ID: 906820154

View in Genome Browser
Species Human (GRCh38)
Location 1:48920829-48920851
Sequence TACCATGCTGACTGTGGTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906820154 Original CRISPR TACCATGCTGACTGTGGTAG TGG Intronic
902780776 1:18703391-18703413 TAGCAGGCTGACTGCGGTTGGGG + Intronic
902791982 1:18775582-18775604 GAACACCCTGACTGTGGTAGGGG + Intergenic
904618631 1:31762980-31763002 GACCAAGCTGACTGCGGGAGTGG + Intronic
905101429 1:35526218-35526240 TACCATGCTGTCTGTTGTTTTGG + Intronic
906820154 1:48920829-48920851 TACCATGCTGACTGTGGTAGTGG + Intronic
910221909 1:84896587-84896609 AAGCATGCTTACTGTAGTAGTGG - Intergenic
911705656 1:101009389-101009411 AACCATAATAACTGTGGTAGTGG + Intronic
913616482 1:120565072-120565094 AACCATGCTTACTGAGGCAGGGG + Intergenic
914573795 1:148945839-148945861 AACCATGCTTACTGAGGCAGGGG - Intronic
917726575 1:177833487-177833509 TACCAGCCTGTCTGGGGTAGGGG - Intergenic
918005355 1:180536760-180536782 TACAACGCTGACTGTTCTAGAGG - Intergenic
918076448 1:181174846-181174868 TAACATCCTGACAGTGGTTGGGG + Intergenic
919085316 1:192913986-192914008 TAACGTGCAGACAGTGGTAGAGG - Intergenic
1063410337 10:5832318-5832340 TGTGATGCTGACTGGGGTAGTGG - Intronic
1064186338 10:13165313-13165335 TTCCATGGTCACTGTGGTTGAGG - Intronic
1064194361 10:13233450-13233472 TGCCCGGCTGACTGTGGGAGAGG + Intronic
1064759121 10:18600580-18600602 TCCCAGGCTGAGTGTGGTGGTGG - Intronic
1065615522 10:27517778-27517800 TGGTATGCTGACTGTGGTGGTGG - Intronic
1069335157 10:67340458-67340480 TAGCATGCTGAGTGTGTTAAAGG - Intronic
1076006370 10:126950850-126950872 TACCATGATGATGGTGGTACTGG + Intronic
1079203033 11:18391603-18391625 TTCCATAGTGACTGTGCTAGGGG + Intergenic
1080481236 11:32652152-32652174 TGCCTAGCTGGCTGTGGTAGTGG + Intronic
1081150792 11:39628489-39628511 GATGATGATGACTGTGGTAGTGG + Intergenic
1082118855 11:48356636-48356658 TGCCATGCTGCCTGGGGTTGTGG + Intergenic
1082255476 11:50028681-50028703 TGCCATGCTGCCTGGGGTTGTGG - Intergenic
1084858041 11:72001294-72001316 TCCCAGGCCGACTGTGGGAGGGG + Exonic
1090980760 11:131719521-131719543 TTGCAGGCTTACTGTGGTAGAGG + Intronic
1091054581 11:132406205-132406227 TACCAGGCTGAGTGTGGTGCTGG + Intergenic
1099861589 12:88230246-88230268 TACCATGGGGAATGTGGAAGTGG - Intergenic
1101344621 12:103875063-103875085 TACCATGCTGGCTATTGTAGTGG - Intergenic
1104541871 12:129673086-129673108 TTCTATCCTGACTGTGGTAGTGG - Intronic
1108298850 13:49053865-49053887 TACAATGCTGTCTGTTGTGGGGG - Intronic
1108611362 13:52087205-52087227 CACCATGCTGAGTGTTATAGGGG - Intronic
1111656741 13:91163347-91163369 TTCTATGTTGACTGTGGTGGTGG + Intergenic
1113072856 13:106438492-106438514 TACCATGCAGACCGGGGTTGTGG - Intergenic
1114635597 14:24185082-24185104 TGCATTGCTGCCTGTGGTAGGGG - Intronic
1115198228 14:30825151-30825173 TAAGATGGTGATTGTGGTAGTGG - Intergenic
1115455702 14:33599787-33599809 TTTCATGCTGACTCTTGTAGGGG + Intronic
1119445165 14:74657287-74657309 TACCATGCTGACTGTGACTTAGG - Intronic
1120240870 14:81948314-81948336 TACCAGGCTGACTATCCTAGAGG + Intergenic
1120571544 14:86124002-86124024 TGAGAGGCTGACTGTGGTAGTGG + Intergenic
1121096950 14:91224026-91224048 GACCAGGGTGACTGTGGGAGTGG - Intronic
1123192379 14:106583600-106583622 TACAATGCAGACTATGTTAGGGG - Intergenic
1123962378 15:25417933-25417955 TACCATGCTGAGAGTTGTTGGGG - Intronic
1132836246 16:1954729-1954751 GACCCTGCTGACTGTGCCAGGGG - Intronic
1135296389 16:21283179-21283201 TGCCATCTTCACTGTGGTAGTGG - Intronic
1135612429 16:23880116-23880138 TACCATGCTGCCTGGCTTAGGGG - Intronic
1137705806 16:50535064-50535086 TCCCATCCAGACTGTGGTTGGGG + Intergenic
1138624932 16:58243918-58243940 CATCATGCTGACTGCGGTAGTGG + Intronic
1139913551 16:70414006-70414028 TATCATGTTGAGTGTGGTGGGGG + Intronic
1143577654 17:7804001-7804023 TAACAAGCTGATTCTGGTAGTGG + Intronic
1144860682 17:18299609-18299631 TCCCATGGCAACTGTGGTAGAGG - Exonic
1148042828 17:44722431-44722453 TACCCTGCTGACTCTGGTTAGGG + Intronic
1148201319 17:45751925-45751947 TACAATGCAAACTGTGTTAGAGG - Intergenic
1149089469 17:52761458-52761480 GACCAACCTGACTGTGGTTGTGG + Intergenic
1150918823 17:69462211-69462233 TCCCCTGCTAACTGAGGTAGAGG - Intronic
1150974921 17:70074630-70074652 TACAATGCAGGCTGTGGTATAGG - Intronic
1155115960 18:22767369-22767391 TGCCATGCTGCCTTTGGAAGGGG + Intergenic
1157626041 18:49051964-49051986 TCCCTTGCTCACTGTGGGAGAGG - Intronic
1157879251 18:51304508-51304530 AGCTATGCTGACTGTGGTTGGGG - Intergenic
1159988019 18:74868601-74868623 AACCATGCTGACGGGGGTTGTGG - Intronic
1160113509 18:76056062-76056084 TACCCTGCTAACTGTAGAAGAGG + Intergenic
1161453195 19:4357902-4357924 TAGCATCCTTACTGTGGGAGAGG - Intronic
1167457126 19:49602221-49602243 TACCCTGCTGTGGGTGGTAGAGG + Intronic
1168411357 19:56142060-56142082 CTCCATCCTGACTGGGGTAGAGG - Intronic
931735659 2:65191094-65191116 CACTATGCTGACTGAGGTTGAGG - Intergenic
932488056 2:72097888-72097910 TTCTATCCTGATTGTGGTAGTGG - Intergenic
934719432 2:96563103-96563125 CAGCAGGCAGACTGTGGTAGCGG + Intergenic
937495128 2:122411286-122411308 TTCCATGGTGACTGAGCTAGGGG - Intergenic
938227353 2:129627304-129627326 TGCCAGGGTGGCTGTGGTAGGGG + Intergenic
939021886 2:136967084-136967106 TACCATGCTGAGCACGGTAGAGG - Intronic
944984759 2:205163156-205163178 CACTATGCTGACTTTGGGAGTGG + Intronic
1170906610 20:20520917-20520939 TAACCTGCTGACTGTTGAAGAGG - Exonic
1176960532 21:15154384-15154406 TACCATGCCAACTGAGGTGGAGG - Intergenic
1181613968 22:24039019-24039041 CAGCATGGGGACTGTGGTAGTGG + Intronic
1183934147 22:41252620-41252642 TCCCATGCTGACTGGGGTTAGGG - Intronic
950727428 3:14925907-14925929 TATCTTGCTGACTTTGGTACTGG + Intronic
950860566 3:16144398-16144420 AACCATGCTGCCTGTGATGGGGG + Intergenic
952179613 3:30903968-30903990 TGTAATGTTGACTGTGGTAGGGG - Intergenic
954818309 3:53302053-53302075 TAGCATCTTGACTGTGGTAGTGG + Intronic
957355134 3:79073540-79073562 TACCATGCAGTCTTTGATAGAGG + Intronic
957744979 3:84328757-84328779 TATCCTGATGACTGTTGTAGTGG - Intergenic
961421815 3:126811985-126812007 TACCATGCTGCTTGTGGTGAGGG + Intronic
962774463 3:138645984-138646006 TTCCATGCTGAATGTGGGAGTGG + Intergenic
966831330 3:184011953-184011975 TTGCATCCTGACTGTGGAAGCGG + Intronic
966898995 3:184466868-184466890 TGCCATGCAGACTGTGTCAGCGG - Intronic
969245134 4:5927039-5927061 TACGATGCCCACTGTGGAAGGGG + Intronic
972998305 4:44911651-44911673 CAGAATGTTGACTGTGGTAGTGG + Intergenic
975231946 4:71945919-71945941 TTCCTTGCTGATTGTGGCAGAGG - Intergenic
977469169 4:97420324-97420346 TCCCATGTTGACTGTGCTGGAGG - Intronic
981469663 4:145116910-145116932 TCCCATGCTAGCTGTAGTAGGGG - Intronic
986646089 5:9917323-9917345 TACCATGATAACTCTGGAAGAGG - Intergenic
990598541 5:57334560-57334582 TACCCTGCTGTCTGTGCTGGGGG + Intergenic
993547570 5:89230578-89230600 TACCATACTTACTGAGCTAGGGG + Intergenic
995725079 5:115173455-115173477 TACCAAGCTGCCTGTGGTCCAGG - Intronic
1001569526 5:172721051-172721073 AAGCATGCTGGCTGTGGTCGGGG + Intergenic
1004673347 6:17817941-17817963 TACCATGATGGTTGTGGTATAGG + Intronic
1009921684 6:70069594-70069616 TAGCATGTTGTCTGTGGTATGGG - Intronic
1011829620 6:91355776-91355798 CACCAGGGTGAGTGTGGTAGAGG + Intergenic
1013097989 6:106963299-106963321 TACCATGGTAACTGGGGGAGGGG - Intergenic
1016624472 6:146149999-146150021 CATCATGCTGACTGTGTTAGAGG + Intronic
1018445311 6:163852911-163852933 GGCCATGCTGAGTGTGATAGGGG + Intergenic
1020049325 7:5071805-5071827 TTCCATGCTGAGGGTGGCAGAGG + Intronic
1020827428 7:13047469-13047491 TACCATGCTGAACATGCTAGAGG - Intergenic
1024587369 7:50853732-50853754 CACCATGCTCACGGTGGTGGTGG + Intergenic
1026598154 7:71751776-71751798 TACGATGCTGGCTGTAGCAGAGG + Intergenic
1029039158 7:97554696-97554718 TACCACACTGACTGAGGTGGTGG + Intergenic
1029504617 7:100955300-100955322 TACCATGGTACCTGAGGTAGGGG - Exonic
1034073655 7:148211427-148211449 TACCTTGCTGACTGAAGGAGTGG + Intronic
1038407560 8:27333361-27333383 GACCATGCTGACTTCGGTGGAGG + Intronic
1040996271 8:53405983-53406005 CACGATGCTGACTGTGGCATGGG - Intergenic
1042243899 8:66691728-66691750 TATCATGCTGACTGTGTTAAGGG + Intronic
1044228794 8:89750315-89750337 TACCATACTGTCTGAGGGAGAGG - Intergenic
1045106532 8:98898114-98898136 TACCAGGTTGCCTGTGGGAGTGG + Intronic
1046057564 8:109097015-109097037 TACGATGGTGATTGTGTTAGTGG + Intronic
1049004611 8:139846798-139846820 CACCATGCTGTCTGTGGAGGAGG + Intronic
1049369008 8:142254623-142254645 CACCATGCTGGCTGTGGGAGAGG + Intronic
1049845553 8:144799125-144799147 GTCCATGCTGGCTGTGGTCGGGG + Intronic
1051504477 9:17812337-17812359 TACCCTGCTGACTGTGAGAGGGG + Intergenic
1052354418 9:27489551-27489573 TACAATGCTGCCTGTGATGGAGG + Intronic
1056812594 9:89776019-89776041 TCCCATGCAGGCTGTGGTTGTGG - Intergenic
1058166632 9:101626456-101626478 TAACATGAAGACTGTGGTTGCGG + Intronic
1060768494 9:126312820-126312842 TACCTTGCCATCTGTGGTAGAGG - Intergenic
1060780687 9:126410226-126410248 TACCAGGCTGACTGTAGAATGGG - Intronic
1062039363 9:134396978-134397000 TGCCAGTCTGACTGTGGTGGGGG - Intronic
1187917780 X:24171389-24171411 GTACATGCTGACAGTGGTAGAGG + Intronic
1189019478 X:37319637-37319659 TACCATGCTGTCAATGCTAGGGG - Intergenic
1190559960 X:51677401-51677423 GAGCATGCAGACTGTGATAGTGG + Intergenic
1190564331 X:51715920-51715942 GAGCATGCAGACTGTGATAGTGG - Intergenic
1191714148 X:64182596-64182618 TCCCCTGCTGACTGGGGGAGAGG + Intergenic
1192472299 X:71409753-71409775 TATAATGCTGAGTGTGGCAGGGG - Intronic
1197093521 X:122567308-122567330 TATCATGCCCACTATGGTAGAGG + Intergenic
1199236918 X:145503301-145503323 TCCCATACTGACTGTGGTGATGG - Intergenic
1199786988 X:151114598-151114620 ATTCATGCTGACAGTGGTAGTGG + Intergenic