ID: 906837576

View in Genome Browser
Species Human (GRCh38)
Location 1:49100493-49100515
Sequence CAAGATCACCAAATCCGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 48}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906837573_906837576 -10 Left 906837573 1:49100480-49100502 CCACCACAGATCTCAAGATCACC 0: 1
1: 0
2: 1
3: 16
4: 135
Right 906837576 1:49100493-49100515 CAAGATCACCAAATCCGGACTGG 0: 1
1: 0
2: 1
3: 1
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906837576 Original CRISPR CAAGATCACCAAATCCGGAC TGG Intronic
906837576 1:49100493-49100515 CAAGATCACCAAATCCGGACTGG + Intronic
908932499 1:69333842-69333864 CAAGAACACCAAAAACAGACAGG - Intergenic
912231147 1:107794207-107794229 CAAGATCCACAAATCTGGGCTGG + Intronic
912356363 1:109057340-109057362 CAAGAACACCATTTCCGGCCGGG + Intergenic
914347116 1:146809380-146809402 GAAGATCTTCAAAGCCGGACAGG + Intergenic
918355377 1:183702893-183702915 CATCAGCACCAAATGCGGACAGG + Intronic
1063853173 10:10216382-10216404 GAAGATCTCCAAATCCCTACTGG - Intergenic
1070469668 10:76766401-76766423 CAATATCACCAAATCCGGCCGGG - Intergenic
1080041350 11:27762708-27762730 CAAAATCACCAAATATGGAAAGG - Intergenic
1091258235 11:134210646-134210668 CAAGATTTCCAAATCTGGCCAGG + Intronic
1100693712 12:97066919-97066941 CAAGATCTCCTAATCCAGAAAGG - Intergenic
1117456098 14:55898358-55898380 CAGCATCACAAAATCCAGACAGG - Intergenic
1121480270 14:94263113-94263135 TAAGATTACCAAATCCAAACTGG - Intronic
1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG + Intronic
1127041686 15:54984019-54984041 CCAGATCACCAAATCCAAAGTGG + Intergenic
1135741706 16:24980816-24980838 CAAAACCCCCAAATCTGGACAGG + Intronic
1141402026 16:83757279-83757301 CAAAATCAACAAATCCAGGCTGG + Intronic
1150764115 17:67989611-67989633 CAAGATGACCAAATAGGGCCGGG - Intergenic
1155844169 18:30684761-30684783 GAAGACCACCAAACACGGACTGG + Intergenic
1161055956 19:2190722-2190744 CAAGACCACCAAAACCACACAGG - Intronic
1165568029 19:36749118-36749140 CAACATCAACAAATCCATACTGG - Exonic
933692665 2:85191404-85191426 CCAGATCACCAAACCCTGCCTGG + Intronic
937503631 2:122511540-122511562 CTAGATCACAAAAACAGGACAGG - Intergenic
938153058 2:128903029-128903051 CGAGACCACGAACTCCGGACGGG - Intergenic
940560464 2:155288641-155288663 AAATATCACCAAAGACGGACTGG + Intergenic
944802615 2:203251420-203251442 CAAGAACACAATATCCTGACTGG - Intronic
948139609 2:235662665-235662687 CAAAATCACCAACTTCGGCCAGG - Intronic
1168960505 20:1866093-1866115 CAAGATCACCAAAACAAGAGTGG + Intergenic
1181139016 22:20790141-20790163 AAAGATCACCAAATCTAGCCAGG + Intronic
1185020464 22:48371717-48371739 CAAGTTCACAAAATTCTGACTGG + Intergenic
954402062 3:50324074-50324096 CAGGATCACCATATCCAGCCTGG - Intronic
959476608 3:106820568-106820590 CATGATCACAAAATTAGGACTGG - Intergenic
962090104 3:132234407-132234429 CAATCTCAACAAATACGGACAGG - Intronic
963940468 3:151091600-151091622 CAAGAACACCAAATCTTGGCTGG - Intronic
970649621 4:18161817-18161839 CAAGATCTTCAAATCCGACCTGG - Intergenic
975605081 4:76147626-76147648 CAAGCCCACCAAATCCTGATAGG + Intronic
978632927 4:110767780-110767802 CAATATCACCAGATCAGGGCTGG - Intergenic
979602014 4:122596089-122596111 TAAAATCAACAAATCCAGACTGG - Intergenic
987042428 5:14075598-14075620 CAAGGTCACCACAGCAGGACAGG + Intergenic
992534709 5:77687866-77687888 TAAGATGACCAAATCCAGGCCGG - Intergenic
1001154157 5:169258509-169258531 CAACATGACCAAAACCAGACAGG - Intronic
1022131149 7:27405676-27405698 CAAGATCACCAATACCAGCCAGG - Intergenic
1023168648 7:37368630-37368652 GAAGATCACCACATCTGGACAGG + Intronic
1026066973 7:67083325-67083347 AAAAATCACAAAATCAGGACTGG - Intronic
1026709951 7:72729015-72729037 AAAAATCACAAAATCAGGACTGG + Intronic
1029646737 7:101861647-101861669 CAGCACCACCAAATCAGGACTGG - Intronic
1031190456 7:118542816-118542838 CAAAATCACCATATCAGGTCAGG + Intergenic
1061202223 9:129144441-129144463 TAAGATCACCAAGTCAGGCCGGG + Intronic
1192997527 X:76527975-76527997 CAAGATGGCCAAATAGGGACTGG - Intergenic
1194867714 X:99089030-99089052 AAAGATCAACAAATCCAGAGGGG + Intergenic
1197246687 X:124173811-124173833 CACGATCACCAAATGTGGAGAGG - Intronic