACAGGAAGG - Intergenic
1148681835 17:49478588-49478610 GGATGGACCCAGTGGGAGGATGG + Intergenic
1148694154 17:49549165-49549187 AGATGTGACAAGTGACAGGAAGG + Intergenic
1148822754 17:50369810-50369832 GGAAGGAGCAAGTGACTGCTGGG - Intronic
1149662720 17:58343765-58343787 TGATAGAGCAAGGGTCAGGATGG - Intergenic
1150273212 17:63880142-63880164 GTATGGAGCAAGGGGCAGGTTGG - Intronic
1151518705 17:74613633-74613655 GGATGGGGAAGGAGACAGGAAGG + Intronic
1151755793 17:76074692-76074714 AGGAGGAGCAAGAGACAGGAGGG - Intronic
1152008848 17:77698346-77698368 TGATGGAGGCAGTGACAGGATGG - Intergenic
1152650484 17:81490285-81490307 GGAAGGAGCTAGGGGCAGGAAGG - Intergenic
1153151551 18:2100975-2100997 GGAGGGAGCAAGAGAGAGAAGGG + Intergenic
1153778011 18:8470714-8470736 TGATGGAGCCAGTTCCAGGATGG - Intergenic
1154492670 18:14933530-14933552 GCATGGAGCAAGGGCCAGGAAGG + Intergenic
1156694806 18:39753554-39753576 GGATGGAGCCACTGAAGGGAGGG + Intergenic
1157120791 18:44909153-44909175 GGAAGGAGCAATTGAAAGGAAGG + Intronic
1157329864 18:46695971-46695993 GGAAGTGGCAAGTGCCAGGAAGG + Intronic
1157602452 18:48902327-48902349 GGATGGAGAAAGGGGAAGGAGGG - Intergenic
1158668224 18:59451884-59451906 GGATGGGGCACGTGGAAGGAGGG - Intronic
1159811995 18:73027013-73027035 GGATGGAGTGAGTGAAAGCAGGG - Intergenic
1159906159 18:74094348-74094370 AGCTGGAGCAAGAGAAAGGAGGG - Intronic
1160585814 18:79912796-79912818 GGCTGGCCCATGTGACAGGAGGG - Intronic
1161025076 19:2032996-2033018 GGCTGGAGAAACTGAGAGGAGGG + Intronic
1161227395 19:3153359-3153381 GGATGGATGGAGTGGCAGGATGG + Intronic
1162858287 19:13486773-13486795 GGATGGAGGAAGTGCAAGGAAGG - Intronic
1163223083 19:15935543-15935565 GGATGGGGCCAGGGACAGGAGGG + Intergenic
1164554786 19:29243210-29243232 GAAGGGAGGAAGTGAAAGGAAGG - Intergenic
1164725870 19:30465258-30465280 AGATGAAGCCAGTAACAGGATGG - Intronic
1165068510 19:33242065-33242087 GGACGGAGCCAGTGACAGGTGGG + Intergenic
1165280041 19:34788292-34788314 AGATGGAGACAGTGACTGGATGG - Intergenic
1165363938 19:35352469-35352491 GGAAGGAGCATGGGGCAGGAGGG + Exonic
1165881410 19:39046653-39046675 GGCAGGAGCAAGGGACAAGAAGG + Intergenic
1166678398 19:44753534-44753556 GGTTGGAGGAAGCGCCAGGAGGG - Intronic
1167944740 19:52979019-52979041 GGCTGGGGCAAGTGTGAGGATGG - Intergenic
1168075481 19:53978879-53978901 GGAAGGAGGAAGGGAGAGGAAGG + Intronic
1168415298 19:56163983-56164005 TGATGGAGCAGGTGCCATGAGGG + Intergenic
1168469657 19:56629938-56629960 GGATGGAGCAAGAGTGAGGCGGG - Intergenic
925299451 2:2800200-2800222 GGAAGGAGGAAGGGAAAGGAAGG + Intergenic
925347315 2:3179988-3180010 GGAAGGAGGAAGAGACAGGGAGG - Intergenic
925466470 2:4110914-4110936 GGAGGGAGGAAGGGAGAGGAAGG - Intergenic
925501683 2:4512193-4512215 GGAGGTAGAGAGTGACAGGAAGG - Intergenic
925565137 2:5244334-5244356 GGATGGAGGGAGAGAAAGGAGGG - Intergenic
925840264 2:7985402-7985424 GGATGAAGGAAGAGAGAGGAAGG - Intergenic
925862578 2:8194366-8194388 GGAAGGAGTAAGTAATAGGAAGG - Intergenic
926049611 2:9736251-9736273 AGATGGGACAAGTTACAGGAAGG - Intergenic
926276206 2:11405078-11405100 GGATGGATTAAGTGGCTGGAAGG - Intergenic
926474320 2:13303467-13303489 GGATGGAGTAAGTGCAAGCAGGG - Intergenic
928069691 2:28202318-28202340 GGATGTGGGAAGAGACAGGAAGG - Intronic
929989289 2:46771763-46771785 GGATGCAGCAAGGGCCAGGACGG - Intergenic
930280850 2:49367844-49367866 GGATGCAGCAAGGAACAGGAGGG - Intergenic
930470963 2:51812647-51812669 GGAGGGAGAATGTGACAGAATGG - Intergenic
930605879 2:53492669-53492691 GGATGGAGTGAGTGCCAGTAGGG - Intergenic
930754169 2:54958803-54958825 GCATGGCCCAAGTGACAGCAGGG - Intronic
932109874 2:68988314-68988336 GGATGGAGGGAGAGACAGAAAGG - Intergenic
932452237 2:71818907-71818929 GACTGGGGCAAGTCACAGGATGG + Intergenic
932780962 2:74558074-74558096 GGATGGAGGGAGCAACAGGAAGG + Exonic
933797028 2:85927819-85927841 GGTTGTAGCAAGTGTGAGGATGG + Intergenic
934105964 2:88694674-88694696 GAAAGGAGCAAGTGGAAGGAGGG - Intronic
936041127 2:109150279-109150301 GCTTGGAGCAAATGAAAGGAGGG + Intronic
936371414 2:111905105-111905127 GGAGGGAGGAAGTGCCAGGATGG - Intronic
936591820 2:113811573-113811595 GAATGGAGCAAGAGAGGGGAGGG - Intergenic
937463779 2:122111678-122111700 GGATGCAGCAGGTGACAGGGAGG - Intergenic
937485422 2:122310236-122310258 GCATGGAGCAAATGAGTGGAAGG + Intergenic
937790708 2:125958000-125958022 TGAAGGAGCAAGTGACCGGGAGG - Intergenic
937937775 2:127259795-127259817 GGAAGGGACAAGTGACTGGAAGG + Intronic
939269886 2:139924891-139924913 GGATGTAGAAAGTGAAAGGAAGG + Intergenic
939513090 2:143131586-143131608 GGAAGGAGCCAGTGAATGGAAGG - Intronic
939733804 2:145819140-145819162 GGATGGAGGAAAGGAAAGGAGGG - Intergenic
940441187 2:153718638-153718660 GGAGGCAGCAGGTGTCAGGACGG + Intergenic
940868491 2:158839736-158839758 GGATGAAGCAAGTCATAGGATGG + Intronic
941019030 2:160388571-160388593 GTGTGGAGCAAGGGACAAGATGG - Intronic
942615024 2:177782778-177782800 GGAGGGAGAAAGAGAAAGGAAGG - Intronic
943235003 2:185306577-185306599 GGATGAAGTAAGTGCCAGAAGGG + Intergenic
944316331 2:198289366-198289388 GGAAAGAGAAAGAGACAGGAAGG - Intronic
946242086 2:218362675-218362697 GGAAGGGGCAGGGGACAGGAGGG - Intronic
946854722 2:223941406-223941428 GGAAGGAGGAAAGGACAGGAGGG - Intronic
947070553 2:226283430-226283452 GGATGGAGTGAGTGCCAGCAAGG - Intergenic
947868928 2:233421648-233421670 GGAAGGAGCCAGAGACTGGAAGG - Intronic
948466035 2:238152074-238152096 GGGCGGAGCCTGTGACAGGAGGG - Exonic
948551552 2:238776086-238776108 GGATGCAGCAGGTGACAAGCTGG + Intergenic
1169104705 20:2984920-2984942 GGAGAGAGAAAGTGACAGGTTGG - Intronic
1169135677 20:3195654-3195676 GGATGGGGCAGGTGATTGGAGGG - Intronic
1169143382 20:3238298-3238320 GGAGGAAGGAAGCGACAGGAGGG + Intronic
1170062405 20:12273006-12273028 GGATGGAGTGTCTGACAGGAGGG + Intergenic
1170464668 20:16611706-16611728 GAATGGATGAAGTGAGAGGAGGG + Intergenic
1172305909 20:33880574-33880596 GGATGCACCAAGGGGCAGGAAGG + Intergenic
1172766093 20:37351712-37351734 GGATGGAGCAAGGGACACAATGG - Intronic
1173640895 20:44601217-44601239 GGATGCAGGCAGTGATAGGAAGG - Intronic
1173882122 20:46423442-46423464 GGATGAGACAAGAGACAGGAAGG - Intronic
1175077662 20:56389759-56389781 GGCCTGAGCAACTGACAGGATGG - Intronic
1175539374 20:59738707-59738729 GGATGAAGGGAGTGTCAGGAAGG - Intronic
1175858202 20:62133968-62133990 GGACGCAGCTAGTGGCAGGAGGG - Intronic
1177085844 21:16702923-16702945 GCAAGGAGCAAGGGACAGAAAGG - Intergenic
1179017682 21:37607097-37607119 AGATGGGGAAAGAGACAGGAGGG + Intergenic
1179100506 21:38351788-38351810 GGAAGGAGAAAGAGAAAGGAAGG + Intergenic
1179108194 21:38422288-38422310 GGCTGAAACAAGTAACAGGAGGG + Intronic
1179879622 21:44287934-44287956 GGAAGGAGAAGGGGACAGGAAGG - Intronic
1181004968 22:20008950-20008972 GAAAGGAGCAAGCAACAGGAGGG + Intronic
1181039196 22:20183980-20184002 GTATGGGGAAAGTGACAGGGTGG - Intergenic
1181779633 22:25183473-25183495 GGAAGGAGAAAGAGAAAGGAAGG - Intronic
1182017816 22:27055609-27055631 GGATAGAGCAATGAACAGGAAGG + Intergenic
1182108119 22:27703881-27703903 GGATGGAGGCAGAGACTGGAGGG - Intergenic
1182962439 22:34488287-34488309 GGAGGGAGCAAGGGAAGGGAAGG - Intergenic
1183730425 22:39615403-39615425 GGAGGAAGCAAGGGGCAGGAGGG + Intronic
1185330611 22:50250614-50250636 GGCTTGAGGAAGTGACAGGGTGG - Intronic
949850222 3:8413219-8413241 GGAAGAAGGAAGTGAAAGGAGGG + Intergenic
950620222 3:14199642-14199664 GGATGGCACAAGTGAAGGGAGGG - Exonic
950671134 3:14526042-14526064 GGGTGGAGCTGGTGGCAGGAGGG - Intronic
953026608 3:39148717-39148739 AGATGGAGGAAGAGAGAGGAAGG - Intronic
953299143 3:41753936-41753958 GGATGGAGTGAGTGCCAGCATGG + Intronic
953909217 3:46883326-46883348 GGAGGGAGGGAGGGACAGGAGGG - Intronic
954812803 3:53258234-53258256 GAAAGGAGCAGGTGAAAGGAAGG - Intergenic
954945968 3:54424653-54424675 GGATGGAGCAAGTGGCCAGGAGG + Intronic
955573920 3:60338083-60338105 AGATGCAGCAGGGGACAGGATGG + Intronic
955609984 3:60746609-60746631 GGATGGAGCAAGGGTATGGAGGG + Intronic
956290050 3:67651604-67651626 GGGTGGAGGTAGTGACAGGCAGG + Intronic
956643489 3:71435494-71435516 GGAGGGAGGAAGGGACTGGAGGG + Intronic
957189141 3:76984010-76984032 GGATGGAGTGAGTGCCAGCAGGG + Intronic
959000939 3:100963737-100963759 GGATGGAGCAGGTAAGTGGATGG - Intronic
959687803 3:109166664-109166686 GGATGGAGAAATTGAGAGAAGGG - Intergenic
960279706 3:115767512-115767534 TGAAGGAGAAAGTGAAAGGAAGG + Intergenic
960284729 3:115815033-115815055 GGCTGGAGCAAATTAGAGGAGGG + Intronic
960987791 3:123291929-123291951 AGGAGGAGCAAGTGCCAGGAGGG + Intronic
961594415 3:128005796-128005818 GGATGAAGCGAGGGAGAGGAAGG + Intergenic
961698719 3:128725363-128725385 GGATGGAACAATTGAAAGAATGG + Intergenic
962846230 3:139276104-139276126 GGATGGAGAAAATTACTGGAAGG + Intronic
963519268 3:146345068-146345090 GGATGGAGCACCTGAAGGGAGGG - Intergenic
963601810 3:147385189-147385211 GGTTGGAGCAAGGGGCTGGATGG - Intergenic
965151727 3:164986226-164986248 GTAAGGAGCAAGAGACAGGAGGG - Intronic
966226097 3:177599704-177599726 GAATGGAGCAAGAGGAAGGAAGG + Intergenic
966572709 3:181464188-181464210 GAATGGAGAAAGGGGCAGGAGGG - Intergenic
967776865 3:193394404-193394426 GGATGGAGTGAGTGGCAGCAGGG + Intergenic
967881373 3:194304148-194304170 TGATGGTGCAAGGGACAGAAGGG + Intergenic
968570398 4:1337413-1337435 GGATGGAGTCAGTCACAGGCAGG - Intronic
969283363 4:6186392-6186414 TGATGGAGGATGAGACAGGAAGG + Intronic
969463891 4:7343514-7343536 AGAGGGAGCAGGTGCCAGGATGG - Intronic
969710483 4:8840470-8840492 GGATGGGGCAAGAGCCAGGGTGG - Intergenic
970267264 4:14302002-14302024 GGATGGAGTGAGTGAAAGCAGGG + Intergenic
970522365 4:16898713-16898735 GGAGGGAGCACGGGAGAGGAGGG + Exonic
973101702 4:46280413-46280435 GGAAAGAGCAAGGGATAGGAAGG + Intronic
973634887 4:52852628-52852650 GGATGGAGGAAGAGAGAGGGAGG + Intergenic
976764270 4:88582761-88582783 GGTGGCAGCAAGTTACAGGAAGG - Intronic
977176402 4:93825861-93825883 GGATGGAGTAAGTGCAAGCAGGG - Intergenic
978437007 4:108696343-108696365 GGATGACGCAAGTGACAGCAAGG + Intergenic
980279951 4:130706599-130706621 GGATAGAGCAAGTGCAAGCAGGG + Intergenic
980459152 4:133083051-133083073 AAATGGAGCAAGTGACTGAAAGG + Intergenic
980663727 4:135900400-135900422 GAATGAAGCAAGAGACAGAAGGG - Intergenic
981557250 4:146008509-146008531 GGAAGGAGAAAGGGAAAGGAAGG - Intergenic
981557264 4:146008559-146008581 GGAAGGAGAAAGGGAAAGGAAGG - Intergenic
983527308 4:168772198-168772220 AGAGGGAGCAAGTGACAGCTAGG + Intronic
983758568 4:171375085-171375107 GCAAGAAGCAAGTGAGAGGAAGG - Intergenic
985950433 5:3218330-3218352 GGCTGGAGCCAGGGTCAGGAGGG + Intergenic
986517698 5:8581113-8581135 GAATGGGGCAGGTGCCAGGAGGG - Intergenic
987066593 5:14296041-14296063 GCAGGCAGCAAGAGACAGGAAGG + Intronic
988878234 5:35471980-35472002 GGATGGAGGAAAGGACAGGTGGG - Intergenic
990886036 5:60594729-60594751 GGAGGGAGCCAGGGAAAGGAAGG + Intergenic
992176002 5:74149209-74149231 TGAAGGAAAAAGTGACAGGATGG - Intergenic
992638878 5:78751601-78751623 GGAGGGTGCAAGTGGCAGCAAGG - Intronic
992666417 5:79013771-79013793 AGCAGGAGCAAGAGACAGGAGGG + Intronic
994523359 5:100871304-100871326 GGATGGAGGAATTGACTGGCTGG - Intronic
996993609 5:129667599-129667621 AGAGGGAGCAAGGGGCAGGAGGG - Intronic
997439241 5:133897600-133897622 GGGTGGAACATGTGACAGGCCGG + Intergenic
998010851 5:138694548-138694570 AAAAGGAGCAAGTGAAAGGAGGG + Intronic
998037162 5:138926900-138926922 GGGTGGAGCAAGTGAGAGGGAGG - Intronic
998980251 5:147694561-147694583 GGAGGGAGGGAGAGACAGGAAGG - Intronic
999770287 5:154770469-154770491 GGAGGGAGCCAGGGACAGGCCGG - Intronic
999811055 5:155127337-155127359 GGAAGGAGCAAGGGACAGGAAGG + Intergenic
999832635 5:155335479-155335501 AGATGGAGTAGGGGACAGGATGG + Intergenic
1000372365 5:160549325-160549347 GGATGGGGTAAGGGGCAGGAAGG + Intergenic
1001241892 5:170077632-170077654 GGAGGAAGAAGGTGACAGGAAGG + Intronic
1001420747 5:171585265-171585287 GTATGGAGCAAATGAGAAGAAGG + Intergenic
1002071770 5:176682774-176682796 GGATGGAGAAACTCACAGGGAGG - Intergenic
1002179807 5:177425563-177425585 GGAGGGAGCAAGTGAGGGCAGGG - Intronic
1002636942 5:180613209-180613231 GGATGGGGAAAGGGACAGGACGG - Intronic
1002806100 6:575511-575533 AGATGGAGCGAGGGAGAGGATGG - Intronic
1003240389 6:4340569-4340591 GGCTTGAGGAAGTGGCAGGACGG - Intergenic
1003315760 6:5010502-5010524 GGCTGGAGGAAGGGATAGGAGGG - Intergenic
1004070921 6:12296712-12296734 GGATGGAGGAAGGGGCAGCAGGG - Exonic
1004392896 6:15224121-15224143 CAATGGAGAAAGTGAGAGGAAGG - Intergenic
1004596733 6:17106068-17106090 GCATGGAGCTAGGGACAGAATGG - Intronic
1005494972 6:26380532-26380554 GGATGGAAAAAGAGACAGGAAGG - Intergenic
1005991084 6:30902588-30902610 GGAGGCAGCATGTGCCAGGAGGG - Intergenic
1007340488 6:41188289-41188311 GGAGGGAGGAAGTGAAAGGCTGG + Intergenic
1007720009 6:43879226-43879248 GGATGGGGCAAGGGAGGGGAGGG + Intergenic
1007829792 6:44629571-44629593 GGCTGGAGCCTGAGACAGGAAGG + Intergenic
1008628217 6:53338283-53338305 GGATGTGACAAGTGACAGTAAGG - Intronic
1008771741 6:54987244-54987266 AGATGGAGCAAGAGAAAGCAAGG + Intergenic
1008779111 6:55080763-55080785 GTGTGGAGGAAGTGATAGGAGGG + Intergenic
1011045914 6:83082510-83082532 GGTTTGAGGAAATGACAGGATGG + Intronic
1011558595 6:88593012-88593034 GGATGTTGCAAGTGTGAGGAGGG + Intergenic
1011627122 6:89291682-89291704 TGATGGAGTAAGAGAAAGGAGGG - Intronic
1011866870 6:91840054-91840076 GGTTGGAGCAAGTGCCATGTTGG + Intergenic
1011902283 6:92313740-92313762 GAATGAAGCATGTGTCAGGAAGG - Intergenic
1013167238 6:107605231-107605253 GAATAGAGCAAGTCAAAGGAGGG + Intronic
1015512266 6:134049521-134049543 GGATGGAGCAACTCACACAAGGG - Intronic
1016573259 6:145538442-145538464 GGATGGAGAGTGTGACAGTAAGG - Intronic
1018149676 6:160926318-160926340 GGATGGGGCAGGAGACCGGAGGG + Intergenic
1018252774 6:161888814-161888836 GGAGGGAGCTAAGGACAGGAGGG - Intronic
1018340421 6:162846009-162846031 GAAGGGAGCCAGTGACAGGGTGG + Intronic
1018597303 6:165495356-165495378 GGAGAGAGAAAGGGACAGGAAGG + Intronic
1018764864 6:166925332-166925354 GGATGGAGGAAGTGAGAGCTGGG - Intronic
1018845949 6:167555765-167555787 GAATGGAACAAGTCACTGGATGG - Intergenic
1019023731 6:168940909-168940931 GGGTGGAGGAAGGGACAGCAAGG + Intergenic
1019128911 6:169859534-169859556 GGTTGGAGCAGCTGCCAGGAGGG + Intergenic
1019517050 7:1444738-1444760 GGATAGAACAAGTGACGGGGTGG + Exonic
1019709724 7:2512653-2512675 GGATGGATGAACAGACAGGAAGG + Intronic
1019963316 7:4479474-4479496 GGATGGAGCTACTTACCGGAGGG - Intergenic
1020212607 7:6167376-6167398 AGCTGGAGCAAGTGCCTGGAAGG - Intronic
1020408764 7:7867008-7867030 GCATGGAGGAAGTGAGAGGGAGG + Intronic
1021254945 7:18380542-18380564 GGATGCAGCAATTGACTGTATGG + Intronic
1021584555 7:22193835-22193857 AGATGGAGCAAGGGAAGGGAAGG + Intronic
1021589220 7:22242403-22242425 GGATGGAGCATGTGGCAGGGAGG + Intronic
1022183004 7:27940103-27940125 GTAGGGAGCAGGTGAGAGGAGGG - Intronic
1022529290 7:31057177-31057199 GGACGGAGCGAATGAGAGGAGGG - Intronic
1022960289 7:35419526-35419548 GGATGGAGCATGTGACGGGGTGG - Intergenic
1023104278 7:36748101-36748123 GGCTGGAGTTAGTCACAGGATGG + Intergenic
1023443761 7:40210837-40210859 GGGTGGAGCAGGTGATTGGAAGG + Intronic
1023897035 7:44442544-44442566 GGAGGGGACAAGTGACAAGATGG + Intronic
1024063571 7:45715875-45715897 TGATGGTGCAAGAGGCAGGATGG + Exonic
1024873722 7:53995941-53995963 GGATGGACCCAGGAACAGGAGGG - Intergenic
1026357786 7:69574502-69574524 GGACAGAGTAAGTGCCAGGAAGG + Intergenic
1026927476 7:74204273-74204295 GGAGGGAGAAAGGGAAAGGAGGG + Intronic
1026927490 7:74204314-74204336 GGAGGGAGAAAGGGAAAGGAGGG + Intronic
1026927505 7:74204355-74204377 GGAGGGAGAAAGGGAAAGGAGGG + Intronic
1027545940 7:79527839-79527861 GGATGGAGGGAGTGAGAGGGAGG - Intergenic
1028390132 7:90306359-90306381 AGATGGAGCCACTGACATGATGG + Intronic
1029543158 7:101196393-101196415 GGAAGGAGCAAGAGAGAAGAGGG + Intronic
1032471530 7:132182517-132182539 GGATGGAGGAAGAGACACCAAGG - Intronic
1033214058 7:139481552-139481574 GGAAGGAGCAACGGCCAGGAGGG - Intronic
1033271981 7:139940204-139940226 GGATGCAGGAAATGACAGGGGGG + Intronic
1033577512 7:142700526-142700548 GGATGGAGTGAGTGCCAGCAGGG + Intergenic
1034737511 7:153442686-153442708 GGATGGAGTAAGTGCAAGCAGGG - Intergenic
1036121055 8:6018225-6018247 AGATGAAGAAAGTGGCAGGAAGG + Intergenic
1036428405 8:8667322-8667344 GGATGGAGCTCATCACAGGAGGG + Intergenic
1036509817 8:9389875-9389897 GGAATGAGCAAGTTACAGGTGGG + Intergenic
1036754316 8:11462219-11462241 GGATGGAGCAAGTTAGAACAGGG + Intronic
1037265895 8:17060187-17060209 GGATGGAGAATGAGACAGGATGG - Intronic
1037340291 8:17837451-17837473 GCAGGGATCAAGTGTCAGGATGG + Intergenic
1037421673 8:18709350-18709372 GGATGGAGCCCCTGACGGGAGGG + Intronic
1037567223 8:20128053-20128075 GGAGGGAGGAAGGGAGAGGAGGG + Intergenic
1037956594 8:23065086-23065108 TGGTGGAGCAGGTGACAGCAGGG - Intronic
1038018087 8:23531369-23531391 GCATGAAGCAAGTGAGAGCAGGG - Intronic
1038822601 8:30966359-30966381 GGAGGGAGGTAGTAACAGGAAGG + Intergenic
1039046162 8:33451843-33451865 GGATGGAGTGAGTGCCAGCAGGG + Intronic
1039459243 8:37729509-37729531 GGAGGGAGCAAGAGAGAGGGAGG + Intergenic
1039800291 8:40948819-40948841 GAGTGGAGAGAGTGACAGGAAGG + Intergenic
1039923579 8:41909680-41909702 GGAGGAAGAAAGTGACAGGGAGG - Intergenic
1041441155 8:57898473-57898495 GGATGGAGAAAGCTTCAGGATGG - Intergenic
1042352119 8:67787854-67787876 GGCTGGAGCAAGAGTGAGGATGG + Intergenic
1042596519 8:70453700-70453722 GGATGGAGAAAGGAAAAGGAAGG - Intergenic
1042908119 8:73795358-73795380 GAAGGGAGCAAGAGACAGGAAGG - Intronic
1042989122 8:74619594-74619616 GGATGGAGTAAGTGCAAGCAGGG + Intronic
1043570751 8:81599944-81599966 GGATGGAGCGAGTGCAAGCAGGG - Intergenic
1044711951 8:95067047-95067069 GGATGGAGCTGGTGCCAGGGAGG + Intronic
1045666044 8:104485777-104485799 TGGTGGAGCAGGTGAAAGGAGGG + Intergenic
1047457564 8:125029949-125029971 GCTTGGAGCAAGAGAAAGGAAGG + Intronic
1048820082 8:138372368-138372390 GGATGGAGGGAGGGGCAGGATGG + Intronic
1048845521 8:138601206-138601228 CGATGGAGCCAGGGACATGAGGG - Intronic
1049267637 8:141677577-141677599 GGATGGAGCATGTGTCATGCAGG - Intergenic
1049454615 8:142680657-142680679 GGAAGGAGGAAGGGAGAGGAAGG + Intronic
1050160808 9:2717473-2717495 GGAAGAAGCAAGTGTTAGGAGGG - Intergenic
1051385235 9:16500668-16500690 GGATGGAGCAGGAGGCATGAGGG + Intronic
1052549438 9:29929232-29929254 TGAAGGAGCAAGTGACATAAAGG + Intergenic
1052685994 9:31756686-31756708 GGAAGGAACAGGTGACAAGAAGG + Intergenic
1052891007 9:33700349-33700371 GGATGGAGTGAGTGCCAGCAGGG + Intergenic
1053455558 9:38230866-38230888 GGGTGGAGAAAGTCAGAGGATGG - Intergenic
1054916028 9:70496152-70496174 GGCTAGAGCAAGTGGGAGGATGG - Intergenic
1055477597 9:76678377-76678399 GGAAGGAGAAAGGGAAAGGAGGG + Intronic
1056670315 9:88622397-88622419 AGATGGAGCAAGAGACAAAAAGG + Intergenic
1057143963 9:92746095-92746117 GGAGGGACCATGTGTCAGGAGGG - Intronic
1057707901 9:97410813-97410835 TGAGGGGGCAAGTGACAGGGAGG + Intergenic
1058645393 9:107127272-107127294 GGAAGGAGACAGTGACAAGAAGG + Intergenic
1058897599 9:109413621-109413643 GGATGGAGCCAATGACAAGGGGG + Intronic
1058980864 9:110168933-110168955 TGATGCTGCAAGTGACAGGTGGG - Exonic
1059152289 9:111959892-111959914 GCATGGAGCCAGTGACAGACTGG - Intergenic
1059568255 9:115406097-115406119 GGATGCAGCAGTTGACAAGACGG - Intergenic
1060659361 9:125394826-125394848 GGATGGAGTGAGTGAGAGCAGGG - Intergenic
1060818490 9:126648357-126648379 GGAAGGAGCCAGTGCCAGGGTGG - Intronic
1061850110 9:133409914-133409936 GGATGGAGTCAGAGTCAGGAGGG + Intronic
1061944339 9:133900330-133900352 GAATGGAACTAGTGACAGGAGGG - Intronic
1061947439 9:133916574-133916596 GGATGGAGAAGGGGAAAGGAGGG + Intronic
1185753428 X:2632736-2632758 GGCTGGAGCAGATGGCAGGATGG - Intergenic
1186362098 X:8852930-8852952 AGATGGGGCAAGGGAGAGGAGGG - Intergenic
1187126325 X:16457643-16457665 GGAGGGAGAAAGGGAAAGGAGGG + Intergenic
1187198325 X:17109604-17109626 GGCTAGAGGATGTGACAGGAAGG + Intronic
1187447669 X:19373134-19373156 GGAAGGAGGAAGAGAGAGGAAGG + Intronic
1187977602 X:24718879-24718901 GGATGGGGGAGGTGACAGAAAGG + Intronic
1188359141 X:29231130-29231152 GGATGGAGCTATTGAGAGGGTGG + Intronic
1188776595 X:34227133-34227155 GGAAGGAAGAACTGACAGGATGG + Intergenic
1190729699 X:53217480-53217502 TGGTGGAGGAAGTGACTGGAAGG - Intronic
1192343261 X:70281272-70281294 GGATGCAGAAAGGGAAAGGAGGG - Intronic
1194589830 X:95786316-95786338 GGATGGAGTGAGTGCCAGCAGGG - Intergenic
1196834513 X:119802045-119802067 GGAAGGAGAAAGAGAAAGGAAGG - Intergenic
1197862470 X:130985102-130985124 GCATGGAGCAGGTGACAGGAAGG - Intergenic
1197869272 X:131050322-131050344 GGCTGGGTCAAGTGGCAGGACGG - Intergenic
1197869385 X:131050965-131050987 GGATGGAGCAAGCAGGAGGAGGG - Intergenic
1198517078 X:137420420-137420442 GGAAGGAACAATTGAAAGGAAGG + Intergenic
1198833122 X:140772228-140772250 GGAGGTAGCAAGAAACAGGATGG - Intergenic
1199134926 X:144237871-144237893 GGAGGGAGGAAGAGACAGGGAGG + Intergenic
1199287952 X:146074658-146074680 GGATGGAGTAAGTGCAAGCAAGG + Intergenic
1200273774 X:154712585-154712607 GGGTGGACCAAATGACTGGAGGG + Exonic
1202605634 Y:26637543-26637565 GAATGGACAAAGTCACAGGAGGG - Intergenic