ID: 906821970

View in Genome Browser
Species Human (GRCh38)
Location 1:48939516-48939538
Sequence GCCTTTCCTCCCCCTCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 411}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906821970_906821976 2 Left 906821970 1:48939516-48939538 CCTCCAGGAGGGGGAGGAAAGGC 0: 1
1: 0
2: 2
3: 43
4: 411
Right 906821976 1:48939541-48939563 GGGCTCTGTAAGTATTAGGCTGG 0: 1
1: 0
2: 1
3: 10
4: 223
906821970_906821978 24 Left 906821970 1:48939516-48939538 CCTCCAGGAGGGGGAGGAAAGGC 0: 1
1: 0
2: 2
3: 43
4: 411
Right 906821978 1:48939563-48939585 GATGTTGATCTGCTCTTTGGAGG 0: 1
1: 0
2: 0
3: 11
4: 124
906821970_906821975 -2 Left 906821970 1:48939516-48939538 CCTCCAGGAGGGGGAGGAAAGGC 0: 1
1: 0
2: 2
3: 43
4: 411
Right 906821975 1:48939537-48939559 GCAGGGGCTCTGTAAGTATTAGG 0: 1
1: 0
2: 1
3: 19
4: 187
906821970_906821977 21 Left 906821970 1:48939516-48939538 CCTCCAGGAGGGGGAGGAAAGGC 0: 1
1: 0
2: 2
3: 43
4: 411
Right 906821977 1:48939560-48939582 CTGGATGTTGATCTGCTCTTTGG 0: 1
1: 0
2: 0
3: 17
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906821970 Original CRISPR GCCTTTCCTCCCCCTCCTGG AGG (reversed) Intronic
900471038 1:2855073-2855095 GCCCTGGCTCCCCCTCCCGGAGG + Intergenic
901785618 1:11622599-11622621 ACCTTTCCTGCCAGTCCTGGTGG - Intergenic
902571139 1:17347704-17347726 CCCTTCCCTCCTACTCCTGGTGG - Intronic
902650545 1:17834517-17834539 GCCTCTCCTCCAGCTTCTGGAGG + Intergenic
902677447 1:18018580-18018602 GCCCTTCCTCCCCCTCATTCGGG - Intergenic
903359623 1:22768746-22768768 GCCTTCCTTCTCCCTCCTGCAGG + Intronic
903834381 1:26193385-26193407 CCTTTTCCTCCCAATCCTGGAGG + Intronic
904062540 1:27723127-27723149 GCCTTTGCACTCCATCCTGGGGG + Intergenic
904300448 1:29550331-29550353 GCCCTTTTTGCCCCTCCTGGAGG + Intergenic
904881088 1:33697616-33697638 TCCCTTCCTCTCCCTCCTGTTGG + Intronic
905680877 1:39869879-39869901 GGCTGTCCCCCACCTCCTGGAGG - Intronic
906821970 1:48939516-48939538 GCCTTTCCTCCCCCTCCTGGAGG - Intronic
907419876 1:54340054-54340076 ACCTTTCTTCCCCCACCTAGAGG + Intronic
907793217 1:57688908-57688930 TCCTTTCCTCCCCACTCTGGTGG - Intronic
908471928 1:64452896-64452918 GACTTTCCTCCCCATCCTTTAGG + Intergenic
908699082 1:66878919-66878941 CCCTTTCCTCCCACTCCTTCTGG + Intronic
912757223 1:112334431-112334453 GCCTCTCCTCTCCATCCTTGAGG + Intergenic
914845401 1:151281293-151281315 CCCTTTCCCCCGCCTCCAGGGGG + Intronic
914950259 1:152107858-152107880 GCTGTTCCTCCCTCTCCTGGCGG + Exonic
915510666 1:156385294-156385316 CCCTTTCCTGCCTCTCCAGGAGG - Intergenic
915954935 1:160213545-160213567 GCCCTTGCCCCCTCTCCTGGAGG - Exonic
919803049 1:201364979-201365001 GCCTTCCCTCCCCATCCTACTGG - Intronic
920048550 1:203149483-203149505 GCCTGTCCTCCTCCTCCTCTGGG - Intronic
920182934 1:204143615-204143637 CCCCTTCCTTCCCCTCCTGCTGG - Intronic
920640886 1:207751454-207751476 CCCTTTGCTCCCCTCCCTGGAGG - Intergenic
920915193 1:210253105-210253127 TCCTCTCCTCCCTCTCCAGGAGG - Intergenic
921904663 1:220484078-220484100 GCCTTCCCTCTCCATGCTGGAGG + Intergenic
922161299 1:223080696-223080718 ACTTTTCCTCCCTCTCCTGTGGG - Intergenic
923146572 1:231202738-231202760 GCCTTTCCAGACCTTCCTGGAGG - Intronic
923521646 1:234739495-234739517 GCCTTTCCTTCCCCTCCGGCTGG - Intergenic
1063039124 10:2318604-2318626 GTGTTTCCTCACCGTCCTGGAGG - Intergenic
1064070709 10:12226399-12226421 GGCTCTCCCCCACCTCCTGGAGG + Intronic
1064808791 10:19168760-19168782 TCCCTTCATCCCCCTGCTGGTGG + Intronic
1065817638 10:29496552-29496574 GCCATGGCTCCCCCTGCTGGCGG + Intronic
1065955226 10:30687849-30687871 GCCATGGCTCCCCCTGCTGGCGG - Intergenic
1067368395 10:45658330-45658352 GCCTTTCACCCAGCTCCTGGGGG - Intronic
1067437463 10:46288170-46288192 CCCTTTCCTGCTCCTCCTGCTGG + Intronic
1067512247 10:46905793-46905815 GGCTTTCTTCCCTTTCCTGGTGG - Intergenic
1067540383 10:47146611-47146633 GCCTGGCCTCCCCATCCTGTGGG - Intergenic
1067649997 10:48146029-48146051 GGCTTTCTTCCCTTTCCTGGTGG + Intergenic
1067830657 10:49609709-49609731 GCCTTCCCCTCCCCTCCTGGCGG + Intronic
1068056750 10:52020748-52020770 GGCTTTCTTCCCCTTTCTGGTGG + Intronic
1068443814 10:57095111-57095133 GCCTGGCCTCCCCCTGCTGCAGG + Intergenic
1069743498 10:70700286-70700308 GCATTTCCACCCTCACCTGGGGG + Intronic
1069744490 10:70706480-70706502 GCCTTCCCCTCCCCTGCTGGGGG + Intronic
1070858674 10:79630219-79630241 GCTCCTACTCCCCCTCCTGGAGG - Intergenic
1070964780 10:80523198-80523220 GGCCTTCATCCCCCTCCTGGAGG - Exonic
1071531292 10:86391984-86392006 CCCTCTGCTCCCTCTCCTGGGGG - Intergenic
1072787831 10:98296251-98296273 GGCCTTCCTCCCTCTCCTGCAGG - Intergenic
1073009949 10:100351265-100351287 GTCTTCCCTCACCTTCCTGGAGG - Intronic
1073084550 10:100879860-100879882 CCCACCCCTCCCCCTCCTGGTGG + Intergenic
1073253060 10:102133611-102133633 GCCTCCCCTCCCCCTCTAGGCGG + Intronic
1075083499 10:119399074-119399096 GCCTTGCCTCCATCTCCTGGAGG + Intronic
1075633097 10:124013132-124013154 GCCTTTCCCTCGGCTCCTGGGGG + Intronic
1075664842 10:124222799-124222821 GCCCTCCCTCCCACTGCTGGAGG + Intergenic
1076021406 10:127076812-127076834 GCCTTCCTTCTTCCTCCTGGTGG + Intronic
1076576553 10:131473695-131473717 GCATTTCCTTCCATTCCTGGTGG + Intergenic
1076637802 10:131893771-131893793 GCCTTTCTTCTCCGGCCTGGGGG - Intergenic
1077040407 11:518697-518719 GCGTTTCCTGCCCCACCTGCTGG - Intergenic
1077069478 11:661754-661776 GCCTGCCCTCCCACTGCTGGAGG + Intronic
1077610964 11:3642796-3642818 GCCTTTCCCCCACCTCCTCTGGG + Intergenic
1079128692 11:17735487-17735509 TCCTCCCCTCCCCCTCCTGGGGG + Exonic
1081785478 11:45743855-45743877 GCCTCCCCTCCCCATCCTTGAGG + Intergenic
1081976733 11:47240080-47240102 CCCTTCCCTCCACCTCCTAGGGG - Exonic
1081986883 11:47311548-47311570 GACTTTTCTTCCCCTCATGGTGG + Intronic
1083674129 11:64316117-64316139 CCCTCTCCTCCCCCTCCTAGGGG + Exonic
1083707370 11:64525751-64525773 GCCCTTCCTCCCTCACCTGCAGG - Intergenic
1083756754 11:64796104-64796126 GCCTTCCCACCCCCTCCCGCCGG - Intronic
1083802898 11:65057234-65057256 GCCTTTCCTGCCCCACCCTGGGG + Intronic
1083853323 11:65380023-65380045 GCCTTTCCTGCCTCTCCTGCTGG - Intronic
1084009204 11:66338389-66338411 GCCTATGCTCCCGGTCCTGGGGG - Intronic
1084556397 11:69878724-69878746 GCCTTTCCTCCCTCTGTGGGAGG - Intergenic
1084881291 11:72173289-72173311 GCCTCCCCTCCCCTTCCTTGTGG - Intergenic
1085038636 11:73314143-73314165 AGCTGTCCACCCCCTCCTGGTGG + Intronic
1085242639 11:75071438-75071460 GTCCTTCCTCCCCCTTCTGCTGG - Intergenic
1085556629 11:77428648-77428670 TCTCTTCCTCCCCCTCCTGATGG - Intronic
1085743944 11:79099123-79099145 GCCTTCCCTCCTCCTGTTGGAGG + Intronic
1086332591 11:85768938-85768960 GCCTTTCTGCCCACTGCTGGAGG - Intronic
1089132730 11:116224934-116224956 TCCTTTTCTCCCCCTCCTGCGGG - Intergenic
1089297991 11:117481279-117481301 CCCTCTCCTGCCCCTGCTGGTGG - Intronic
1089730840 11:120517757-120517779 CCCTTCCCACTCCCTCCTGGGGG - Intronic
1090380273 11:126321611-126321633 GCCTGTCCACTCCCTCCTGAAGG - Intronic
1090489615 11:127147069-127147091 GCCTAACCTCCCCCTCCTGATGG - Intergenic
1090901636 11:131037500-131037522 GCCTGACCTCCGCCTCCTGTCGG - Intergenic
1091237398 11:134031333-134031355 GCCTTTCCCCTTCATCCTGGGGG - Intergenic
1091685835 12:2561580-2561602 GTCTGTCCTGCCCCTCCTGTGGG - Intronic
1092086491 12:5767183-5767205 GCCTTTCATCCGTCTCCTGAGGG - Intronic
1092091027 12:5803763-5803785 CTCTTTCTTTCCCCTCCTGGAGG - Intronic
1092214964 12:6674777-6674799 GCATTTGCTCGCCCTTCTGGGGG - Intronic
1092260578 12:6951505-6951527 CCCTTACCTCACCATCCTGGGGG - Exonic
1092396929 12:8134802-8134824 GCCTTCTCACCCCCTCCAGGCGG - Intronic
1092599081 12:10039124-10039146 GCCCTGCTTCCTCCTCCTGGTGG + Intronic
1093667534 12:21832281-21832303 GCTTTTCCTCCCCCGCATTGAGG - Intronic
1096428130 12:51521303-51521325 GCCTTTCCCCCCCCACATTGAGG + Intergenic
1096873050 12:54606656-54606678 TCCTTCCCTCCTCCTCCCGGGGG + Intergenic
1097687344 12:62703417-62703439 GGCTTTCTCCTCCCTCCTGGAGG - Intronic
1097882224 12:64696263-64696285 GACTTTCCTCCCTTTCTTGGGGG - Exonic
1100268432 12:93000585-93000607 CCCTTTTCTCCCCATCCTGAGGG - Intergenic
1101593096 12:106139808-106139830 GGCCTTCCTCCCCTTCCAGGCGG - Exonic
1101989350 12:109471701-109471723 GCCTTTTCTCCCCCCCTTCGAGG - Intronic
1102841576 12:116130368-116130390 GCTTTTCTTTCCCCTCCTAGCGG - Intronic
1102924989 12:116819581-116819603 GCCATTAATCCCCCTCCTGGCGG - Intronic
1103329309 12:120142790-120142812 GGCTTTCCTGCCCCTGCTGATGG - Intronic
1103692953 12:122790704-122790726 GCCCTCCCTCCCCTTCCTGGAGG + Intronic
1103929798 12:124444029-124444051 ACCTTCCTTCCCGCTCCTGGAGG + Intronic
1104068796 12:125327462-125327484 TCATTTCCTCTCCATCCTGGTGG + Intronic
1104273612 12:127305061-127305083 GCCCTTCCCCCACCTCCTGGAGG - Intergenic
1104619823 12:130302503-130302525 GCCTCTCTTCCCGGTCCTGGTGG - Intergenic
1104666156 12:130649078-130649100 GCTTTTCCTGCCCTTCGTGGCGG + Intronic
1104943152 12:132404205-132404227 GCCTCTCCTCCCACACCTGCAGG - Intergenic
1105212328 13:18264464-18264486 GTCTTTGCTCTCTCTCCTGGTGG + Intergenic
1105280354 13:18959528-18959550 GCCTGGCCTCCCCCTCCTGAAGG + Intergenic
1110939457 13:81330884-81330906 GCCCTTCTTCCCCCTCTTGGAGG + Intergenic
1111739764 13:92189173-92189195 TCCTTTTCTCCCCTTCCTGCTGG - Intronic
1112091913 13:96091153-96091175 CCTCTTCCTCCCCCTCCCGGGGG - Exonic
1113284203 13:108828692-108828714 GCCTGTCCTGCTCCTCCTGGAGG - Intronic
1115547481 14:34476274-34476296 GGCTGTCCCCCACCTCCTGGAGG - Intergenic
1116701829 14:48254387-48254409 GCCTTTTTTCTCCCTCCTGCTGG - Intergenic
1118866827 14:69711019-69711041 GCCCTTCCTCCCTCTCCCTGTGG + Exonic
1119799084 14:77426658-77426680 GCCTTCTCTCCCGCTCCTGGTGG - Exonic
1121970308 14:98349823-98349845 GCCATTGCACACCCTCCTGGGGG - Intergenic
1122651620 14:103229803-103229825 CCCTTCCCTCCAACTCCTGGGGG - Intergenic
1124174367 15:27408446-27408468 GCCATTCCTGCCTCTCCTGAGGG - Intronic
1127725990 15:61750721-61750743 CCCTTTGCTCGGCCTCCTGGAGG - Intergenic
1129833425 15:78685638-78685660 CCCTTTCCCTCCCGTCCTGGGGG + Intronic
1129909584 15:79214985-79215007 GCCTATCCTCCCTCTCAGGGAGG + Intergenic
1130737956 15:86570375-86570397 GCCTGTCCTCCCCTTTCTTGAGG - Intronic
1131412442 15:92221069-92221091 TCCTTTCCTCCTCCTCTTGAGGG - Intergenic
1131944336 15:97602807-97602829 CCCTTTCCTCCCCCTGCTATGGG - Intergenic
1132156990 15:99502755-99502777 GCCTCTGCTCCTCTTCCTGGAGG - Intergenic
1132250323 15:100331114-100331136 GTCTTGCCTGCCCCTCCGGGGGG - Intronic
1132390818 15:101436988-101437010 GCCTGTCCTTCCACTCCTTGAGG - Intronic
1132584742 16:701192-701214 GCCTGTCCCCTCCCTCCTGTGGG - Intronic
1132689122 16:1174653-1174675 GCCTCTCCTCTCCCAGCTGGGGG - Intronic
1132980648 16:2737288-2737310 GCCTTTTGTCGCCCTCCTGCAGG - Intergenic
1133735297 16:8610421-8610443 GCCTTTCTTCCAGCTCCTGGTGG - Intergenic
1135401944 16:22172103-22172125 GCCTTTCCTCTCCCCCTGGGTGG - Intronic
1135563343 16:23493475-23493497 GGCTTTCCACCTTCTCCTGGGGG - Intronic
1135821556 16:25691124-25691146 CCCTCACCTCCCTCTCCTGGGGG - Intergenic
1136066930 16:27765594-27765616 GCCCTTCCTTCCCATGCTGGGGG - Intronic
1137565912 16:49532428-49532450 GCCCTTCCTCCTCCCCCTGGGGG + Intronic
1137625816 16:49907771-49907793 GCCTCTCCTCCCTGTACTGGCGG + Intergenic
1137991402 16:53160046-53160068 GATTTTGCTCCCCCTACTGGAGG + Intronic
1138433179 16:56982367-56982389 CCCTTTCCTCTCCCTGCTGGTGG + Intronic
1138532244 16:57640766-57640788 TTTTTTCCTCCCCCTCCTCGAGG - Intronic
1138723552 16:59110579-59110601 GGCTTTCTTCCCTTTCCTGGTGG + Intergenic
1140094090 16:71860368-71860390 GCCTCACCTCCCGCTCCTCGGGG + Exonic
1140454674 16:75098123-75098145 GCCCCTCCTCGCCCTCCTGTAGG - Intronic
1140781584 16:78301831-78301853 GCCTTTCTTCCACCTTCTTGGGG + Intronic
1141625940 16:85261101-85261123 CCCTTACCACCCCCGCCTGGAGG + Intergenic
1142305611 16:89283076-89283098 GTCCTTCCTCCTTCTCCTGGAGG + Exonic
1143118680 17:4594519-4594541 TCCTGTCCTCTCCCTCCTGCCGG - Intronic
1143157921 17:4850497-4850519 GTCCTTCCTCCCCTTCCTGCTGG + Intronic
1143166143 17:4898115-4898137 CCCTTTCTTCCCCACCCTGGAGG - Exonic
1143172288 17:4937339-4937361 GCCCTTCCTCCCCCTCATTGAGG - Exonic
1143830793 17:9648757-9648779 GCCTTTCCTCCCCAGCCAAGTGG - Intronic
1147588592 17:41666933-41666955 GCGTTTCCTCCCCTTCCCAGCGG - Intergenic
1147971855 17:44222368-44222390 GCCTTTCATCCCCGGCCTGCAGG - Intergenic
1148073144 17:44920346-44920368 GGCTTTGCTCCCTCTCCTTGAGG - Intergenic
1148736894 17:49870015-49870037 GCTTGCCCTCCCCCTCCAGGAGG - Intergenic
1148895176 17:50835352-50835374 CCCTTTCCCCCACCTCCTTGGGG - Intronic
1149388892 17:56170236-56170258 GCCTTCCTTCTTCCTCCTGGAGG - Intronic
1149602845 17:57904362-57904384 GCCTTTCCCACCACTCCTGGTGG - Intronic
1150271804 17:63871691-63871713 TCATTTCTTCCCGCTCCTGGAGG + Intergenic
1150277483 17:63909277-63909299 TCATTTCTTCCCGCTCCTGGGGG + Intergenic
1150292022 17:63987673-63987695 GCCTTTCCACCCCTCCCTGAAGG + Intergenic
1150806982 17:68327054-68327076 GTCTTTCCTTACCCTCCAGGAGG - Intronic
1151153008 17:72104294-72104316 GACTTTCCTACCCCACCTTGGGG + Intergenic
1151345144 17:73496828-73496850 CCCCATCCTCCCCCTCCTGAAGG + Intronic
1151564555 17:74890532-74890554 GCCTTTCCTCCCCAGCTTCGAGG + Intronic
1151811733 17:76447577-76447599 TCATTCCATCCCCCTCCTGGAGG + Intronic
1151847597 17:76668215-76668237 CCCTTTCCTCCTCCTCCTGCAGG + Intergenic
1152585699 17:81188551-81188573 GCCTGGCCAGCCCCTCCTGGGGG + Intergenic
1152620841 17:81364085-81364107 GCCTCTCCCCCAGCTCCTGGTGG + Intergenic
1156184616 18:34647390-34647412 GCCATTTTTCCCCCTACTGGTGG - Intronic
1157488611 18:48107169-48107191 TCCCTTCCTCCCTCTCCTGACGG - Intronic
1157516430 18:48314936-48314958 CCCTCAGCTCCCCCTCCTGGGGG + Intronic
1158294700 18:55983060-55983082 TCTTTTCCTCCTCCTCTTGGAGG - Intergenic
1158681852 18:59575099-59575121 GTCTGTCCTCCACCTTCTGGAGG - Intronic
1160050809 18:75431535-75431557 CCCCTTCCTCCCACCCCTGGTGG + Intergenic
1160855185 19:1214098-1214120 GCCGGGCTTCCCCCTCCTGGAGG + Intronic
1161058949 19:2204847-2204869 GCCCTTCCTGCTCCTCCTGAGGG + Intronic
1161153448 19:2721068-2721090 GCCTCCCCTCCCCCACCCGGAGG - Intronic
1162016152 19:7847642-7847664 GCCCATCCTCCCCCTCCTGGGGG - Intronic
1162417209 19:10545016-10545038 GACTTCCCGCCCCTTCCTGGGGG + Exonic
1163471762 19:17501266-17501288 GCCTTACCCTCCACTCCTGGAGG - Exonic
1164582408 19:29442649-29442671 GCCTTCCCTCCCGCCTCTGGAGG + Intergenic
1165226258 19:34357377-34357399 GACCTTCCTCTCCCACCTGGGGG + Intergenic
1166359700 19:42247992-42248014 GCCTGCCCTGCCCCTCCAGGGGG - Exonic
1167078654 19:47264596-47264618 GCCGCTCCTCCCACTCCTGGGGG - Exonic
925141547 2:1553292-1553314 GCCTTACCTCGTCCTCCTAGAGG + Intergenic
925258225 2:2507671-2507693 GCCTGCCCTCCCCGTCCCGGGGG + Intergenic
925614705 2:5734415-5734437 GCCTCTCTTCCACCTTCTGGTGG - Intergenic
925856625 2:8135155-8135177 GCCTGGCCTCCTCCTCCAGGTGG - Intergenic
925860799 2:8173291-8173313 GCCTTTCCTGCACCACGTGGTGG - Intergenic
926048272 2:9726349-9726371 GCATTGCCTCCTCCTCATGGTGG + Intergenic
926176109 2:10593759-10593781 GCCTTGCCCTCCCCTCCTTGTGG - Intronic
926419796 2:12685445-12685467 GCCTCTCCCCCAGCTCCTGGGGG - Intergenic
927961463 2:27242853-27242875 GGCTCTCCTCACCCTCCAGGAGG + Exonic
928110577 2:28505691-28505713 GGCTTTCCTTCCCTTCCTGCAGG + Intronic
928311840 2:30217718-30217740 GCCCCTCCTCCACCTCCTGCTGG - Intergenic
928650594 2:33400034-33400056 GGCTTTCTTCCCTTTCCTGGTGG + Intergenic
929761479 2:44811026-44811048 GCCTTCCCTCCCTCTCCAGATGG + Intergenic
932740251 2:74285699-74285721 GGCTTGCCTGACCCTCCTGGTGG - Intronic
933179194 2:79210906-79210928 GCCCTCCCTCTCCCGCCTGGGGG + Intronic
933643916 2:84793800-84793822 GCCTGTCTTCCCTCTCCTGTTGG - Intronic
934301294 2:91777937-91777959 GTCTTTGCTCTCTCTCCTGGTGG - Intergenic
935579386 2:104743693-104743715 GCCTTTTCTCTCCCTCCTCTGGG - Intergenic
936012023 2:108930963-108930985 GCCCTGGCTCCCCGTCCTGGTGG - Exonic
936438422 2:112528880-112528902 GCCTTTCTTTCCCCTGCTGTGGG - Exonic
938126977 2:128681502-128681524 GCCTTTCCTCCACCTGTAGGTGG - Intergenic
938248738 2:129797831-129797853 GACTTTCCTCCCACACCTTGTGG - Intergenic
940426404 2:153536121-153536143 TCCTTTTCTCCTCCTCCTGCTGG + Intergenic
940901557 2:159130892-159130914 GTCTTTCCTCACCTGCCTGGTGG + Intronic
942249274 2:174033850-174033872 GCCTGTCCTCTCCATCCTGGTGG - Intergenic
942382416 2:175405652-175405674 GCTTGTCCTCTCACTCCTGGAGG - Intergenic
944743486 2:202634675-202634697 GCCTTTCCTTTCCCGCCGGGGGG - Intergenic
945347689 2:208738486-208738508 TCCTTTTCTCCCCCTCCTGATGG + Intronic
945892773 2:215447767-215447789 GCCTCTCCTCCAGCTTCTGGTGG - Intergenic
947403926 2:229755349-229755371 GCTCTTCCTCCCTTTCCTGGAGG + Intergenic
947499886 2:230664265-230664287 GGCTCTCCTCCCAGTCCTGGGGG - Intergenic
947884352 2:233553929-233553951 GCCTTACCTCCTCCCCCAGGTGG - Intronic
948253863 2:236551953-236551975 GCTTGTCCTTCCCCTCCTCGTGG + Intergenic
948699893 2:239752936-239752958 GGATTTCCTCACCCTCCTGATGG + Intergenic
948777950 2:240299539-240299561 GCCCATCCTCTCCCTCCAGGGGG + Intergenic
1169046549 20:2538061-2538083 CCCTTTCCACTCCCTCCTGTGGG + Intronic
1169891926 20:10462804-10462826 TCCTTTCTTCCCCATCATGGAGG + Intronic
1170597578 20:17817317-17817339 CCCTTTCCCCAACCTCCTGGTGG + Intergenic
1170987638 20:21273200-21273222 GCCTTTCCTGCCCCTGTTGGTGG + Intergenic
1171414498 20:24968450-24968472 CCCTTTCCTCCCCTCCCTGCAGG - Intronic
1172299511 20:33839174-33839196 GCCTTTCCTCCACATTCTGGAGG - Intronic
1172620114 20:36313160-36313182 GCCTTTCCTTCCCCCACTGCAGG + Intronic
1172761689 20:37327881-37327903 GCCTCTCCTCCCCCCGCTGCGGG + Intergenic
1172906847 20:38376859-38376881 GACTTTGCTTCCCCTCCAGGAGG + Exonic
1172980403 20:38937352-38937374 GCCACTGCTCCCACTCCTGGAGG - Intronic
1173561742 20:44010973-44010995 GCTTCTCCTCCGGCTCCTGGGGG + Intronic
1175172798 20:57091959-57091981 CCCCTTCCCCCCTCTCCTGGGGG - Intergenic
1175676999 20:60954804-60954826 CCCTTTCCTCCCCTTCCTACAGG - Intergenic
1175887484 20:62300692-62300714 CCATTTCCTCCACTTCCTGGAGG - Intergenic
1175934382 20:62508296-62508318 CCCGTTCTTCCCCCTCCTGCAGG - Intergenic
1179206156 21:39281358-39281380 GTCTTTCCTCCCCATTCTAGGGG - Intronic
1179210301 21:39319161-39319183 GCCCTTCCTCCACCTACTAGTGG + Intronic
1179488723 21:41727067-41727089 TCCTCTCCTGCCTCTCCTGGAGG - Intergenic
1179508856 21:41859060-41859082 GCCGTTCCACCCTCACCTGGGGG - Exonic
1180815146 22:18784783-18784805 GTCTTTGCTCTCTCTCCTGGTGG + Intergenic
1180922288 22:19527116-19527138 ACCTTTCCTGCCACTCATGGAGG + Exonic
1181004753 22:20007720-20007742 GCCCTTCTGCCACCTCCTGGGGG + Intronic
1181201336 22:21219120-21219142 GTCTTTGCTCTCTCTCCTGGTGG + Intronic
1181700413 22:24617843-24617865 GTCTTTGCTCTCTCTCCTGGTGG - Intronic
1182353215 22:29710478-29710500 GCCTGTCCTTCCCCACCTGCTGG + Intergenic
1183295950 22:37029677-37029699 GCCTTTCCTCCCGCCCCTACTGG - Exonic
1184101250 22:42342782-42342804 CCATTTCCTCCCCCTCCTTCAGG + Intronic
1184114035 22:42411733-42411755 CCCTTTGCTTCCCCTCCAGGAGG - Exonic
1184235445 22:43180702-43180724 GCCTGTCCTCCCCCTCCCCGGGG + Intronic
1184282654 22:43447063-43447085 GCCTTCCTCCCCCCTGCTGGTGG + Intronic
1184557624 22:45241482-45241504 GCCTTGCCTCCCCAACATGGGGG + Intergenic
1184763754 22:46561054-46561076 CCCCTTCCTCACCCTCCTGGGGG - Intergenic
1184766818 22:46576661-46576683 GCCTTTCCTCGACCGCCTCGCGG - Intronic
1185060881 22:48606145-48606167 CGCTCTCCTCCACCTCCTGGAGG + Intronic
1185190899 22:49435336-49435358 GCCTTTCCTCCTCGTTCTGGGGG + Intronic
1185285092 22:49996531-49996553 GCCTTGCCTCCTCCTCCCTGGGG - Exonic
1185413243 22:50696963-50696985 ACCTCTCCTTCCCCTCCTGTGGG - Intergenic
1203225578 22_KI270731v1_random:76310-76332 GTCTTTGCTCTCTCTCCTGGTGG - Intergenic
1203265252 22_KI270734v1_random:10474-10496 GTCTTTGCTCTCTCTCCTGGTGG + Intergenic
949106037 3:200772-200794 GCCTTTCCTCTCACCCCTTGGGG + Intronic
949567528 3:5258726-5258748 GCCTTCATTCACCCTCCTGGTGG + Intergenic
950027917 3:9833351-9833373 GCCTTTCTTCCCCTTTCCGGGGG - Intronic
950033872 3:9870181-9870203 GCCATTTCTGCCCCTTCTGGAGG + Exonic
950591779 3:13941150-13941172 TCCTTTCCTCCACTTCCGGGTGG - Intronic
950722912 3:14897637-14897659 GCCTTTCCTCCAGCTCCTCCAGG - Exonic
950793607 3:15493235-15493257 GCCATTCCTCCCGCTCCCTGGGG - Intronic
951611057 3:24494063-24494085 GGCTTCTCTCCGCCTCCTGGGGG - Intronic
952606647 3:35155049-35155071 ACATTTCCTCCCCAACCTGGAGG - Intergenic
953255463 3:41286536-41286558 GCCTTGCCTCCTCTTCCTGAAGG - Intronic
953533180 3:43756342-43756364 GCCTTTCCTCCTCCTTCTATGGG - Intergenic
954169450 3:48788924-48788946 GCCTGTCCTCCCTCTCTTGGTGG - Intronic
954481316 3:50803882-50803904 GGCTGTCCCCCACCTCCTGGAGG + Intronic
957072323 3:75576910-75576932 GACTTTTCTCTCCCTCCAGGAGG + Intergenic
960742906 3:120854625-120854647 GTTTTTCCTCCCCCTCTTTGTGG - Intergenic
960977936 3:123194666-123194688 GCCTCTCCAGCCCCTCCTGCTGG + Intronic
961167859 3:124776043-124776065 GCTTTCCTTCCCTCTCCTGGAGG - Intronic
961281746 3:125769861-125769883 GACTTTTCTCTCCCTCCAGGAGG - Intergenic
961872599 3:129999723-129999745 GACTTTTCTCTCCCTCCAGGAGG + Intergenic
961939359 3:130621824-130621846 GCCTCTCCTCCGGGTCCTGGAGG - Exonic
963558838 3:146834129-146834151 GCCTCTCTTCCAGCTCCTGGTGG + Intergenic
963970343 3:151422403-151422425 GCCTCTCCTCCAGCTTCTGGTGG + Intronic
964499114 3:157328727-157328749 GCCTTTCCTGAGCTTCCTGGTGG - Intronic
964794327 3:160481053-160481075 GGCTTTCCTCTGACTCCTGGTGG + Intronic
965799459 3:172476490-172476512 CCCAATCCTCTCCCTCCTGGAGG - Intergenic
966503994 3:180678989-180679011 GCCTTTCCTCTCTCGCCAGGAGG + Intronic
967611302 3:191509169-191509191 GCCTTTTCTCCCCTTCCGGGAGG + Intergenic
967812966 3:193775810-193775832 GCCCCTCCTCCCTCTCCTGCGGG - Intergenic
967924063 3:194632982-194633004 CCCTTTCCGCCCCCTCCTCTAGG + Intronic
968088161 3:195883521-195883543 GCCACACCTCCCCTTCCTGGGGG + Intronic
968913577 4:3487536-3487558 CCCTTCCCTCCTGCTCCTGGTGG - Intronic
969015917 4:4104225-4104247 GACTTTTCTCTCCCTCCAGGAGG + Intergenic
969197488 4:5574581-5574603 GCTTTTCATCACCATCCTGGAGG + Intronic
969504316 4:7574735-7574757 GCCCTTCCTCCTGCTCATGGGGG - Intronic
969508315 4:7602298-7602320 GGCTGTCCCCCACCTCCTGGAGG + Intronic
969556718 4:7916594-7916616 GACTCCCCTCCCCCTCCTGCAGG + Intronic
969572152 4:8015437-8015459 GCCGTTCCTCCCCATCCCGCCGG + Intronic
969738036 4:9004127-9004149 GACTTTTCTCTCCCTCCAGGAGG - Intergenic
969797226 4:9535674-9535696 GACTTTTCTCTCCCTCCAGGAGG - Intergenic
970401542 4:15722016-15722038 TGCTTCCCTTCCCCTCCTGGTGG + Intronic
970609732 4:17714009-17714031 GCCTTGCCTCCTCATCCTTGGGG + Intronic
971195614 4:24470449-24470471 GGCTATCCTGCCCCGCCTGGCGG - Intergenic
974400716 4:61402709-61402731 GCCTTTCTTCACTCTGCTGGAGG - Intronic
976149448 4:82077931-82077953 GGCTGTCCCCCACCTCCTGGAGG - Intergenic
977831348 4:101597383-101597405 GGTTTTCCTCCTCCCCCTGGTGG + Intronic
978885311 4:113761283-113761305 GCCGATCCTCCTCCTCCTGCGGG + Intronic
982320562 4:154072764-154072786 TCCATTCCTCCACTTCCTGGAGG - Intergenic
982341405 4:154303020-154303042 GCCATTGCACTCCCTCCTGGGGG - Intronic
983811213 4:172064795-172064817 GCCTTTTCTTCACCTCCAGGTGG + Intronic
984302337 4:177937835-177937857 GCCATTCCTCCCTCTCATGCTGG + Intronic
985779030 5:1860228-1860250 GCCCTACCTGCCACTCCTGGAGG + Intergenic
985838959 5:2291388-2291410 GCCTGGCATCACCCTCCTGGGGG - Intergenic
986650497 5:9958950-9958972 GCCTTTCTTCCCTTTTCTGGTGG + Intergenic
988692028 5:33581951-33581973 GCCTTTCCCCCAGCTTCTGGTGG - Intronic
988885441 5:35552533-35552555 GCCTTTAACCCCCCTCCTGCAGG + Intergenic
989047291 5:37285251-37285273 GCCATTCCACCCCAGCCTGGGGG + Intergenic
991509994 5:67365775-67365797 GCCTTTTCGCACTCTCCTGGGGG - Intergenic
992139376 5:73780491-73780513 GACTTTGCTCGCCCTCCTGCTGG + Intronic
992392882 5:76345507-76345529 GCCTTCCCTAACCCTCCTGTTGG - Intronic
995236195 5:109832813-109832835 GGCTGTCCCCCACCTCCTGGAGG + Intronic
998003114 5:138640041-138640063 GCTTTTCCACCCCTTCCTGGAGG - Intronic
998130356 5:139648620-139648642 GCCCCTCCTCCCCCTCCCCGCGG - Exonic
999391849 5:151199069-151199091 CCCTTTCCTTCTCCACCTGGGGG + Exonic
1001678218 5:173536139-173536161 GGCTTCCTTCCCCATCCTGGTGG + Intergenic
1002382578 5:178840913-178840935 GCCTTTCCTTCTCCTCCTCCAGG - Intergenic
1002425460 5:179172100-179172122 GCCTTGCTTCCGCCTCCTGCTGG - Intronic
1002508546 5:179697960-179697982 GCCTTTCTTCCCCTTCCCGGTGG + Intronic
1003854271 6:10256309-10256331 TCCTTTTCTCCTCCCCCTGGTGG - Intergenic
1003925257 6:10871556-10871578 GCCCTTCCTCCCCATCCTGCCGG + Intronic
1005301646 6:24476834-24476856 GTCTTTCCTACCCCTCTTGTGGG - Intronic
1005647571 6:27856077-27856099 CCCTTTGCTCACCCTCCTGGAGG + Intronic
1006029814 6:31170571-31170593 GCCTTCTCGCCCCCTCCAGGTGG - Exonic
1006338164 6:33431725-33431747 GGCTTTCCTCTTCCCCCTGGTGG - Intronic
1006436376 6:34027893-34027915 TTCTGTCCTGCCCCTCCTGGTGG - Intronic
1007371304 6:41428257-41428279 GCGTTAGCTCCCCCGCCTGGCGG - Intergenic
1007747133 6:44050170-44050192 GCCTTTCCTCCTCACCCTGTAGG + Intergenic
1008109746 6:47478595-47478617 TGCTTCCCTCCCCCTCCTCGTGG + Intronic
1008155462 6:48008736-48008758 GCCCTTCCTGGGCCTCCTGGGGG - Exonic
1009413553 6:63393286-63393308 GCCTCTCCTCCCCAACCTGTAGG + Intergenic
1011228734 6:85136373-85136395 GCCTGTCCCCTCCCTCCTGCTGG - Intergenic
1011550642 6:88528434-88528456 GCCTCTTCTCTCCTTCCTGGAGG + Intergenic
1013231612 6:108165978-108166000 GCTTTTCCCCCAACTCCTGGCGG - Intergenic
1013321089 6:108990383-108990405 GCTTGTCCTCCCTTTCCTGGAGG + Intronic
1014068819 6:117157841-117157863 GCCTTGCATCCTTCTCCTGGTGG - Intergenic
1014308561 6:119770916-119770938 GTCTTACCTCCCCTTTCTGGAGG + Intergenic
1014847519 6:126296700-126296722 GCCATTTCTCCCCCTCCAAGTGG - Intergenic
1015782973 6:136890423-136890445 GTCATTCCTCCTCCTCCTGCAGG + Intronic
1016727818 6:147395837-147395859 GTCTTTCCTCCTCTTCATGGTGG - Intergenic
1016841983 6:148533904-148533926 TCCTTTCCGACGCCTCCTGGTGG - Exonic
1019168763 6:170116962-170116984 GCCTTTCCTCAGAGTCCTGGCGG - Intergenic
1019373372 7:675394-675416 TCTTTTTCTCCCCCTCCCGGAGG - Intronic
1019374433 7:681847-681869 GCCTTTCCTCCTGCACCTGGAGG + Intronic
1019568731 7:1697904-1697926 TCCTTTCTTCCCACACCTGGAGG - Intronic
1019971276 7:4542903-4542925 GCCTTCTCTCCCTCGCCTGGTGG + Intergenic
1020072777 7:5238529-5238551 GCCTTTCCTCTCCCTCGGGGAGG + Intergenic
1021030307 7:15724579-15724601 CACTTGCCTCACCCTCCTGGGGG - Intergenic
1021694848 7:23266800-23266822 GCCTTCCTTCCACATCCTGGTGG + Intronic
1021973389 7:25986702-25986724 GCCTTTCCACAACTTCCTGGAGG - Intergenic
1022137823 7:27466079-27466101 TCCTTTCCACCACATCCTGGCGG + Intergenic
1022634447 7:32118955-32118977 GCCTCTACCCCCCATCCTGGAGG - Intronic
1023000507 7:35802188-35802210 TCCTTTCCTCCCCCACATGTTGG + Intronic
1024185544 7:46944953-46944975 GTATTTCCTCCCATTCCTGGAGG + Intergenic
1024213507 7:47227436-47227458 GCATTTCCTCTCCCTTCTGCAGG - Intergenic
1024394975 7:48855768-48855790 GCCTTTCCACCCTCTTCTGCTGG - Intergenic
1024400293 7:48916907-48916929 GCCTTTCCACCCTCTTCTGATGG + Intergenic
1028952677 7:96654560-96654582 GCATTTGCTCACCCTCCTGATGG - Intronic
1030764581 7:113393379-113393401 GCTTATCCTCCTCCTCCAGGTGG + Intergenic
1031101909 7:117491547-117491569 GCCTTTCCCCTACCTTCTGGTGG + Intronic
1031374194 7:121004309-121004331 ACCTATCCTCCTCCTCCAGGGGG + Intronic
1031436573 7:121739337-121739359 CCCTTTCCTCCTCCTCCTCTAGG - Intergenic
1033685693 7:143639639-143639661 GCCTTTTCTCTCCCGCCTTGTGG + Intronic
1033690050 7:143727676-143727698 GCCTTTTCTCTCCCGCCTTGTGG - Intronic
1033698921 7:143817982-143818004 GCCTTTTCTCTCCCGCCTTGTGG - Intergenic
1034065116 7:148128940-148128962 GCCTTTCCTCCCCATCGTGGAGG + Intronic
1034345301 7:150382021-150382043 GCATCCCCTCCCCCACCTGGAGG - Intronic
1034433769 7:151053532-151053554 CCCTTTCCTCTCCACCCTGGTGG + Intergenic
1034522804 7:151632997-151633019 GCCTGTCCTGCCCTTCCAGGAGG - Intronic
1036243120 8:7095401-7095423 GACTTTTCTCTCCCTCCAGGAGG - Intergenic
1036257679 8:7218643-7218665 GACTTTTCTCTCCCTCCAGGAGG + Intergenic
1036258930 8:7225642-7225664 GACTTTTCTCTCCCTCCAGGAGG + Intergenic
1036307691 8:7613868-7613890 GACTTTTCTCTCCCTCCAGGAGG - Intergenic
1036310983 8:7684238-7684260 GACTTTTCTCTCCCTCCAGGAGG + Intergenic
1036892414 8:12605083-12605105 GACTTTTCTCTCCCTCCAGGAGG + Intergenic
1036898707 8:12656030-12656052 GACTTTGCTCTCCCTCCAGGAGG + Intergenic
1036899958 8:12663059-12663081 GACTTTTCTCTCCCTCCAGGAGG + Intergenic
1037742148 8:21616403-21616425 GCCTTTTCTTCCCCTCCCTGTGG - Intergenic
1037768766 8:21787237-21787259 GCCTCTCCTCCCTGTCTTGGAGG + Intronic
1037894811 8:22644888-22644910 ACGCTTCCTCGCCCTCCTGGGGG - Intronic
1037992910 8:23333304-23333326 ACCCTTCCTCACTCTCCTGGGGG + Intronic
1038615312 8:29088514-29088536 ATCTCTACTCCCCCTCCTGGGGG - Intronic
1038709335 8:29927165-29927187 TCCTTTCCTCCTCTTGCTGGGGG - Intergenic
1038828609 8:31033324-31033346 CCCCTTCCCTCCCCTCCTGGCGG - Exonic
1039021498 8:33212034-33212056 GCCTTCCTTCTCCCTCCTGTGGG + Intergenic
1039915849 8:41859777-41859799 GCCTGTCTTCCCCCTTCTGAGGG + Intronic
1040907205 8:52480905-52480927 GCTTCTCCTTCCTCTCCTGGGGG - Intergenic
1041317088 8:56575308-56575330 AGCCTTCCTCCCCTTCCTGGAGG + Intergenic
1041381764 8:57259578-57259600 GCCGTTCAGCCCCTTCCTGGCGG + Intergenic
1041599124 8:59694795-59694817 GCCATTCCTCTCCCTCCTGTCGG - Intergenic
1043483576 8:80676870-80676892 GCCTGTGCTCCGCCTCCTGCAGG - Intronic
1044526739 8:93260979-93261001 GCCTATGCTCCACTTCCTGGAGG + Intergenic
1044710086 8:95048868-95048890 GCCTCTCGTCCCCCTCCCAGGGG + Intronic
1044727497 8:95205238-95205260 CCTTTTCCTCTCCCTCCTGCAGG + Intergenic
1046720575 8:117614159-117614181 GCCTTTACTCACACTCCTTGAGG - Intergenic
1047697207 8:127415894-127415916 GCCTTCTCGCCCCCTCCAGGCGG + Exonic
1048219362 8:132527207-132527229 TGGTTTCCTCCCCATCCTGGCGG + Intergenic
1048268352 8:133007242-133007264 GCCTCTCCTCCCCCTTCTCCCGG - Intronic
1049230491 8:141479045-141479067 CCCTTGCCTTCCCCTCCTTGTGG + Intergenic
1049317061 8:141975056-141975078 GCCTCTCCTTCCTCTCCAGGGGG + Intergenic
1049569033 8:143359826-143359848 GCCTGACCCCTCCCTCCTGGTGG + Intronic
1050408891 9:5340413-5340435 GACTTTCCTTCCACTCCTGTGGG + Intergenic
1050509301 9:6377002-6377024 GCCAGTCCACCCCCTTCTGGGGG - Intergenic
1051374910 9:16392964-16392986 TCCTTCCCTCCCGCTCCTGTGGG - Intergenic
1052736975 9:32352582-32352604 GACTTTCCCCCTCCTCCTGCAGG - Intergenic
1055079678 9:72257097-72257119 GCATTTCCTTCCCCACCTGCTGG - Intronic
1056396300 9:86184389-86184411 TCCTTTCCTCGCTCTCCTGGTGG - Intergenic
1056452926 9:86734150-86734172 GCTTCTCCTCCTCCTCCTGTTGG - Intergenic
1056665047 9:88574893-88574915 GCCTGTCCCCACCATCCTGGGGG + Intronic
1057582442 9:96299434-96299456 GCCTTACCTTCCCCTCCCTGTGG + Intronic
1057905154 9:98977396-98977418 GCTTCTCCTCCCCTCCCTGGTGG + Intronic
1059268798 9:113060093-113060115 CCCTTTGCGCCCGCTCCTGGGGG - Intergenic
1059269934 9:113065542-113065564 CCCTTTGCGCCCGCTCCTGGGGG - Intergenic
1059271068 9:113070990-113071012 CCCTTTGCGCCCGCTCCTGGGGG - Intergenic
1059272201 9:113076436-113076458 CCCTTTGCGCCCGCTCCTGGGGG - Intergenic
1059273336 9:113081878-113081900 CCCTTTGCGCCCGCTCCTGGGGG - Intergenic
1059274472 9:113087324-113087346 CCCTTTGCGCCCGCTCCTGGGGG - Intergenic
1059438647 9:114290551-114290573 TCCTTTCCTCCCCTGCCTGGTGG + Intronic
1060918971 9:127407093-127407115 GCCTTTCCTCTCTCTGCAGGAGG + Exonic
1060932310 9:127496900-127496922 TTCTCTCCTCCCCCACCTGGTGG + Intronic
1061215372 9:129218643-129218665 TCTTTTCCTTCCCTTCCTGGGGG - Intergenic
1061664752 9:132154020-132154042 GGGACTCCTCCCCCTCCTGGAGG - Intergenic
1062252843 9:135606872-135606894 GCCATCTCTCCCCATCCTGGAGG + Intergenic
1062360061 9:136183392-136183414 GCCTCTCTCCCCGCTCCTGGTGG + Intergenic
1062435426 9:136544797-136544819 GACCTTCATCCCCCTCCTGTGGG - Intronic
1062471959 9:136710021-136710043 GCCTGTCCTCCTCCTGCAGGAGG - Intergenic
1062512808 9:136916789-136916811 CCCTGTCCACTCCCTCCTGGTGG + Intronic
1186745630 X:12565250-12565272 GCCTAAGCTCCACCTCCTGGAGG - Intronic
1187126311 X:16457590-16457612 TCCTTTCCTCCTCCTCCTCTTGG - Intergenic
1187175049 X:16888693-16888715 GCCTTGCCTCCCCTGCCTCGGGG - Intergenic
1187478631 X:19634632-19634654 TCCTCTCCTCCTCCTCCTTGTGG - Intronic
1187488148 X:19724119-19724141 ACCTTTCCTCCCCCTCTCAGAGG + Intronic
1190102099 X:47529653-47529675 GCCTCTCCTCCAGCTGCTGGTGG + Intergenic
1192057783 X:67789871-67789893 GCCAATCCTTCCCCTCCTGCAGG + Intergenic
1192252160 X:69422209-69422231 GGCTGTCCCCCACCTCCTGGAGG - Intergenic
1192362652 X:70449337-70449359 GCCTTTCCACCCACTTCTGCAGG + Exonic
1193173574 X:78365097-78365119 GCCTTCTCTCCACCTCCTGATGG + Intergenic
1193668260 X:84351201-84351223 GCCCTTCCTCCTCCTCATTGGGG - Intronic
1193747630 X:85301055-85301077 CACTTTCCTCCCTCTCCTTGTGG - Intronic
1194041807 X:88950741-88950763 GGCTTCCTTCCCCCTCCTAGAGG - Intergenic
1194553088 X:95325140-95325162 GGCTTTCTTCCCTTTCCTGGTGG + Intergenic
1196942833 X:120794486-120794508 CACTTCCCTCCCTCTCCTGGAGG - Intergenic
1199230651 X:145433954-145433976 ACCTCTCCTCCCCTTCCTGGAGG + Intergenic
1199500787 X:148503438-148503460 TCCTTTCTTGGCCCTCCTGGGGG - Intronic
1200086854 X:153611338-153611360 GCCTCCCCTCCCCATCCTTGGGG + Intergenic