ID: 906837627 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:49100943-49100965 |
| Sequence | TTAATCAGTAAATGGTAGGG CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 160 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 13, 4: 146} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 906837621_906837627 | 27 | Left | 906837621 | 1:49100893-49100915 | CCATGCTGCAGATAAGGATGCTG | 0: 1 1: 1 2: 4 3: 46 4: 483 |
||
| Right | 906837627 | 1:49100943-49100965 | TTAATCAGTAAATGGTAGGGCGG | 0: 1 1: 0 2: 0 3: 13 4: 146 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 906837627 | Original CRISPR | TTAATCAGTAAATGGTAGGG CGG | Intronic | ||