ID: 906821963

View in Genome Browser
Species Human (GRCh38)
Location 1:48939501-48939523
Sequence AGCTCAAGAAAGGGGCCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 180}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906821963 Original CRISPR AGCTCAAGAAAGGGGCCTCC AGG Intronic
900706427 1:4083050-4083072 AGCAGAAGAAAGGGGCCTCTTGG + Intergenic
902645074 1:17792152-17792174 AGCTCAAGAAAGGGTGGACCAGG + Intronic
903375512 1:22863324-22863346 TGCTCAAGAAAGGGGCATCCTGG + Intronic
904624876 1:31796794-31796816 ACCACAAGAGAGGGGCCTCAAGG - Intronic
905685209 1:39902465-39902487 AGCTCAAGAAACGGGCCGACGGG - Intergenic
905979825 1:42214457-42214479 AGCTCAAGAAAGGTCCTTTCTGG + Intronic
906821963 1:48939501-48939523 AGCTCAAGAAAGGGGCCTCCAGG + Intronic
907448774 1:54528705-54528727 AACTCAAGAAAGAGGCAGCCAGG - Intergenic
907597777 1:55735501-55735523 AGACCATGGAAGGGGCCTCCAGG - Intergenic
909039073 1:70628656-70628678 AGCAGAAGTAAGGGCCCTCCAGG + Intergenic
910991057 1:93056938-93056960 AGCTCAAGAAAGGAGACGGCTGG - Intergenic
911010514 1:93276058-93276080 AGCCCAACAATGGCGCCTCCTGG - Intronic
912023530 1:105138192-105138214 TGCACAAGCAAGGGACCTCCAGG - Intergenic
916000781 1:160613140-160613162 AGCTTAAGGCAGGGGACTCCCGG - Intronic
918413885 1:184287765-184287787 AGCACAGGTAAGGGCCCTCCAGG + Intergenic
919190717 1:194214629-194214651 AACTCAAAGAAGGGGCTTCCAGG + Intergenic
919518195 1:198553710-198553732 AGCCCCAGAAATTGGCCTCCTGG - Intergenic
920120121 1:203650211-203650233 AGCTCAAGGACGGGCGCTCCCGG + Intronic
922619225 1:226980182-226980204 AGCTCAGGAAAGGTCCTTCCAGG - Intronic
922950097 1:229551792-229551814 AGCTCCAGAAAGAGTCATCCTGG + Intronic
923781756 1:237031151-237031173 AGATCAACAAAGGGGTTTCCAGG + Intergenic
1068569723 10:58615982-58616004 AGCAGAAGTAAGGGCCCTCCAGG + Intronic
1069063518 10:63918707-63918729 AGTTCAAGCAAGGTGCCTGCAGG + Intergenic
1069544873 10:69320665-69320687 AGCTCAAGACAGTGGGCTGCTGG + Intronic
1069912022 10:71765617-71765639 ATCTCAAGGAAGTTGCCTCCAGG - Intronic
1071474569 10:86014931-86014953 AACTCAAGAAAGGGTGCTCCTGG - Intronic
1071715239 10:88089096-88089118 AGCGCAGGAAAGGGGCTTTCTGG - Intergenic
1077211410 11:1372422-1372444 CCCTCAGCAAAGGGGCCTCCAGG + Intergenic
1077468725 11:2746881-2746903 AGATCCAGGAAGGGACCTCCTGG + Intronic
1078462042 11:11521567-11521589 AGCTCAGGAAAGTGGCTGCCTGG - Intronic
1078857590 11:15219364-15219386 TGCTCTACAGAGGGGCCTCCTGG - Intronic
1080233682 11:30045618-30045640 AGCACAGGTAAGGGACCTCCAGG + Intergenic
1080596337 11:33777134-33777156 AGCCCAGGAAAGGGCTCTCCTGG - Intergenic
1082624666 11:55468673-55468695 ACCCCAAAATAGGGGCCTCCAGG - Intergenic
1083323796 11:61863245-61863267 AGCTCAGCGCAGGGGCCTCCGGG - Intronic
1084566944 11:69935232-69935254 AGCACAAGAAAGGTGCCTGCAGG - Intergenic
1085888866 11:80553885-80553907 AGGTAAAGAAAAGGGCTTCCAGG + Intergenic
1088837462 11:113589923-113589945 AACTCAAGAAAGGGGAGCCCTGG - Intergenic
1089567344 11:119378711-119378733 AGGCAAAGAAATGGGCCTCCAGG + Intronic
1091223582 11:133945032-133945054 AGCTGAGGAAGGGTGCCTCCAGG - Intronic
1091842359 12:3630239-3630261 GGCTCAAGTCAGGAGCCTCCTGG + Intronic
1093364657 12:18278310-18278332 AGATGAAGAAAGGGGCCACATGG - Intronic
1096538405 12:52289635-52289657 AGCTCAGGTATGGGGCCTCCTGG + Intronic
1096540372 12:52303729-52303751 AGCTCAGGTATGGGGCCTCCTGG - Intronic
1101880367 12:108622133-108622155 AGCCCATGAAAGAGGCTTCCTGG + Intergenic
1107306474 13:39025634-39025656 AGCCCAAGAATAGGGCCTCAAGG - Intronic
1109229417 13:59738386-59738408 AGCTCAGCAGAGGAGCCTCCAGG + Intronic
1111692887 13:91586689-91586711 ATATCAAGAAAGGGACCTGCTGG - Intronic
1112011097 13:95294512-95294534 AGCTGAATAAAGAGGCCTCCTGG - Intronic
1113647788 13:112011246-112011268 TGCTCAAGTCTGGGGCCTCCAGG + Intergenic
1113869707 13:113551731-113551753 AGGTCAAGAAAGGGTTCTGCTGG - Intronic
1114479457 14:23023290-23023312 AGAGAAAGCAAGGGGCCTCCAGG + Intronic
1118011761 14:61616978-61617000 AGCTCAAGTAATTGGCCTTCAGG + Intronic
1120673192 14:87387926-87387948 AGATCAAGAAAGAGGCCATCTGG - Intergenic
1121536446 14:94694374-94694396 CCCTCAAGACTGGGGCCTCCTGG + Intergenic
1122360690 14:101160379-101160401 AGATCAAGAAAGAGGCCATCCGG + Intergenic
1122503330 14:102216234-102216256 AGCTCTCAAAAGCGGCCTCCTGG + Intronic
1122749269 14:103920764-103920786 GACTCAAGAAAGGGGCCGGCCGG - Intronic
1123195402 14:106611114-106611136 AGCTCCAGGAAGGGGCTCCCCGG - Intergenic
1126269070 15:46791528-46791550 AGATCAAGAAAGGTGACTCAGGG + Intergenic
1132020621 15:98358861-98358883 AGAGCAAGAAAGGGCCCCCCAGG + Intergenic
1132713171 16:1278222-1278244 AGCTAATGAAAGGGGGCTCAGGG + Intergenic
1132828720 16:1917495-1917517 TACTGTAGAAAGGGGCCTCCAGG - Intronic
1133417247 16:5616295-5616317 AGCTCCAGGAAGCGGCCACCAGG - Intergenic
1133877412 16:9748298-9748320 AAAACAAGAAAGGGGGCTCCTGG + Intergenic
1134033962 16:11015484-11015506 AATTCCAGAAAGGGGCCTCATGG + Intronic
1136568698 16:31084478-31084500 AGCTCAAGAACGGACCTTCCAGG - Intronic
1139851048 16:69951759-69951781 AGCCCCAGACAGGGGCCTGCGGG + Intronic
1139880028 16:70174671-70174693 AGCCCCAGACAGGGGCCTGCGGG + Intronic
1140372483 16:74420846-74420868 AGCCCCAGACAGGGGCCTGCGGG - Intronic
1141130837 16:81435415-81435437 AGCTCAAGAAAGGAGCCCAAGGG + Intergenic
1141424396 16:83935813-83935835 AGCAGAAGAAAGGGGCTTCTGGG - Intronic
1141805196 16:86337281-86337303 AGCTCAGGAAATGAGCCCCCGGG - Intergenic
1142271614 16:89092693-89092715 AGCTCAGGAAAGGGCACTTCAGG - Intronic
1142850073 17:2700582-2700604 AAGTCAAGCATGGGGCCTCCAGG + Intronic
1143501985 17:7344566-7344588 AGCTTAAGAGAGGGGCCTGGTGG + Exonic
1144773236 17:17771017-17771039 GGCTCAGGAAAGGGGGCTTCAGG + Intronic
1145887143 17:28390152-28390174 AGCTCAAAGCAGGGGCTTCCAGG + Intronic
1147673709 17:42191132-42191154 AGCTCGATAAAGGGGGCCCCAGG + Exonic
1151117699 17:71756432-71756454 AGCTCAGGAGAGGGGCCTAGGGG + Intergenic
1152531202 17:80920309-80920331 AGCTAAAGAAAGCTCCCTCCAGG + Intronic
1155249510 18:23941259-23941281 GGCTGGGGAAAGGGGCCTCCAGG - Intronic
1155818591 18:30347413-30347435 AGCTCATGAAAGGAGCCTGGAGG - Intergenic
1159769377 18:72530721-72530743 AGCTCCAGAGAGAGGCCTCCGGG - Intergenic
1162819198 19:13212497-13212519 GGCTCACGAAAGCGGCCTCAAGG - Exonic
1164542577 19:29131952-29131974 ATCTGAGGAGAGGGGCCTCCAGG + Intergenic
1166959867 19:46490908-46490930 AGCCCAAGGAAGGGCACTCCAGG + Intronic
925276080 2:2649331-2649353 AGCTCAGGAAAGAGGCTGCCTGG - Intergenic
925890247 2:8427588-8427610 AACTCAGGAATGGGGACTCCAGG + Intergenic
927811092 2:26180517-26180539 AGGCCAAGAAAGGGGCCTTCAGG - Intronic
927818787 2:26244582-26244604 AGCTCAAGATGGTGGCCTGCCGG - Exonic
929671528 2:43879577-43879599 ATCTCAAGAATGGGGTCTGCAGG - Intergenic
933771775 2:85749198-85749220 AGCTCCAGAAAGGGCCAACCAGG - Intergenic
935816929 2:106854628-106854650 AGTTAAAGAGAGGTGCCTCCTGG - Intronic
936947043 2:117940461-117940483 AGATCAGGAAAGGGGCCTCCAGG + Intronic
938188154 2:129251782-129251804 AGATCAAGAATGGGGACTACAGG - Intergenic
939896128 2:147793198-147793220 AGCTAAAGGAATGGACCTCCAGG + Intergenic
943319649 2:186432014-186432036 AGCACAGGTAAGGGCCCTCCAGG + Intergenic
944392322 2:199229780-199229802 AGCTCAGGTAAGGGACCTCCAGG - Intergenic
945187007 2:207149352-207149374 ACATAGAGAAAGGGGCCTCCTGG + Intronic
947301099 2:228689283-228689305 AGATGAAGGGAGGGGCCTCCAGG - Intergenic
947621005 2:231591077-231591099 AGCTCAAGAAATCCTCCTCCTGG + Intergenic
1169519363 20:6354635-6354657 AGCTGAAGAAAGGAGGGTCCTGG + Intergenic
1169746213 20:8945757-8945779 AGCTCCAGAAAGAGTCTTCCTGG + Intronic
1170554478 20:17504530-17504552 AGAGGAAGAAAGGGGCTTCCAGG + Intronic
1170663733 20:18366903-18366925 ATCAGAGGAAAGGGGCCTCCTGG + Intergenic
1171783484 20:29442462-29442484 AGCTCCAGACAGGGGCCCTCAGG - Intergenic
1172208950 20:33184254-33184276 AAAGCAAGGAAGGGGCCTCCAGG + Intergenic
1172309589 20:33907496-33907518 AGCTCTGGAGAGGGGCGTCCTGG - Intergenic
1172945554 20:38685510-38685532 AGCTGAAGAAAGAGCCCTCAAGG + Intergenic
1174090965 20:48047266-48047288 AGTTCAAGGAAGGGCCCCCCTGG + Intergenic
1175243202 20:57564712-57564734 AGCTCAAGAAAGGAAGCCCCTGG - Intronic
1175371779 20:58497177-58497199 AGCTGGTGAAAGGGGCCTCCTGG + Intronic
1175853674 20:62107404-62107426 AGCCCCAGAAAAGGGGCTCCTGG + Intergenic
1177188596 21:17824635-17824657 AGCTCATGAAAGCAGCCTCAGGG - Intergenic
1178360048 21:31941744-31941766 TGTTAAACAAAGGGGCCTCCTGG + Intronic
1179816410 21:43909124-43909146 ACTTCAAGAAAGGCTCCTCCCGG + Intronic
1179982577 21:44903972-44903994 GGATGGAGAAAGGGGCCTCCTGG - Intronic
1180906242 22:19413951-19413973 AGCTAAGGAAAGGGACCTTCTGG + Intronic
1180969618 22:19808321-19808343 ATCTGACGAAAGGGGCCCCCGGG + Intronic
1181570219 22:23764311-23764333 ACCTGAAGGAAGGGGCTTCCCGG + Exonic
1182453006 22:30432410-30432432 CCCTCCAGAAAGGGGCCACCAGG + Intergenic
1182818798 22:33194706-33194728 ATCTCAAGAATGTGGCCTGCAGG - Intronic
1182865638 22:33601955-33601977 ACCTCATGGAAGGGGCTTCCAGG + Intronic
1182928230 22:34147648-34147670 AGGTCAAGAAAGGTACCTACAGG + Intergenic
1185011913 22:48319274-48319296 AGCCCAATAAAGGGGCCCCCAGG + Intergenic
950210227 3:11117641-11117663 GGCGCCAGAAAAGGGCCTCCTGG - Intergenic
950461433 3:13124655-13124677 AGCTCAAGAAAGGGCACTGGCGG + Intergenic
950790667 3:15469234-15469256 GGCTCAAGAAATGGCCTTCCTGG + Intronic
953021031 3:39113429-39113451 AGCTCACTGAAGGGGCATCCCGG - Intronic
956904294 3:73749964-73749986 ATCTCAGGGAAGGGGGCTCCTGG + Intergenic
959562852 3:107802262-107802284 AGCTCACGTCAGGGGACTCCAGG - Intronic
960973397 3:123154870-123154892 AGCTCCAGAGAGGGCTCTCCAGG - Intronic
961539163 3:127588958-127588980 AGCTCACGATAGGGGCCTAAGGG + Intronic
963798320 3:149653574-149653596 TGCTCAGGAAAGGTGCCTTCAGG + Intronic
968079638 3:195837007-195837029 AGAACAAGAAGGGGGCATCCTGG - Intergenic
968508475 4:983487-983509 AGCTGCAGAGAGAGGCCTCCAGG + Intronic
968813750 4:2811405-2811427 AGCTGGAGAAAGGGGCTTTCTGG - Intronic
969107804 4:4820998-4821020 AGCTCAAGCATGGGGTCTCTGGG + Intergenic
969249292 4:5956532-5956554 AGCTCAAGCAGAAGGCCTCCCGG + Intronic
972322263 4:37982941-37982963 AGCTCCACCAAGGGGCCTCCAGG - Intronic
974402990 4:61427797-61427819 AGCTCAGGTAAGGGACCTCCAGG - Intronic
976342913 4:83964757-83964779 AGCACAGGTAAGGGCCCTCCAGG - Intergenic
977141328 4:93375954-93375976 AGCTGAAGAGAGAGGCCTCAGGG - Intronic
979027996 4:115601842-115601864 AGATCAAGAAAGTGGACTCATGG + Intergenic
982277513 4:153651658-153651680 AGGGCAAGAAAGGGCCCACCCGG + Intergenic
983384041 4:167035460-167035482 AGCTCAAGAAAAGTCCCTACAGG + Intronic
984316343 4:178137140-178137162 AGCGCAGGTAAGGGACCTCCAGG + Intergenic
984767976 4:183414018-183414040 AGACCAAGAAAGGGGCTGCCGGG - Intergenic
985820958 5:2160130-2160152 TGCTCAAGAAAGGAGCAGCCTGG + Intergenic
986624920 5:9715047-9715069 AGCTAAGGAAAGGGGACTCCAGG + Intergenic
989342762 5:40394874-40394896 ATCTCAAGAAAGTGGGGTCCTGG - Intergenic
993180742 5:84548887-84548909 AGGTCAAGGAAGGGGCCTGGTGG + Intergenic
997809694 5:136955115-136955137 ACCTCAAGAAATAGTCCTCCTGG + Intergenic
999663297 5:153888019-153888041 AGCTCAATAAGGGTGCCTGCTGG - Intergenic
1001240813 5:170068630-170068652 AGCCCCAGAAAGGGGCTGCCAGG + Intronic
1001557227 5:172645057-172645079 AGCTCAATAACCGGGCATCCTGG + Intronic
1001639320 5:173233972-173233994 CGCTGCAGAAAGGGGCCTTCTGG - Intronic
1002270882 5:178071113-178071135 GGCAGGAGAAAGGGGCCTCCTGG + Intergenic
1003520148 6:6851416-6851438 ATCTCAAGAAGAGGGGCTCCTGG - Intergenic
1003556313 6:7142606-7142628 AGCTCATGAAGCGGGCCTGCTGG - Intronic
1004923214 6:20395896-20395918 GGCACAAGAAAGGGTCCTCAGGG + Intergenic
1005994701 6:30924170-30924192 AGCACAAAGAAGGGGACTCCAGG - Intronic
1006866216 6:37211069-37211091 AGTTCAAGGCAGGGGCCTGCTGG + Intergenic
1009400531 6:63249508-63249530 AGATCATGAAAGCTGCCTCCAGG - Intergenic
1011118876 6:83927823-83927845 AGGTCTAGGAAGGGGCCTGCTGG + Intronic
1013246862 6:108295072-108295094 AGTTCAAGATGGCGGCCTCCTGG + Exonic
1017256523 6:152339854-152339876 AGCCCAAGAAAGGCTTCTCCAGG + Intronic
1020440900 7:8215401-8215423 AGCTCCTGGAAGGGGCTTCCTGG - Intronic
1022493666 7:30839691-30839713 AGCTGGAGAAAGGGCACTCCAGG + Intronic
1023402834 7:39802864-39802886 CCCTCAGGAAAGGGGCCTCTGGG - Intergenic
1024570974 7:50722568-50722590 CACTCAAGAAAGGGGAGTCCAGG + Intronic
1027684837 7:81267149-81267171 AGCACAGGTAAGGGACCTCCCGG - Intergenic
1028165131 7:87529914-87529936 ACCTCCAGAAATAGGCCTCCGGG + Intronic
1033002702 7:137524896-137524918 AGCTCCAGGAAGGGGAGTCCAGG - Intronic
1033429452 7:141275664-141275686 AGCTCAATCAAGGTGCCTTCTGG + Intronic
1033930137 7:146509734-146509756 AGCACAGGTAAGGGACCTCCAGG - Intronic
1034385051 7:150734049-150734071 AGGTGAGGAAAGGAGCCTCCTGG - Intronic
1034509808 7:151524452-151524474 ATTGCAAGGAAGGGGCCTCCTGG - Intergenic
1035470488 7:159106105-159106127 GGCTCAGGATAGGGGCCTGCAGG - Intronic
1037596635 8:20359789-20359811 AGGTCAAGAAAGTAGACTCCAGG - Intergenic
1038394472 8:27236849-27236871 AGCTGAAGGAAGAGGCCTCCAGG - Exonic
1038441473 8:27573634-27573656 AGCTCAAGATTGTGGCCTCCAGG + Intergenic
1040434879 8:47380515-47380537 GGCTCAAGAAAGGCACCTGCCGG - Intronic
1041777951 8:61544972-61544994 AGGTAAAGAAAGAGTCCTCCAGG + Intronic
1042605898 8:70546221-70546243 AGCCCAAGAAATGGGACTGCTGG - Intergenic
1047824047 8:128553681-128553703 AACATAGGAAAGGGGCCTCCTGG + Intergenic
1049382752 8:142325585-142325607 AGGCCAAGGAAGGGACCTCCAGG - Intronic
1053323107 9:37118302-37118324 AGCTCAAGCAAGGTGCCTCATGG - Intergenic
1056335023 9:85559909-85559931 CACTCAAGAAAGGGGACTGCAGG - Intronic
1056394520 9:86169294-86169316 AGCTCAACAAAAGGGTCTCAAGG + Intergenic
1059754778 9:117282367-117282389 AGCTCAGGAAAAGGGCCTGAAGG - Intronic
1203443505 Un_GL000219v1:33318-33340 AGCTCCAGATAGGGGCCCTCAGG - Intergenic
1203514313 Un_KI270741v1:152227-152249 AGCTCCAGATAGGGGCCCTCAGG - Intergenic
1187543937 X:20228666-20228688 AGCTCAAAAATGGGGTCGCCAGG - Intronic
1188164523 X:26845653-26845675 AGCTCAAGGATGGGGACTGCAGG - Intergenic
1189263813 X:39698311-39698333 ACCTCCAGAAAGGGCCCCCCTGG - Intergenic
1192312279 X:70026975-70026997 AGCTCCAGGAAGGTTCCTCCAGG - Intronic
1192357653 X:70419217-70419239 AGCTCCATGAAAGGGCCTCCAGG + Intronic
1193957978 X:87886191-87886213 AGCAGAAGAAAGGGGACTCTTGG + Intergenic
1194634860 X:96332918-96332940 ACCTCTAGAATGGGGCATCCTGG + Intergenic