ID: 906837621

View in Genome Browser
Species Human (GRCh38)
Location 1:49100893-49100915
Sequence CAGCATCCTTATCTGCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 535
Summary {0: 1, 1: 1, 2: 4, 3: 46, 4: 483}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906837621_906837627 27 Left 906837621 1:49100893-49100915 CCATGCTGCAGATAAGGATGCTG 0: 1
1: 1
2: 4
3: 46
4: 483
Right 906837627 1:49100943-49100965 TTAATCAGTAAATGGTAGGGCGG 0: 1
1: 0
2: 0
3: 13
4: 146
906837621_906837626 24 Left 906837621 1:49100893-49100915 CCATGCTGCAGATAAGGATGCTG 0: 1
1: 1
2: 4
3: 46
4: 483
Right 906837626 1:49100940-49100962 GATTTAATCAGTAAATGGTAGGG 0: 1
1: 0
2: 0
3: 14
4: 183
906837621_906837624 19 Left 906837621 1:49100893-49100915 CCATGCTGCAGATAAGGATGCTG 0: 1
1: 1
2: 4
3: 46
4: 483
Right 906837624 1:49100935-49100957 AAGGTGATTTAATCAGTAAATGG 0: 1
1: 0
2: 3
3: 35
4: 402
906837621_906837623 0 Left 906837621 1:49100893-49100915 CCATGCTGCAGATAAGGATGCTG 0: 1
1: 1
2: 4
3: 46
4: 483
Right 906837623 1:49100916-49100938 AGGCTTATAAGACTTCAGTAAGG 0: 1
1: 0
2: 0
3: 1
4: 111
906837621_906837625 23 Left 906837621 1:49100893-49100915 CCATGCTGCAGATAAGGATGCTG 0: 1
1: 1
2: 4
3: 46
4: 483
Right 906837625 1:49100939-49100961 TGATTTAATCAGTAAATGGTAGG 0: 1
1: 0
2: 2
3: 24
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906837621 Original CRISPR CAGCATCCTTATCTGCAGCA TGG (reversed) Intronic