ID: 906836096

View in Genome Browser
Species Human (GRCh38)
Location 1:49084737-49084759
Sequence GAGAAGAGTCTGAATGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 217}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906836096_906836099 26 Left 906836096 1:49084737-49084759 CCTGCAGCATTCAGACTCTTCTC 0: 1
1: 0
2: 0
3: 14
4: 217
Right 906836099 1:49084786-49084808 TTAAAAAACATCAGATTAGAGGG 0: 1
1: 0
2: 4
3: 46
4: 552
906836096_906836100 27 Left 906836096 1:49084737-49084759 CCTGCAGCATTCAGACTCTTCTC 0: 1
1: 0
2: 0
3: 14
4: 217
Right 906836100 1:49084787-49084809 TAAAAAACATCAGATTAGAGGGG 0: 1
1: 0
2: 3
3: 37
4: 408
906836096_906836098 25 Left 906836096 1:49084737-49084759 CCTGCAGCATTCAGACTCTTCTC 0: 1
1: 0
2: 0
3: 14
4: 217
Right 906836098 1:49084785-49084807 GTTAAAAAACATCAGATTAGAGG 0: 1
1: 0
2: 2
3: 22
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906836096 Original CRISPR GAGAAGAGTCTGAATGCTGC AGG (reversed) Intronic
900686883 1:3954396-3954418 GAGACGAGGATGAATGCTGATGG - Intergenic
902125329 1:14205091-14205113 GGGAAGAGGCTGAAAGTTGCAGG + Intergenic
903315857 1:22506121-22506143 GAGAAGACGCTGACTGCTGAGGG + Exonic
905435554 1:37952915-37952937 GAGACAAGTCTGAGTGCTGATGG - Intergenic
906119884 1:43382353-43382375 GAGAAGAAGCTGAACTCTGCAGG - Intergenic
906544510 1:46611887-46611909 GGGAGAAGTCTGAATGCTGAAGG - Intronic
906836096 1:49084737-49084759 GAGAAGAGTCTGAATGCTGCAGG - Intronic
907952730 1:59199169-59199191 GAGAAGAGTGTGAATAATTCAGG - Intergenic
912166969 1:107053529-107053551 GAGAAGAGTTGGAGTTCTGCTGG - Intergenic
916710004 1:167396406-167396428 GAGAAGTGGCTAAATGATGCAGG + Exonic
917213199 1:172651307-172651329 GAGAACATTCTGAAAGCTTCTGG + Intergenic
917969041 1:180195632-180195654 TGGAAGAGTCAGGATGCTGCTGG - Intronic
918497284 1:185155429-185155451 GACAAAAGTCAGAATGCTTCAGG - Intronic
920259706 1:204680568-204680590 GAGCAGAGTCTGCTTGATGCGGG + Intronic
922537473 1:226391709-226391731 GAGAAGGGTGAGAAGGCTGCGGG + Intronic
1064569073 10:16673697-16673719 GAGAAGCATCTGTGTGCTGCAGG - Intronic
1066227064 10:33393718-33393740 GAGAGGAGACAGAAAGCTGCAGG + Intergenic
1066307176 10:34156746-34156768 GAGAAGAGCATGGAAGCTGCAGG - Intronic
1066526511 10:36284774-36284796 GAGTAAAGGCTGAATGCTGATGG + Intergenic
1066677993 10:37908586-37908608 TAGAAAAGTCTAAATGATGCTGG - Intergenic
1066763026 10:38775205-38775227 GAGTAGTGTCTGAAGGCCGCAGG + Intergenic
1066958545 10:42197226-42197248 GAGCAGTGTCTGAAGGCCGCAGG - Intergenic
1068599187 10:58937554-58937576 GAGAAGAGCCTGGCTCCTGCAGG + Intergenic
1068802196 10:61154062-61154084 GAGGAGAGTCTGTTTGGTGCGGG + Intergenic
1069755735 10:70773533-70773555 GGGGAGAATCTGAGTGCTGCTGG + Intronic
1071089773 10:81904719-81904741 GAGAACAACCAGAATGCTGCAGG - Intronic
1072713273 10:97732216-97732238 GAGTTGAGGCAGAATGCTGCAGG + Intergenic
1072770837 10:98135722-98135744 AAGAAGAGTCTAAATTCTGGTGG - Intronic
1073289379 10:102405816-102405838 GAGAAGGGTGTGAGGGCTGCAGG - Intronic
1074415091 10:113260771-113260793 GAGCAAAGTCAGAATGCTGTGGG - Intergenic
1074585063 10:114760128-114760150 GAAATTAGTCTGGATGCTGCAGG + Intergenic
1076821223 10:132940737-132940759 GTGAAGAGTCTGTTTTCTGCCGG - Intronic
1079471323 11:20780867-20780889 GAGAAGAGTGTGAATGGGGTGGG + Intronic
1080550931 11:33373770-33373792 GGGAAGCGACTGAATGTTGCTGG - Intergenic
1080695077 11:34596509-34596531 GAGAAGAGCCAGAATACTGTAGG + Intergenic
1084570400 11:69956383-69956405 GAGAAGAGACTGAAGGCTGTGGG + Intergenic
1084734063 11:71093157-71093179 AGGAAGGGTCTGAGTGCTGCAGG - Intronic
1086720194 11:90111260-90111282 GAGTAGTGTCTCAAGGCTGCAGG + Intergenic
1087457970 11:98411224-98411246 GAGAAATATCTGAATGCTGACGG - Intergenic
1087677691 11:101181540-101181562 GAGGAGAGTCTACATGATGCTGG - Intergenic
1088908057 11:114169729-114169751 GAGGAAAGACTGAGTGCTGCAGG + Intronic
1089709628 11:120305764-120305786 GAGAAGTGGCTGAATGATGCAGG + Exonic
1090134202 11:124179053-124179075 GAGGATATTCTGAATTCTGCAGG + Intergenic
1093803608 12:23404702-23404724 GAGAAGAATGTGTATTCTGCTGG - Intergenic
1094147790 12:27248578-27248600 CTGAAGAGTCTGGATCCTGCTGG - Intronic
1095132162 12:38556342-38556364 GAGAATAGTCTGACTCATGCAGG - Intergenic
1097352391 12:58562730-58562752 GAGAAGAGTCCGGCTGCCGCTGG - Intronic
1098466092 12:70787406-70787428 TTGAAGAGTATGAATGCTGTAGG + Intronic
1098899931 12:76102100-76102122 GAGAAGAGAATGAATTCTGGTGG - Intergenic
1100026736 12:90138923-90138945 GAGAAGAATATGTATTCTGCAGG + Intergenic
1103477243 12:121227698-121227720 GAGAAGAGTGTGCATGCAGAAGG + Intronic
1104079158 12:125415145-125415167 GAGAAGAGTCTTTAAGATGCGGG - Intronic
1104165808 12:126228698-126228720 GAGCAAAGTCTGGATGCAGCTGG + Intergenic
1104247662 12:127059062-127059084 GAGAATCCTCTGAATGCTGGAGG - Intergenic
1104280460 12:127371986-127372008 GAGAAGAGTCTTCAGGCTTCAGG - Intergenic
1107091336 13:36484216-36484238 GAGAAGAATGTGTATTCTGCAGG + Intergenic
1109387774 13:61655401-61655423 CAGAAGAGTGAAAATGCTGCAGG + Intergenic
1109511027 13:63374355-63374377 GAGAAGAGTTTCAATGCATCAGG - Intergenic
1112397941 13:99050601-99050623 GAGAATAGCTTGAATGCTGGAGG + Intronic
1113660960 13:112105937-112105959 GAGAAGAGTCCCAGTTCTGCAGG + Intergenic
1113674601 13:112198649-112198671 GAGAGGAGGCTGAGTGATGCGGG - Intergenic
1114755705 14:25257220-25257242 GAGAAGATACTGAAAGCTCCTGG - Intergenic
1115651813 14:35407751-35407773 GAGAAAAATCTGAGTGCTGAAGG - Intergenic
1116335328 14:43650071-43650093 CAGAAGAGCTTGAAAGCTGCAGG + Intergenic
1116753238 14:48913091-48913113 GAGAACTGTATTAATGCTGCAGG - Intergenic
1117041474 14:51772714-51772736 GATATTAGTCTGAATACTGCAGG - Intergenic
1117580635 14:57148197-57148219 GTGAAGAATTTGAATGATGCTGG - Intergenic
1117766769 14:59091733-59091755 GAGAAAAGTCTGAAAGAAGCAGG - Intergenic
1122755247 14:103973543-103973565 GAGAAGAGGCAGAGGGCTGCCGG + Intronic
1123926645 15:25119147-25119169 GAGAAGAGTCTCCATGCGGAAGG - Intergenic
1124840917 15:33241347-33241369 GAGGAAAGCCTGAATGCTGTTGG + Intergenic
1125430990 15:39593344-39593366 GAGAACCTTCTGAAGGCTGCAGG + Intronic
1127531069 15:59843972-59843994 GAGAAGAGTCTGCATCCTTGAGG + Intergenic
1127554512 15:60074258-60074280 GAGAATGGTCTGGAGGCTGCGGG + Intergenic
1129368043 15:75069049-75069071 GAGAAGAGCCAGCATGCTGAAGG + Intronic
1130760190 15:86811330-86811352 GAGAACAGTCAGAAGGCTACTGG + Intronic
1132138625 15:99369491-99369513 GTGTTGAGTCTGAATTCTGCGGG + Intronic
1132224274 15:100128356-100128378 GGGAGGAGTGGGAATGCTGCAGG + Intronic
1136389187 16:29951597-29951619 GATAAGAGTCTGAGTTGTGCTGG - Intronic
1137429379 16:48406229-48406251 GAGCAGAGACTGAAGGCTGAGGG - Intronic
1138401149 16:56745332-56745354 GAGATGAGTCTGAGTGATGAGGG + Intronic
1140029990 16:71328040-71328062 GAAAAGACTCTGAAGGCTTCTGG + Intergenic
1140352388 16:74274783-74274805 GTGCAGATTCTGAATGCTGGAGG + Intergenic
1142112083 16:88338351-88338373 GAGAGGAGTCTGCACCCTGCAGG + Intergenic
1143762161 17:9112733-9112755 GAGAATGGTGTGAACGCTGCGGG + Intronic
1143869988 17:9951338-9951360 GAGGCGGGTCTGAATGCTTCTGG + Intronic
1144865738 17:18334618-18334640 CAGATAAGTCTGAATGGTGCAGG - Intronic
1149134192 17:53345057-53345079 GAGAAGTGTTTGAATCATGCAGG + Intergenic
1149606638 17:57929752-57929774 TAGAAGACTTTGGATGCTGCAGG - Intronic
1150146051 17:62770628-62770650 GAGAACAGTTTGAATCCAGCAGG - Intronic
1152108818 17:78345802-78345824 GAGAAGGGTCTGAATCTTGCTGG + Intergenic
1152931296 17:83111533-83111555 GAGAAGAGGGTGAAGGCTCCCGG + Intergenic
1153628360 18:7043324-7043346 AAGAAAAGTTTGAATACTGCTGG - Exonic
1153914683 18:9734850-9734872 GAGAAGATTAAGAATGCTGGGGG - Intronic
1154334581 18:13455473-13455495 GAGAAGAGGCTGGAGGCTGCAGG + Intronic
1154381051 18:13850147-13850169 AAGAAGAGGCTGAAAGCTGTTGG + Intergenic
1155764905 18:29616300-29616322 AAGAAGAGAGTGACTGCTGCTGG + Intergenic
1156834896 18:41540746-41540768 GAGTGGAATCTGAATGCTGAAGG + Intergenic
1157449611 18:47775376-47775398 GTGTAGAGTATGAATGATGCAGG - Intergenic
1158198084 18:54910540-54910562 AGGAAGGGTCTGAATGCTGGGGG - Intronic
1159519089 18:69495646-69495668 GGGAAGGGCCTGAAGGCTGCAGG - Intronic
1163127501 19:15252137-15252159 GAGAGGAGTGGGAATGCTCCTGG - Intronic
1164960202 19:32421649-32421671 GAGAGGAGTCTGTAAGCTGCAGG + Intronic
1165822267 19:38684122-38684144 GATAAGGCTCTGAATGCTGGGGG - Intronic
1167687896 19:50968064-50968086 GTGCTGAGTCTGATTGCTGCAGG - Exonic
925458814 2:4042547-4042569 GAGAAGAGGCTGAATGGAGGTGG - Intergenic
925873718 2:8293789-8293811 GAGAGGAGTTTGAATGCTGATGG + Intergenic
927675058 2:25099197-25099219 GTGTAGAGACTGAATTCTGCAGG - Intronic
928585050 2:32751391-32751413 GAGAAGAGTATGTACGCTTCAGG + Intronic
929419040 2:41772183-41772205 GAGATGAGTCTTTATGGTGCAGG - Intergenic
930233561 2:48867109-48867131 GAGGAGATTCCAAATGCTGCTGG - Intergenic
930864572 2:56109796-56109818 GGGAAGAATCTGAATGGAGCAGG - Intergenic
931007643 2:57870229-57870251 GAGAAGGGGCTGAAAGCTGGAGG - Intergenic
931551903 2:63455862-63455884 GAGAAGAATGTGTATTCTGCAGG - Intronic
932420681 2:71599637-71599659 AAGAGGAGGCTGGATGCTGCCGG + Intronic
932929773 2:76020791-76020813 GAGAAGAGAACTAATGCTGCAGG + Intergenic
935460830 2:103331623-103331645 GAGAAGAATATGAATTCTCCTGG + Intergenic
935598722 2:104900525-104900547 GAGAAGAGTAGGAAGGCTGGGGG - Intergenic
936026582 2:109035385-109035407 AAGAAGACTCTGAAAGCTGGAGG + Intergenic
937212410 2:120283403-120283425 ACAAAGAGTCTGAATGGTGCAGG - Intronic
938026612 2:127954904-127954926 CAGAAGAATCTGGATGCTGGAGG + Intronic
938610600 2:132944076-132944098 GAGATGGATCTGAATGGTGCAGG + Intronic
941650060 2:168082859-168082881 GAGAAGTGTCAGAATGAGGCTGG - Intronic
941697211 2:168565794-168565816 AATAAGAATCTGAATGCTTCTGG - Intronic
943041938 2:182814384-182814406 GTGCAGAGTCTGAAGGCAGCTGG + Intergenic
943471348 2:188297613-188297635 GAGAGGAGACTGAATACTGTGGG + Intronic
943653845 2:190486502-190486524 GATGAGAGTCTGAAATCTGCAGG - Intronic
944203644 2:197134979-197135001 GAGAAGATTCTGAATTCTCCAGG + Intronic
945252741 2:207778062-207778084 GTGAAGGCACTGAATGCTGCTGG - Intergenic
947481378 2:230503473-230503495 GAGAATAATCTGAATGTTCCTGG - Intronic
947866232 2:233399722-233399744 TAGAAGAGTCTGTCTGCTGCTGG + Intronic
947982236 2:234420403-234420425 GAGACCAATCTGGATGCTGCTGG - Intergenic
948119263 2:235516747-235516769 GGGAAGATTCTGAAGCCTGCCGG - Intronic
948786123 2:240353843-240353865 GTGAAGTCTCTGAATGGTGCTGG + Intergenic
1169175395 20:3507469-3507491 GAAAAGAGTTTGAATGATGTGGG + Intronic
1171330693 20:24336118-24336140 GAGAAGAATTTGAATGTTTCTGG - Intergenic
1172956992 20:38767969-38767991 GAGAAGTGGCTGAGTGTTGCTGG + Intronic
1173307018 20:41860461-41860483 TAGAATACTCTGAAAGCTGCAGG + Intergenic
1180862973 22:19097795-19097817 GAGAAGAGTCTGTAAGGTGATGG + Intronic
1180879705 22:19195248-19195270 GAGCAGAGTCTGCAGGTTGCTGG - Intronic
1181293806 22:21818929-21818951 GAGGGGAGGCTGAAGGCTGCAGG + Intronic
1183726266 22:39591491-39591513 GCGAAGATTCAGTATGCTGCAGG + Intronic
950565014 3:13764150-13764172 GAAAAGAGTCTGACAGCTGCAGG + Intergenic
950844802 3:16004538-16004560 AAGCAGAGTCTGAATGCAGAAGG - Intergenic
954954730 3:54508975-54508997 GAGCAGAGTATGCAGGCTGCTGG + Intronic
955965622 3:64386144-64386166 GGGAAGTGCCTGAATTCTGCTGG + Intronic
962344318 3:134608372-134608394 GGGATGTGTCTGAAGGCTGCAGG - Intronic
967430552 3:189380072-189380094 GAGAAGAATGTGTATTCTGCTGG + Intergenic
968131639 3:196195839-196195861 GGGAAGGGTCTGAAGCCTGCAGG + Intergenic
972381714 4:38525657-38525679 GAGAATAATCTGAATGGTACTGG + Intergenic
972800576 4:42471872-42471894 CAGAAGAGCCTGAAAGATGCCGG - Intronic
972942380 4:44212572-44212594 GAGATGGGTTTGAATTCTGCTGG - Intronic
974333485 4:60509345-60509367 GAGAAGAATGTGTATTCTGCAGG - Intergenic
974501940 4:62716621-62716643 GAGAAGAATTTGTATTCTGCAGG - Intergenic
975064510 4:70043486-70043508 GAGAAGAGTCAGAACACTGAAGG - Intergenic
975477047 4:74835160-74835182 GAGAGCCATCTGAATGCTGCTGG - Intergenic
977914568 4:102577252-102577274 GAGATGAGGCTGAAAGTTGCTGG - Intronic
978549981 4:109915040-109915062 CAGAATAGTCTGATTCCTGCTGG + Intronic
979756617 4:124348636-124348658 GAGCAGAGTTTGAAGCCTGCTGG + Intergenic
980200092 4:129645438-129645460 GAGAAGAGGCTGGGTGATGCTGG - Intergenic
980438287 4:132809484-132809506 GAGGAGAGTCCGGATGCTGGGGG + Intergenic
981095794 4:140779172-140779194 GATAAGAGTCTGTAACCTGCTGG + Intergenic
982994461 4:162323435-162323457 GAGAAGAATGTGATTGCAGCTGG + Intergenic
983000037 4:162402886-162402908 GGAATGAGTTTGAATGCTGCGGG - Intergenic
983726880 4:170940314-170940336 GTTAAGAGTCTGCATGCTCCAGG - Intergenic
985913717 5:2902176-2902198 GAGAAGGGTGAGGATGCTGCTGG + Intergenic
988290522 5:29278461-29278483 GAGAGTAGTCTGAATGCCACAGG - Intergenic
988727528 5:33939081-33939103 GAGAGCAGTCTGCGTGCTGCCGG + Intergenic
989005236 5:36803234-36803256 CACAAGACTCTGAATGCTCCAGG + Intergenic
991272223 5:64797403-64797425 CAGTAGACTCTGAATCCTGCAGG - Intronic
992210833 5:74478182-74478204 GAGAAGAGTTTGGCTGCTGGGGG - Intergenic
993508917 5:88747122-88747144 GAGAAGACTCTCAATCCTGTAGG - Intronic
994300596 5:98142528-98142550 GAGAAGAGACTGAAGGCAGCAGG - Intergenic
997426534 5:133806709-133806731 GAGAACTGCCTGAGTGCTGCTGG + Intergenic
998066031 5:139159456-139159478 GAGAAGAGTCTTATTGCACCAGG + Intronic
999143364 5:149377279-149377301 GTGAAGAGGCAGAATGCTGCAGG - Intronic
1000245123 5:159442641-159442663 GGGAGGAGGCTGCATGCTGCAGG + Intergenic
1000250450 5:159489763-159489785 TAGAAGACTCTGAAAGCTGGAGG + Intergenic
1001761301 5:174210364-174210386 GAATAGAGGCTGCATGCTGCAGG - Intronic
1002976411 6:2082375-2082397 GAGAAGAGTGTCACTGCTGCTGG + Intronic
1003728165 6:8790225-8790247 TAGAAGAGTGTGAAAGCTGGTGG + Intergenic
1003761757 6:9186410-9186432 CACAAGAGACTGAATTCTGCTGG + Intergenic
1004108282 6:12687139-12687161 GAGAAGTGTTTAAATGCTGCGGG + Intergenic
1006088608 6:31614823-31614845 GAGAAGAATCTGAAGTCTGCTGG - Intergenic
1007317686 6:41002694-41002716 GAGAAGGGTCTGAGAACTGCAGG - Intergenic
1007679517 6:43624759-43624781 GAGAAGAGTGAGAATGCAGGAGG + Intronic
1009440841 6:63676500-63676522 GAGAAGAGCCTTCATGCAGCGGG + Intronic
1009783363 6:68298481-68298503 GAAAAGATTCTAAATGCAGCAGG + Intergenic
1010061886 6:71632663-71632685 GAGAAGAATGTGTATTCTGCAGG + Intergenic
1010124078 6:72412429-72412451 GAGAAGACGCTGAATGCAGAGGG + Intergenic
1012917176 6:105182486-105182508 GAGAAAAATCAGAATGCAGCAGG - Intergenic
1013244728 6:108275619-108275641 GAGAAGAGGCTAAGTACTGCTGG + Intergenic
1020213585 7:6172350-6172372 GTGTTGAGTCTGAAGGCTGCTGG - Intronic
1023676484 7:42635432-42635454 GAGAAAATCCTGACTGCTGCAGG + Intergenic
1024431605 7:49294683-49294705 GAGAAGAATGTGAATTTTGCAGG - Intergenic
1024792703 7:52984952-52984974 GGGAAGGGGCTAAATGCTGCCGG - Intergenic
1024808956 7:53184536-53184558 GAGAAGAATCTGACTGGAGCTGG + Intergenic
1026523081 7:71132814-71132836 GAGAAGAGTCAAAGTGCTGTTGG + Exonic
1026843465 7:73683807-73683829 GAGGGGAGCCTGAATACTGCGGG + Intronic
1036072174 8:5453312-5453334 GAGAAGCCACTGAGTGCTGCAGG - Intergenic
1036576373 8:10031376-10031398 GAGAAGAGTGTGAATTTTGGTGG - Intergenic
1038628095 8:29213862-29213884 GAAAACAGTTTGAATGCGGCAGG + Intronic
1039192339 8:34990909-34990931 GAGAAAAGTAAGAAAGCTGCAGG + Intergenic
1039468962 8:37802038-37802060 GAGAAGAGGCTGTCTGCCGCAGG + Intronic
1041196913 8:55409999-55410021 GAGAACAGTCTGACTGGAGCAGG + Intronic
1043004986 8:74808133-74808155 GAGAGGAGCCTGAGTGTTGCTGG + Intronic
1043403684 8:79908947-79908969 GAGAAGAGGCTGTAAGGTGCAGG - Intergenic
1044767013 8:95587208-95587230 GGGAAGAGAGTGCATGCTGCCGG + Intergenic
1045589513 8:103578202-103578224 GAGAGGATTCTAAATGCAGCAGG + Intronic
1047491383 8:125377511-125377533 GAAACGAGTCCGCATGCTGCTGG + Intergenic
1048710237 8:137201671-137201693 GAGAAGAGTGTGAGTCCTGTGGG + Intergenic
1050253738 9:3772553-3772575 GAGAATAGTCTGTATGGAGCAGG - Intergenic
1057762448 9:97887890-97887912 GAGAAGAATCATAATGCTGAGGG + Intergenic
1058148932 9:101442981-101443003 GAGATGAGATTGAATGCTGTGGG - Intergenic
1059153697 9:111971172-111971194 GAGAAGAATCTAAAAGCTGAGGG - Intergenic
1059695958 9:116730716-116730738 CAGAAGAGGCAGAATGATGCAGG + Intronic
1059730630 9:117053599-117053621 GAGAAGAGCCAGGATGTTGCTGG - Intronic
1061061143 9:128250943-128250965 GAGTAGGGGCTGAATGCGGCTGG + Intronic
1061533627 9:131233897-131233919 GGGAAGAGGTTGAATGCTGGTGG + Exonic
1188179206 X:27033402-27033424 GAGAAGAGTCTCCATGCAGAAGG + Intergenic
1189170777 X:38907260-38907282 GAGAACAGTCTAACTGCTGGGGG - Intergenic
1189236696 X:39492507-39492529 GAGAGGAGTCTGAGTGCCCCTGG + Intergenic
1190469404 X:50762985-50763007 GAGAAGAGTATAAATGGGGCAGG - Intronic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1193165305 X:78273933-78273955 GAGAAGAGTCCGTATCCTACAGG + Intronic
1193415680 X:81221070-81221092 GAGAAGAATGTGTATTCTGCAGG + Intronic
1193635141 X:83941418-83941440 GAGAAGAATGTGTATTCTGCTGG + Intergenic
1198827385 X:140713615-140713637 GAGAAGAGTCTAGGTGCTGTGGG - Intergenic
1199105981 X:143868733-143868755 GATAGGAGTTTGAATGTTGCCGG - Intergenic
1199705103 X:150417924-150417946 GAGTAGTATCTGAATGATGCTGG + Intronic
1201682337 Y:16661183-16661205 GAGAGGACTCTGAATATTGCTGG + Intergenic