ID: 906819048

View in Genome Browser
Species Human (GRCh38)
Location 1:48910207-48910229
Sequence TTACCTGCTTAATATAGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906819048 Original CRISPR TTACCTGCTTAATATAGTCA GGG (reversed) Intronic
902045484 1:13520863-13520885 TTGCCTGCTTAATATTCTAAAGG + Intergenic
905932166 1:41796622-41796644 TTACCTGCTCAAGATAATGATGG - Intronic
906819048 1:48910207-48910229 TTACCTGCTTAATATAGTCAGGG - Intronic
907660747 1:56390418-56390440 TTCCCTGCCTAAGAAAGTCAGGG - Intergenic
909371642 1:74889887-74889909 TTCCCTTCTTCATATAGTCAAGG - Intergenic
910000464 1:82335325-82335347 CAACCGGCTTAATATACTCATGG - Intergenic
910392475 1:86759110-86759132 TTATATGCTTAATATATTCTAGG + Intergenic
910609412 1:89125582-89125604 GTATCTGCTTAATAAAGTTAGGG - Intronic
911783153 1:101909420-101909442 TTACATGATGAATATATTCATGG - Intronic
911828810 1:102523897-102523919 TTCCCTCCTTAATATGGACAAGG + Intergenic
912066525 1:105751782-105751804 TTACGTGCTGAATATATTGAAGG - Intergenic
917695755 1:177521760-177521782 CTGCCTGCTTAATATGGGCATGG - Intergenic
924310714 1:242740247-242740269 TAAACAGCTTATTATAGTCAAGG + Intergenic
1063515737 10:6693365-6693387 TTACCTGCTCAATAAATTCTCGG + Intergenic
1064472043 10:15645267-15645289 TTACCTACTTTGTATACTCAAGG + Intronic
1065316036 10:24464925-24464947 TTACCTGCTTATTATGGGCAGGG - Intronic
1068305675 10:55204190-55204212 TTACATATTTAATATACTCAAGG + Intronic
1068922891 10:62503580-62503602 TCAACTGCTTAACATTGTCAGGG + Intronic
1073508064 10:104019904-104019926 TTACCTGTTTAATTTTATCACGG - Exonic
1073547887 10:104367827-104367849 ATATCTGCTTAGGATAGTCAAGG + Intronic
1074693662 10:116029028-116029050 TTTCCTGCACATTATAGTCACGG - Intergenic
1077948874 11:6932801-6932823 TTACCTACAGAATAAAGTCAAGG - Intronic
1078209473 11:9258863-9258885 TTCACTGCTCAATACAGTCAAGG + Intronic
1080603896 11:33847909-33847931 TTACTTGCTTAGTGTAATCAGGG - Intergenic
1080818543 11:35782646-35782668 TTTCCTGATTAATAGAGACATGG - Intronic
1086504672 11:87492936-87492958 TCTCCTACTTAATATATTCACGG - Intergenic
1089574569 11:119432324-119432346 AGACATGGTTAATATAGTCATGG + Intergenic
1090269255 11:125374429-125374451 TCAGCTGCTGACTATAGTCAGGG + Intronic
1090930457 11:131293514-131293536 TTAGCAGCTTAATAATGTCAGGG + Intergenic
1092980089 12:13786153-13786175 GTACCTGCTTAGTTTAGTCGAGG - Intronic
1093253494 12:16837490-16837512 ATACATGCTTAAAATAGTCAAGG - Intergenic
1094763221 12:33559825-33559847 TTAATTGCTTATTATACTCAAGG - Intergenic
1097462207 12:59875628-59875650 TTACCTGCTTGATGGAGTCAAGG + Intergenic
1098311157 12:69150478-69150500 TTACTTTCTTCATAGAGTCACGG + Intergenic
1099073532 12:78076830-78076852 TTACTTGCTTAAGAAATTCAAGG + Intronic
1100012037 12:89965216-89965238 TTACCTCCTTATTATAGGTAAGG + Intergenic
1101233257 12:102763629-102763651 TTTCCTGCTTAATAGTGTAATGG + Intergenic
1104765094 12:131325351-131325373 TTACCTGCTTTCCATTGTCATGG + Intergenic
1106202702 13:27554515-27554537 TTACTTGCATAATATTTTCAGGG + Intronic
1107308788 13:39053398-39053420 TTACCTGCTTGTATTAGTCAGGG - Intergenic
1108635842 13:52333777-52333799 ATACCTGCTTAATAGAGTTGTGG - Intergenic
1108651966 13:52489471-52489493 ATACCTGCTTAATAGAGTTGTGG + Intergenic
1110457107 13:75701546-75701568 TCAAATGCTTAATATAATCATGG - Intronic
1115044652 14:28976700-28976722 ATACCTTCTTGAAATAGTCATGG - Intergenic
1116308318 14:43287713-43287735 TTACAAGCTTAATTTAGGCATGG - Intergenic
1118631922 14:67713331-67713353 TTACCTGCTTTCCATCGTCATGG + Intronic
1118726953 14:68635309-68635331 TTACCTGCTTTATATAGTGGAGG + Intronic
1119955862 14:78798217-78798239 TTACTTCCTAAATATATTCAGGG + Intronic
1124111231 15:26790567-26790589 TTACCTGCTAAGAAAAGTCATGG + Intronic
1125409516 15:39390874-39390896 TTACATGGTTAATATAGGGAAGG + Intergenic
1126962548 15:54013818-54013840 CTAAGTGCTTAATATAATCATGG - Exonic
1133629803 16:7609329-7609351 TTTCCTGCTTAATAGACCCAAGG - Intronic
1134142715 16:11735592-11735614 TTATCTGCTGAATATAGTTCTGG + Intronic
1134345868 16:13391264-13391286 TTATCTGCTTAACTTAGTCTTGG + Intergenic
1135674623 16:24404883-24404905 TTACCTGCTTATTAGAATCGTGG + Intergenic
1137382026 16:48008301-48008323 TTAACTGCCTGATACAGTCAGGG - Intergenic
1139114149 16:63928548-63928570 TAAACTGCCTAATATTGTCAGGG + Intergenic
1139611328 16:68061095-68061117 TTACCTTCTCAATCTTGTCAGGG - Exonic
1140297408 16:73722410-73722432 TTTCCTGGTTCATAAAGTCAAGG - Intergenic
1140552384 16:75880827-75880849 ATAACTACTTAAAATAGTCACGG + Intergenic
1149472217 17:56926193-56926215 TTACCTGCTTTCCATCGTCATGG - Intergenic
1153471211 18:5448016-5448038 TTACCTGCTAAATATCAGCATGG + Intronic
1153623384 18:7000826-7000848 TTTCCTCCTTAAAATAGTAAAGG + Intronic
1153652547 18:7253937-7253959 TTACATGCTTATTACAGACATGG + Intergenic
1158366268 18:56740563-56740585 TGACCAACTTAATATAATCAGGG + Intronic
1158427044 18:57349684-57349706 TTAACTGCTTAATATAGGCCAGG + Intergenic
1159543196 18:69806474-69806496 TTTCCTGCTTAATACATACAGGG - Intronic
1160065454 18:75570082-75570104 TCACATGGTTAATATAGTGAAGG + Intergenic
1161874655 19:6898709-6898731 TTACCTGCTTAATTAATTAAGGG + Intronic
925508213 2:4593774-4593796 TTACCTGTTTAATAGATACATGG - Intergenic
925835226 2:7938654-7938676 TTATCTGCATAAGATACTCAGGG + Intergenic
931545641 2:63382827-63382849 TTTACTGCTTAGTATAGTCAGGG - Intronic
932014274 2:68008636-68008658 TTACCTGCAAAATATACTAAGGG + Intergenic
934045078 2:88166597-88166619 TCACCTGCATAATATTTTCACGG + Intergenic
934807205 2:97242576-97242598 TTACCTTCTTAACCTAGTCTTGG + Intronic
937658552 2:124404494-124404516 TGACCTGCTTAACAAAGTCAAGG + Intronic
940240309 2:151555601-151555623 TAACCTGGTTTATATAATCATGG - Intronic
940623058 2:156138544-156138566 TTAGCTGCTCAATATTGACATGG + Intergenic
942423703 2:175836610-175836632 ATTCCTGATTAATGTAGTCACGG - Intergenic
946571127 2:221025400-221025422 TAACCTGCTTAATAAAGGGAGGG + Intergenic
947324765 2:228962168-228962190 TTGCCGTCTTAATAGAGTCAGGG + Intronic
1170484294 20:16800485-16800507 TTCCCTGCTTAAAATAAGCAGGG + Intergenic
1171961492 20:31498009-31498031 TTACCTGGTCACCATAGTCATGG + Intergenic
1173831346 20:46090652-46090674 GTACCTGATTAATATAGCTATGG - Intergenic
1174669093 20:52289297-52289319 TTACCTGCCTAGTATATTCCAGG - Intergenic
1177617255 21:23538973-23538995 TTATCTCCTTAATACAGTCTTGG - Intergenic
1177884367 21:26731333-26731355 TTATCTGCTTCATGTAGACAGGG + Intergenic
1178728290 21:35075180-35075202 TTATCTGCCTAATATAGACACGG + Intronic
955752616 3:62197711-62197733 TTACCTGATTAATAGACCCAGGG + Intronic
956070389 3:65443574-65443596 TTACCTGTTTAATAAAGTTTTGG - Intronic
956110078 3:65861417-65861439 ATCCCTGTTTTATATAGTCATGG + Intronic
963896380 3:150689252-150689274 TTACCTGCCTTCTATTGTCATGG - Intronic
964562406 3:158011871-158011893 TTACCTACTTAATTTTGTCTGGG + Intergenic
967614544 3:191548606-191548628 TTACCAACTTAATAATGTCATGG - Intergenic
969469741 4:7380640-7380662 GTTCCTCCTTAATAAAGTCAGGG + Intronic
969887654 4:10230045-10230067 GTACCTCCTAAATATAGCCAAGG - Intergenic
970333446 4:15005362-15005384 TTACCTACTTAAAATACACACGG - Intronic
971133655 4:23841552-23841574 TTGGCTGCTTAATTTGGTCATGG - Intronic
973103323 4:46298918-46298940 TTAATTGCTAAATATAGTGAGGG + Intronic
975008193 4:69316862-69316884 TTAAATTCTTAATATATTCATGG + Intronic
976895879 4:90110581-90110603 TTACCTGTTTAACTTAATCAAGG + Intergenic
979295007 4:119022208-119022230 GTACCTCCTTCTTATAGTCATGG + Intronic
981640784 4:146941349-146941371 ATATCTGCTGAATATATTCAAGG - Intronic
984426710 4:179596904-179596926 TTACCTGCTTATTTCAGTCCAGG - Intergenic
985298882 4:188465816-188465838 TTGAATGCTTAATATATTCATGG - Intergenic
985526692 5:406834-406856 TTACCAACTTAATATACTAAAGG + Intronic
986692264 5:10322720-10322742 TTATGTTCTTAATATAGTTAAGG + Intergenic
987024682 5:13913243-13913265 TTAACTGCTTTATCTTGTCATGG - Intronic
987721158 5:21634169-21634191 TTACCTGCTTAGGATACTCTTGG - Intergenic
988654125 5:33189382-33189404 TTAACAGCTGAATATGGTCAGGG - Intergenic
989246757 5:39263864-39263886 TTACCTGCTTCATATTTTGAGGG - Intronic
989437990 5:41436890-41436912 TTAGATACTTAATATAGTCAAGG + Intronic
989548775 5:42707365-42707387 TTACCTGTCTAATATTTTCATGG - Intronic
991312716 5:65262242-65262264 TGACCTGCATAAAACAGTCATGG + Intronic
991491636 5:67189353-67189375 TTACCTGCTTTCTATTTTCAAGG - Intronic
992954437 5:81892761-81892783 TGACCTGCTTAATACATTCTAGG + Intergenic
995526748 5:113056241-113056263 GTACCTGCTTCATAAAGTCAGGG + Intronic
999274429 5:150319487-150319509 TTCCCTGCTTAGGATAGTCAAGG - Intronic
1000903325 5:166934819-166934841 TAACCTGCTTAATCATGTCAAGG + Intergenic
1001004832 5:168041009-168041031 TTACTTACTAAATATTGTCAAGG - Intronic
1001252381 5:170156537-170156559 CAAACTGCTTAATATATTCAAGG + Intergenic
1001319116 5:170665776-170665798 ATATCTCCTTAATATTGTCAAGG - Intronic
1002982566 6:2154966-2154988 TTACCTACTTCATATGGTTAAGG + Intronic
1005295608 6:24423208-24423230 TTACCTGCTTCATAGGGTTATGG + Intronic
1008410591 6:51174241-51174263 TTCCCTGCTTAATGTAGATAAGG + Intergenic
1008950936 6:57158425-57158447 TTATATGCTGAATATAGCCAAGG + Intronic
1009029628 6:58041085-58041107 TGACCTGCTTCATGGAGTCAGGG + Intergenic
1009205165 6:60792474-60792496 TGACCTGCTTCATGGAGTCAGGG + Intergenic
1009399396 6:63236586-63236608 TTACCTGTGTAACATTGTCAAGG - Intergenic
1009452311 6:63816441-63816463 TTTCCTGCTTAAGATGGTCAGGG - Intronic
1010121481 6:72380459-72380481 TTACTTTATTATTATAGTCAGGG + Intronic
1014145026 6:117987624-117987646 TTACCTGCTTAAGAATGGCATGG + Intronic
1014536924 6:122625436-122625458 TAACCTGCTTTATACATTCATGG - Intronic
1018145517 6:160883656-160883678 TTACCTGCTTTCCATCGTCATGG - Intergenic
1020829953 7:13082700-13082722 TCATCTGCTTAATAAATTCAGGG + Intergenic
1021102639 7:16601306-16601328 TTACCTGCATATTATAGACAAGG - Intronic
1021113824 7:16725941-16725963 TTTCCCGCTTAATTTAATCAAGG - Intergenic
1021509164 7:21416623-21416645 TTACCTGCTTATTTTAGTTCAGG + Intergenic
1022677752 7:32515523-32515545 TTACCTGCCTTCTATTGTCATGG - Intronic
1026434343 7:70381788-70381810 CTACCTGCTAAATATTCTCAAGG + Intronic
1028749359 7:94365259-94365281 TTATGTGCTGAATATATTCAAGG - Intergenic
1028955837 7:96688869-96688891 TGACCTGCTTAATACATTCTAGG - Exonic
1031861581 7:126985769-126985791 TTAACTGATTAATGTATTCATGG - Intronic
1032914237 7:136469998-136470020 TGATCTGCCTAATATTGTCAGGG + Intergenic
1035838670 8:2786951-2786973 TTTCCTGATTGATACAGTCATGG - Intergenic
1035869438 8:3121241-3121263 TAACCTGCTGACTATAGTCAGGG - Intronic
1038452438 8:27648655-27648677 TTACCAGCTTAAAATATTCTCGG + Intronic
1042839955 8:73113615-73113637 ATACCTGCTTAATAGACACAGGG - Intronic
1043443569 8:80298138-80298160 TTACCTGCCCAATATAATCTTGG - Intergenic
1044101320 8:88143552-88143574 TTATGTTCTTAAGATAGTCAAGG + Intronic
1045335529 8:101200364-101200386 TAACATGCTTAATATAATAAGGG - Intronic
1045951422 8:107855682-107855704 GTACCAGCTTAATATAGTAGTGG + Intergenic
1046993042 8:120482593-120482615 TTAATTGTTTAAAATAGTCATGG + Intronic
1047301453 8:123616977-123616999 TTACCTTGTAAATATAGACAGGG + Intergenic
1050808260 9:9711103-9711125 TTACCTGCTTATTACAGTTTAGG - Intronic
1052781659 9:32787317-32787339 TTACCTACTTAAGATACTTAAGG + Exonic
1052864438 9:33456601-33456623 TTACCTGCTTAAAACCTTCAGGG - Intergenic
1057520698 9:95757949-95757971 TTATTTGCTTATTAGAGTCAGGG + Intergenic
1060561925 9:124552574-124552596 GTACCTGCTTAATACGGACACGG - Intronic
1186939130 X:14485527-14485549 TGAACTGGTTACTATAGTCAAGG + Intergenic
1187424596 X:19165696-19165718 TAACATGCTTAATCTAGTCCTGG + Intergenic
1189319393 X:40078582-40078604 TTAGCTGCTTAATCTAATCCAGG - Intronic
1189386861 X:40544292-40544314 TTCCCTGCTTCTTATAGTTAAGG + Intergenic
1195463956 X:105159094-105159116 ATACCTACTTCATATAGTTATGG - Intronic
1196898963 X:120364691-120364713 TTAGGTGCTTATTATAATCAAGG - Intronic
1197390617 X:125859162-125859184 TTAACTGCTTATTATATGCAAGG - Intergenic
1198066360 X:133100433-133100455 ATACCTGCTTTATATACTGATGG - Intergenic
1201789651 Y:17825446-17825468 TTATATGCTTAATAGAGACAGGG + Intergenic
1201811903 Y:18080543-18080565 TTATATGCTTAATAGAGACAGGG - Intergenic
1202351302 Y:23995196-23995218 TTATATGCTTAATAGAGACAGGG + Intergenic
1202519477 Y:25674923-25674945 TTATATGCTTAATAGAGACAGGG - Intergenic