ID: 906824434

View in Genome Browser
Species Human (GRCh38)
Location 1:48963583-48963605
Sequence TTCCTGGGGAACTCCCATAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 3, 3: 5, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906824427_906824434 -4 Left 906824427 1:48963564-48963586 CCCAGTATTCTGTATGATGTTCC 0: 1
1: 1
2: 1
3: 13
4: 167
Right 906824434 1:48963583-48963605 TTCCTGGGGAACTCCCATAGGGG 0: 1
1: 0
2: 3
3: 5
4: 95
906824426_906824434 5 Left 906824426 1:48963555-48963577 CCAGGCAGGCCCAGTATTCTGTA 0: 1
1: 0
2: 1
3: 6
4: 100
Right 906824434 1:48963583-48963605 TTCCTGGGGAACTCCCATAGGGG 0: 1
1: 0
2: 3
3: 5
4: 95
906824428_906824434 -5 Left 906824428 1:48963565-48963587 CCAGTATTCTGTATGATGTTCCT 0: 1
1: 0
2: 2
3: 7
4: 198
Right 906824434 1:48963583-48963605 TTCCTGGGGAACTCCCATAGGGG 0: 1
1: 0
2: 3
3: 5
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906824434 Original CRISPR TTCCTGGGGAACTCCCATAG GGG Intronic
904995126 1:34625754-34625776 TTCCTGCGGAAACCCAATAGAGG + Intergenic
905653068 1:39669263-39669285 TTCCTGAGGAGCTCCCATTTAGG + Intronic
906824434 1:48963583-48963605 TTCCTGGGGAACTCCCATAGGGG + Intronic
908997912 1:70180289-70180311 ATCATGGTGACCTCCCATAGTGG - Intronic
910309902 1:85811499-85811521 TTTCTGAGGAACTACCATACTGG + Intronic
912455400 1:109793345-109793367 TTCCTGCGCAACTATCATAGGGG + Intergenic
914853449 1:151332386-151332408 CTCCTTGGGATCTCACATAGAGG - Intergenic
915904473 1:159867765-159867787 TTCCTGGGCAACTGCCAGCGGGG - Intronic
916253855 1:162766349-162766371 TTCCTGGGTCAGACCCATAGTGG + Intronic
920990864 1:210938020-210938042 TTCCAGGGACATTCCCATAGAGG - Intronic
1063300923 10:4848263-4848285 TACCTGGGGAACCCCCATAGCGG + Intergenic
1064945966 10:20790291-20790313 TTTTTAGGGAACTCCTATAGGGG + Intronic
1068903102 10:62292102-62292124 TTCCTGGAGAACTCACTGAGAGG - Intergenic
1071461397 10:85900163-85900185 TTCCTGGGGAGCTCCACCAGGGG + Intronic
1076235407 10:128860549-128860571 TGCCTGGGGAACACTCATATCGG - Intergenic
1078407856 11:11086905-11086927 TTCTGGGGTAACTCCCATGGTGG + Intergenic
1083197286 11:61096109-61096131 TTTCGGGGGAATTCCCATAATGG - Intergenic
1083323767 11:61863158-61863180 TGCCTGGGGACCTCCCATCCTGG + Intronic
1088383679 11:109224831-109224853 TTCCTAGAGACCTCCCAGAGTGG - Intergenic
1092992754 12:13919045-13919067 TTTCTGGGAAATTCCCACAGTGG + Intronic
1102883340 12:116503035-116503057 CTCCTGGGAAACTCCTAAAGGGG + Intergenic
1104645633 12:130495363-130495385 TCCCTGGGGAAATCTCACAGGGG - Intronic
1108881648 13:55127237-55127259 TTCGTGGGGAACACCTAAAGTGG - Intergenic
1114749019 14:25182854-25182876 TTTCTGGGGAAACCCCATAGGGG + Intergenic
1119216912 14:72876262-72876284 TTCCAGGGGACCACCCAGAGGGG - Intronic
1120376496 14:83714413-83714435 TTCCAGGGGAACAGCCATAATGG + Intergenic
1120738636 14:88083202-88083224 TTCCTGGGAAACTTCCCAAGGGG + Intergenic
1202848472 14_GL000225v1_random:1185-1207 CTCCTGGGGCTCTCCCACAGGGG + Intergenic
1202862191 14_GL000225v1_random:89904-89926 TGCCTGGGGCTCTCCCACAGGGG - Intergenic
1127847996 15:62888227-62888249 TTCCTTGGGAAATCCCTTACTGG - Intergenic
1130916236 15:88307314-88307336 TTCCTGGGCAAATCCCATTCAGG + Intergenic
1134211261 16:12279516-12279538 TTCCTTGGGAGCTCCCTCAGTGG + Intronic
1134414101 16:14028990-14029012 ATCCTGGGGAAATCTCAAAGAGG + Intergenic
1137245569 16:46700835-46700857 TTTTTGAGGAACTGCCATAGAGG + Intergenic
1139534103 16:67561244-67561266 ATCCTGGGGCACTCCAATATTGG - Intergenic
1142110459 16:88328400-88328422 TTCCTGGGGAACCTCCCTGGAGG - Intergenic
1142598178 17:1039712-1039734 TGCCTGGGGAACTGGCACAGGGG + Intronic
1143046646 17:4086294-4086316 TTTCTGGGGGATTCCCACAGCGG + Intronic
1143046655 17:4086324-4086346 TTTCTGGGGGATTCCCACAGCGG + Intronic
1143046664 17:4086354-4086376 TTTCTGGGGGATTCCCACAGCGG + Intronic
1143976876 17:10836832-10836854 TTCCTGTGGAAGACCCAGAGTGG + Intronic
1145367214 17:22274214-22274236 GTCTTGGGGAGTTCCCATAGGGG + Intergenic
1157445174 18:47738966-47738988 TTCCTGGGGCACCCACACAGAGG - Intergenic
1159559793 18:69981443-69981465 TTCCTGGGGAAAGCACATACAGG + Intergenic
1160402580 18:78621585-78621607 TTCATAGGGGACTTCCATAGAGG - Intergenic
1164562532 19:29302484-29302506 TTCCTAGTGACTTCCCATAGTGG + Intergenic
1166920899 19:46228560-46228582 TTCCTGGGGAGCACGGATAGGGG - Intergenic
1168374640 19:55866446-55866468 TTTCTGGACAACTCCCATAATGG + Intronic
926152814 2:10434341-10434363 TTCCTGGGGACCTCCGAAGGTGG + Intergenic
927051272 2:19331664-19331686 TTCCTGGCCAACTCCCTTATTGG - Intergenic
927065900 2:19470749-19470771 ATCCTGAGGAACTTCCACAGAGG + Intergenic
928464895 2:31514446-31514468 TTCTTGAGGAACTCCCATAGAGG - Intergenic
934947367 2:98551563-98551585 TTCCCAGGGAAGTCCCAAAGTGG - Intronic
935915062 2:107940351-107940373 TTGCTTGGGAACTCACATGGAGG + Intergenic
937553730 2:123128910-123128932 CTCCTGGGGAACAACCTTAGTGG + Intergenic
939707992 2:145478934-145478956 TTCCTGGGCAACTCCTAGTGCGG - Intergenic
942917859 2:181333995-181334017 TCCCTGGGGAACTACCACATAGG + Intergenic
1169130898 20:3165984-3166006 GACCTGGGGACCTCCGATAGTGG - Exonic
1171784426 20:29449196-29449218 TGCCTGGGGCTCTCCCACAGGGG - Intergenic
1174687093 20:52466451-52466473 TTCCTGGGGCACTAGCAAAGAGG - Intergenic
1182772923 22:32808829-32808851 TGCATGGGAAACTCCCAGAGGGG + Intronic
1183085917 22:35486985-35487007 TGCCTGGGGAAGCCCCATAGGGG - Intergenic
960822380 3:121748960-121748982 TTCCTCGAGAACTCTCTTAGAGG + Intronic
961670398 3:128524284-128524306 CTTGTGGGGAACTCCCACAGAGG + Intergenic
964373080 3:156021850-156021872 TGCCTGATGAACTACCATAGTGG + Intergenic
964928128 3:161982170-161982192 TACCTGGGGAAGTCCCAGGGAGG + Intergenic
965678509 3:171225436-171225458 CTCTTGGGGAACTCCTATTGAGG - Intronic
972256266 4:37358976-37358998 TTCCCAGGACACTCCCATAGTGG - Intronic
984938609 4:184911842-184911864 TTCCTGGGGAGCCACCAGAGAGG - Intergenic
986340914 5:6788557-6788579 TTCCTTGGGAGCTCACCTAGTGG - Intergenic
995556765 5:113337518-113337540 TTCCTTGGGAACAGCCTTAGGGG + Intronic
998254515 5:140574440-140574462 TTCCAAGGGACCTCCCACAGCGG + Intronic
998420733 5:141983531-141983553 ATGTTGTGGAACTCCCATAGAGG + Exonic
1001806562 5:174591667-174591689 TTACTTGGGAACACCCATAAGGG + Intergenic
1002133172 5:177093526-177093548 TCCCGGGGGAACTCCCATAGTGG - Exonic
1006056376 6:31387814-31387836 ATCTTGGGGAACTCACACAGGGG - Intergenic
1006069099 6:31484766-31484788 ATCTTGGGGAACTCACACAGGGG - Intergenic
1007278728 6:40694601-40694623 TTCCTGTGGAGATCCCATAGTGG - Intergenic
1009885277 6:69617476-69617498 TTGCTGGGGAACTTCAACAGAGG - Intergenic
1011217260 6:85018242-85018264 TTCCTAGGGAAAGTCCATAGGGG - Intergenic
1012379069 6:98598756-98598778 TTCTTGGGCAAATGCCATAGAGG + Intergenic
1017549355 6:155488627-155488649 CTCCTGGGGAAGTCCCAAATCGG - Intergenic
1019166921 6:170103218-170103240 TTCCTGAGGAAGACCCATATGGG + Intergenic
1020035457 7:4960501-4960523 TTCCCGGGCAGGTCCCATAGGGG - Intergenic
1020480711 7:8656913-8656935 TTCATGGGAAACTCGCAGAGTGG - Intronic
1023183977 7:37514470-37514492 ATCCTCTGGAGCTCCCATAGAGG - Intergenic
1026925298 7:74188071-74188093 CTCCTGGGGAACTCCTTTACTGG - Intronic
1029724370 7:102392564-102392586 TCCTTGGAGAACTCCCATACAGG - Intronic
1035022434 7:155807500-155807522 TTCCTGGGAAACTCCCCAGGCGG - Intronic
1035178442 7:157071390-157071412 CTCCTGTGGAACTCCCATAATGG + Intergenic
1043482702 8:80669051-80669073 TTCCTGGGGTGCTCTCACAGTGG - Intronic
1047585570 8:126268640-126268662 TTCCTGTGGAACCCCCATGGTGG + Intergenic
1053025971 9:34728555-34728577 TTCATGGGAAACACCCACAGTGG + Intronic
1053748994 9:41234969-41234991 CTCCTGGGGCTCTCCCACAGGGG + Intergenic
1054337384 9:63818386-63818408 CTCCTGGGGCTCTCCCACAGGGG - Intergenic
1056028522 9:82526168-82526190 TTTCTGGGGAGATCCCATAAAGG + Intergenic
1056658249 9:88526351-88526373 CTCCTAGGAAACCCCCATAGGGG + Intergenic
1060530643 9:124345397-124345419 TTCCTGGGGAAGGCCGAGAGGGG + Intronic
1061817747 9:133206748-133206770 TTCCTGGGGACCTCTCATCTGGG - Intronic
1189312594 X:40030394-40030416 TTCCTCAGGAACTTACATAGAGG - Intergenic
1194604336 X:95961555-95961577 ATCCTAGGGAACTCCCCAAGAGG + Intergenic
1194678197 X:96818377-96818399 TTCCTGGGTAACCCCAAAAGAGG - Intronic
1199896340 X:152130994-152131016 CCCCTGGGGAACCTCCATAGAGG - Intergenic
1200943060 Y:8805368-8805390 TTTCAGGGGAATTCCCATAATGG - Intergenic