ID: 906821431

View in Genome Browser
Species Human (GRCh38)
Location 1:48934413-48934435
Sequence CTCTCTAAAGTGAAATTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906821426_906821431 9 Left 906821426 1:48934381-48934403 CCCACTGTGATTATTAATGCTAT 0: 1
1: 0
2: 2
3: 23
4: 250
Right 906821431 1:48934413-48934435 CTCTCTAAAGTGAAATTGGGAGG 0: 1
1: 0
2: 1
3: 13
4: 133
906821427_906821431 8 Left 906821427 1:48934382-48934404 CCACTGTGATTATTAATGCTATC 0: 1
1: 0
2: 0
3: 23
4: 210
Right 906821431 1:48934413-48934435 CTCTCTAAAGTGAAATTGGGAGG 0: 1
1: 0
2: 1
3: 13
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906821431 Original CRISPR CTCTCTAAAGTGAAATTGGG AGG Intronic
901310154 1:8263179-8263201 CACTCTGAAATGAGATTGGGGGG + Intergenic
901669086 1:10843913-10843935 CTATCTAAAGTGAAATGCAGAGG - Intergenic
906821431 1:48934413-48934435 CTCTCTAAAGTGAAATTGGGAGG + Intronic
911135659 1:94437093-94437115 CTCTATAATATGAAATTGCGAGG + Intronic
916117275 1:161497171-161497193 TTCTCTAAAGTGATTTTTGGGGG - Intergenic
917593561 1:176503281-176503303 TTCTCTAAAGTGGAAGTGAGTGG - Intronic
918052666 1:180988196-180988218 CTCGCTTCAGTGAAATTGAGGGG - Intronic
920448814 1:206041353-206041375 CTCTCTGAAGGGCAATTTGGTGG - Intronic
924361309 1:243244394-243244416 TTCACTAGAGTTAAATTGGGAGG - Intronic
1065217551 10:23463981-23464003 TTCACTAAATTGAATTTGGGAGG + Intergenic
1065986195 10:30954685-30954707 CTCTCTAAAATAAATGTGGGTGG + Intronic
1066104947 10:32148262-32148284 CTCTCTAGAATGAAACTGAGAGG - Intergenic
1067986791 10:51156997-51157019 CTCTCTTTAGTGAAATTAAGTGG + Intronic
1069858253 10:71453622-71453644 CTCTTTAAAGGGACATTGGGAGG - Intronic
1076098667 10:127755776-127755798 CTCTCTAGACTGAAAATGGCAGG - Intergenic
1082651477 11:55799435-55799457 CTCTCTAAATTGGAATTGGCAGG - Intergenic
1090534601 11:127626748-127626770 ATTTCTAAAGTGAAACAGGGTGG + Intergenic
1092835809 12:12486938-12486960 TTCTCTAAAGAAAAAATGGGGGG + Intronic
1096973407 12:55684875-55684897 CACTCTAAGGGGAAGTTGGGTGG + Exonic
1098704916 12:73675011-73675033 CTCACAAAAATGAATTTGGGAGG - Intergenic
1098783242 12:74715225-74715247 CTCCTTAAAATGAAAGTGGGTGG - Intergenic
1107063484 13:36187056-36187078 ATCTCTAAAGAGAAAGGGGGAGG + Intronic
1108094398 13:46885616-46885638 TTCTCTCAAGTGGAATTGGTAGG + Intronic
1108621449 13:52188495-52188517 CTCTGGAAAGTATAATTGGGTGG - Intergenic
1108665193 13:52623049-52623071 CTCTGGAAAGTATAATTGGGTGG + Intergenic
1110580756 13:77122271-77122293 GTCTGTCAAGTAAAATTGGGGGG + Intronic
1110940562 13:81343418-81343440 CTCCCTGAAGTGAATTTGTGAGG + Intergenic
1111287086 13:86109208-86109230 CTTTCTAAAGTGAAACTTGCTGG - Intergenic
1113525943 13:110976615-110976637 CTCACTAAAGTGAAATTGTATGG - Intergenic
1114599110 14:23940099-23940121 ATCTCTGTAGTGAAAGTGGGGGG - Intergenic
1115231944 14:31170011-31170033 CTCTCTTTAAAGAAATTGGGAGG - Intronic
1117985630 14:61383845-61383867 CTTTCTAAAGTGACAATGGAAGG + Intronic
1119302637 14:73583566-73583588 CTCTCTAAACTGAAAATTGGCGG + Intergenic
1121883124 14:97517992-97518014 CAGACTAAAGTAAAATTGGGAGG + Intergenic
1123821018 15:24030677-24030699 TTGTCTACAGTGGAATTGGGTGG + Intergenic
1130105961 15:80928684-80928706 CTCTCTAGAGTCAGAGTGGGAGG + Intronic
1131717504 15:95129477-95129499 CTCTCCAAAGCTAAATTGTGAGG - Intergenic
1133192518 16:4144913-4144935 CCCTTAAAAGTGAAATTGGCCGG + Intergenic
1136159184 16:28407073-28407095 CTCTCTAAAGTGGAACAGTGTGG - Intergenic
1136203903 16:28708210-28708232 CTCTCTAAAGTGGAACAGTGTGG + Intronic
1136563212 16:31053479-31053501 CTTTCTAAACTGAAAGAGGGTGG - Intergenic
1140259222 16:73362766-73362788 CACTCTAATGTGAAATTAGGGGG + Intergenic
1143241867 17:5450371-5450393 CTCTGTACAGTGGAATTTGGGGG + Exonic
1148083600 17:44980853-44980875 CTCTCTACTGTGACACTGGGAGG - Intergenic
1150482236 17:65519529-65519551 TTCCCTAAAGTGAGGTTGGGAGG + Intergenic
1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG + Intronic
1150977437 17:70104296-70104318 CTCTCTAATCTGAAATTTAGAGG + Intronic
1152589114 17:81202659-81202681 CTCACTAAAGTTACATTGAGAGG + Intronic
1153106105 18:1529019-1529041 ATTTCTAATGTTAAATTGGGAGG + Intergenic
1153692597 18:7608524-7608546 GTCTCTAAAATGAGAATGGGAGG + Intronic
1155506457 18:26538277-26538299 CTCTGTAAAGAGAAATAGGAAGG + Intronic
1164620616 19:29693923-29693945 TTCCCTGAAGTGAAATTGGTTGG + Intergenic
1165205542 19:34182178-34182200 TTCACTCAAGTAAAATTGGGAGG - Intronic
1168348396 19:55661761-55661783 CTCTTTAAAGTGAAATATTGTGG + Intronic
926154361 2:10444356-10444378 CTCACTAAAGGCAAATGGGGCGG - Intronic
927852989 2:26511372-26511394 CTCCCTAAAGTGAGATAGGGGGG - Intronic
933657863 2:84904553-84904575 CTCTTTAAAGTGGGATTTGGTGG - Intronic
933879055 2:86649801-86649823 CTCTATAAATTCAACTTGGGTGG - Intronic
938958899 2:136323295-136323317 ATCTCTAAAATGAAACAGGGAGG + Intergenic
940838453 2:158551913-158551935 CTCTCTAAACTGATTGTGGGAGG + Intronic
940951907 2:159684965-159684987 CTCACTAAAGTGGAATTTGTGGG + Intergenic
944648816 2:201807999-201808021 CTTTATAATATGAAATTGGGGGG - Intronic
945437046 2:209830984-209831006 CTGTCTAAAGTGGAATAAGGTGG - Intronic
947073084 2:226312876-226312898 TTCTCAATAGTAAAATTGGGAGG - Intergenic
948135716 2:235634652-235634674 CTCTCTAAAATGGAATGTGGAGG - Intronic
1169417343 20:5428725-5428747 CCCTGTAAAGTCAAATTTGGGGG + Intergenic
1172926412 20:38540842-38540864 TTCTTTAATGAGAAATTGGGGGG + Intronic
1179294771 21:40051869-40051891 CTCTCTCAAATGAAAATGTGTGG - Intronic
1179436879 21:41368432-41368454 CTCCCTAAACTGCAATGGGGAGG + Intronic
1180522159 22:16219296-16219318 TTCTCTAAAGTGAAGCTTGGTGG + Intergenic
1181619252 22:24077268-24077290 CTCTCTAAAGTTAATTTCAGTGG - Intronic
949095615 3:81929-81951 CTCCCTGAAGTGAAATCTGGAGG + Intergenic
950519195 3:13486426-13486448 CTCTCTAAAATGCTCTTGGGTGG - Intronic
952179036 3:30898470-30898492 CTCTCTAAAAAGAACTTGGAAGG + Intergenic
952694174 3:36246783-36246805 CTCTAGAAAGTGAATTTGGAGGG - Intergenic
952701787 3:36336192-36336214 AACTGTAAAGTGGAATTGGGAGG + Intergenic
953778461 3:45843251-45843273 CTCACTAAACAGAAATGGGGAGG - Intronic
954972563 3:54663557-54663579 CTCTCTGAAGTGAAATTAAGAGG - Intronic
956202695 3:66722789-66722811 CTCTCTTAAAAGAAAATGGGAGG - Intergenic
956451714 3:69381434-69381456 CACTCTAGAGAGAAATAGGGTGG - Intronic
958719766 3:97829323-97829345 ATCTCTAATGTGAAACTGGGTGG + Intronic
959307588 3:104688957-104688979 CTCTCTAATGTTAAATTGTATGG + Intergenic
959564994 3:107825157-107825179 CCCTCTAAAGTGAAATTGGCAGG - Intergenic
960927735 3:122812673-122812695 CTATTTAAAGTGAAGATGGGAGG - Intronic
961921501 3:130431189-130431211 CTGTGTAAAATGAAATTGGTGGG - Intronic
964119387 3:153166449-153166471 CTGTCAAAACAGAAATTGGGTGG + Exonic
965063410 3:163810740-163810762 TTCTTTAAAGTCAAATAGGGAGG + Intergenic
972366694 4:38382517-38382539 TTCTTTTAAGTGAAATTGTGTGG + Intergenic
972548861 4:40108657-40108679 CTCTCTAAACTGAATCTGTGGGG + Intronic
974565358 4:63573848-63573870 CTCTCTAGACTCAGATTGGGAGG - Intergenic
974619249 4:64335006-64335028 TTCTGCAAAGTAAAATTGGGAGG - Intronic
975562732 4:75722820-75722842 ATCTGTAAAGTGAAATTGTAGGG - Intronic
976124286 4:81817038-81817060 CTCTCTAAAGTGGTGTTTGGAGG + Intronic
976424422 4:84884902-84884924 CTCTCTAAAGTCACATACGGAGG + Intronic
976720263 4:88162499-88162521 CTAACTAAAGTTACATTGGGAGG + Intronic
977967146 4:103166337-103166359 GTCTCTAGAGTGAAATTGCCTGG - Intronic
979650379 4:123123319-123123341 CTCTCTAAAGTTAAATAGGCAGG - Intronic
980808143 4:137839962-137839984 CTTTCTATAGTGAAATTGCTGGG - Intergenic
981036533 4:140175316-140175338 CTCCATAAAATGAAATTGGTAGG - Intergenic
981625060 4:146745999-146746021 CTTTCTATATTGCAATTGGGAGG + Intronic
981938038 4:150255065-150255087 CTTTCTAAGATGAACTTGGGTGG - Intronic
983804515 4:171977589-171977611 CTCTTTAAAGTTAAAATGAGTGG - Intronic
984934243 4:184876204-184876226 CTCTCTTCACTGAAATTGTGAGG - Intergenic
987413879 5:17642745-17642767 CTCTCCAAAAAGAAATTAGGTGG - Intergenic
990522421 5:56592933-56592955 CTCTCTGAAGCTGAATTGGGAGG + Intronic
990565185 5:57020913-57020935 CTCTCTAAGGGGAAATTGTTGGG + Intergenic
993302547 5:86228998-86229020 CTTTCTAGAATGAAATTGGAAGG + Intergenic
997063308 5:130532899-130532921 CTATTTAAAGGGAAATTTGGAGG + Intergenic
999868196 5:155724736-155724758 CACTCTAAAGTGCTATTGGATGG + Intergenic
1000268288 5:159658716-159658738 CTTTGTGAAGTGAAATTGAGAGG - Intergenic
1005312024 6:24567898-24567920 GTTTCTAAGGGGAAATTGGGAGG - Intronic
1005786645 6:29251139-29251161 CTCTCTAAAATGAAATTGTTGGG + Intergenic
1012096653 6:94970963-94970985 CTCTATAAAGTTACATTGAGTGG - Intergenic
1013037858 6:106404166-106404188 ATCTGGAAAGTGAAGTTGGGAGG + Intergenic
1013185648 6:107755571-107755593 CTCTCTCCAGTGGAATGGGGGGG + Intronic
1013839268 6:114371056-114371078 AACTATAAAATGAAATTGGGTGG + Intergenic
1014017618 6:116551228-116551250 CTCTCTAAATTAAAATTCCGTGG + Intronic
1014648046 6:123999782-123999804 CTCTCTAATGTGCTAATGGGAGG - Intronic
1018668616 6:166162082-166162104 CTCTCTAAAGTGACAATGATGGG - Intronic
1021919988 7:25475259-25475281 CTCTCTAAAGTGGCAGTGTGGGG - Intergenic
1026196418 7:68177458-68177480 CTTTCTAAAGAGAAATGGTGGGG - Intergenic
1028755980 7:94434830-94434852 CTCTCTAAAATGGAAGGGGGTGG - Intergenic
1030470171 7:109953570-109953592 CTGTCTACAGTGAACTTGGTTGG + Intergenic
1030897558 7:115080121-115080143 GTCTCTAAAGTGAAATTCAGAGG - Intergenic
1031881561 7:127204443-127204465 CTCTGTAAAGTGAACATTGGAGG - Intronic
1031939148 7:127768888-127768910 CTCTTTTAAGTACAATTGGGAGG + Intronic
1033431508 7:141293710-141293732 CTCTCTAATTTGTTATTGGGAGG + Intronic
1039869767 8:41535990-41536012 CTCTCTAAATAGACATGGGGTGG + Intronic
1050109122 9:2196442-2196464 ATCTCTAATGGGAAATTGAGAGG - Intergenic
1052455760 9:28695464-28695486 TTCTCTGAAGTGAAATTGTGTGG - Intergenic
1053700836 9:40688617-40688639 TTCTCTAAAGTGAAGCTTGGTGG - Intergenic
1054312129 9:63488015-63488037 TTCTCTAAAGTGAAGCTTGGTGG - Intergenic
1054410903 9:64812072-64812094 TTCTCTAAAGTGAAGCTTGGTGG - Intergenic
1057077605 9:92146967-92146989 CTCTGTAAAGAGAAATGGGAGGG - Intergenic
1059928870 9:119241013-119241035 CTCTATAAAGCGAATGTGGGAGG - Intronic
1061627504 9:131849696-131849718 CTCTCTCACCAGAAATTGGGAGG - Intergenic
1062650325 9:137573062-137573084 CTCTCTAAAGAATAAGTGGGCGG + Intronic
1187212844 X:17246914-17246936 CTTCCTAAAGGGAACTTGGGAGG + Intergenic
1187251736 X:17604980-17605002 CTTTCTCAAGTCAAACTGGGAGG - Intronic
1188059252 X:25580532-25580554 CACTAAAAAATGAAATTGGGAGG + Intergenic
1188137303 X:26505196-26505218 CTCTCTCAGGTGAAATGGGAGGG - Intergenic
1188994316 X:36863955-36863977 ATCTGTAAAGTTAAATTGGATGG + Intergenic
1189347560 X:40253464-40253486 GTCTCTAAAGAGAGATAGGGAGG + Intergenic
1192246616 X:69378371-69378393 ATCTATAAAGTGGGATTGGGTGG - Intergenic
1193732314 X:85116077-85116099 CTCTATAAAGTGAAGTGGAGAGG + Intergenic
1195746311 X:108122066-108122088 CTCTCTAAAGTGAAATTAAAAGG - Intronic
1197615266 X:128683625-128683647 CCCTCTAAAGATAAATTGTGTGG - Intergenic
1197951309 X:131900444-131900466 CTGTCTAAGGTGACATTTGGGGG - Intergenic