ID: 906837627

View in Genome Browser
Species Human (GRCh38)
Location 1:49100943-49100965
Sequence TTAATCAGTAAATGGTAGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906837621_906837627 27 Left 906837621 1:49100893-49100915 CCATGCTGCAGATAAGGATGCTG 0: 1
1: 1
2: 4
3: 46
4: 483
Right 906837627 1:49100943-49100965 TTAATCAGTAAATGGTAGGGCGG 0: 1
1: 0
2: 0
3: 13
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906837627 Original CRISPR TTAATCAGTAAATGGTAGGG CGG Intronic
906837627 1:49100943-49100965 TTAATCAGTAAATGGTAGGGCGG + Intronic
907575146 1:55519677-55519699 TAAATTAATAAATGGTAGAGTGG + Intergenic
909227385 1:73043111-73043133 ATAATCAGTAATTGTTAGGCAGG + Intergenic
910837401 1:91529632-91529654 TAAATCAACAAATGGTAAGGAGG - Intergenic
911316003 1:96357588-96357610 TAAATCAGTAACTGGTAGAATGG + Intergenic
911692959 1:100856171-100856193 TTATTCAGTAAATGGTGCTGGGG - Intergenic
914417667 1:147498846-147498868 GCACTCAGTAAATGGTAGGTAGG - Intergenic
916670807 1:167018356-167018378 CTAATAAGTAAACGGCAGGGAGG - Intronic
916947251 1:169741353-169741375 TCAGTTAATAAATGGTAGGGTGG + Intronic
916976324 1:170083681-170083703 GTAATTAATAAATGGTAGGTAGG - Intronic
917750318 1:178047350-178047372 GTACTCAGTAAATGGTAGGAAGG + Intergenic
918669542 1:187198193-187198215 TTACTCAATAAATTGTTGGGTGG - Intergenic
919713808 1:200754408-200754430 TTAATTAGTAATTTATAGGGAGG + Intronic
924038679 1:239961827-239961849 ATAATAAGTAAATGGAAGAGAGG + Intergenic
924091913 1:240510071-240510093 TTAAAAAGCAAATGGTAGGCCGG + Intronic
924593119 1:245422283-245422305 GTAATGAGTAAAGGGTGGGGGGG - Intronic
1064459939 10:15524576-15524598 TAAATCAGTAAATGGCAATGGGG + Intronic
1067550589 10:47232115-47232137 TTTAAGAGTAAATGGTAGGCTGG - Intergenic
1072841314 10:98777167-98777189 TTAAAAAACAAATGGTAGGGAGG + Intronic
1072993493 10:100221508-100221530 TTACTATGTCAATGGTAGGGGGG + Intronic
1074333924 10:112549093-112549115 CTCATCAGTAAATGGGAGGCGGG - Intronic
1080051737 11:27865134-27865156 TTATTCATTACTTGGTAGGGGGG + Intergenic
1083565522 11:63712135-63712157 TTAATATGTGAATGGTAGGAGGG + Intronic
1085488891 11:76895135-76895157 GTATTCAGTAAATGGTATTGAGG - Intronic
1085928798 11:81055801-81055823 GTAAGCAGTAAATAGTAGGATGG - Intergenic
1090462723 11:126906333-126906355 ATAAGCATTAAAAGGTAGGGAGG + Intronic
1091180619 11:133601137-133601159 TAAATGAGTAAAAGGTGGGGTGG - Intergenic
1091848426 12:3676120-3676142 TTAATAAGGAAATGGGTGGGTGG - Intronic
1092707997 12:11305601-11305623 TTAAAAAGAAAATGGAAGGGAGG + Intergenic
1092976022 12:13745630-13745652 TTAATGAATAGATGGTAGGATGG - Intronic
1096944131 12:55385326-55385348 TTAATCATTAAATGTTAGAGAGG - Intergenic
1098154319 12:67581638-67581660 TTTATGAGTAAATGCTTGGGAGG - Intergenic
1099296198 12:80830951-80830973 TTAATCAGTACAGCGTAAGGAGG - Intronic
1100171615 12:91981506-91981528 TTAATCAATAAATGGTTCTGGGG - Intergenic
1101288377 12:103340249-103340271 TTGATCAGTGAATGGCAGCGAGG + Intronic
1104512095 12:129390258-129390280 ATGATCTGTAAATGGAAGGGTGG - Intronic
1105665805 13:22554341-22554363 TAAATAAGTAAATGGTAAGTTGG + Intergenic
1105665809 13:22554459-22554481 TAAATAAGTAAATGGTAAGATGG + Intergenic
1108224752 13:48276980-48277002 TCAATCAGTAAATGGCAGGAAGG - Intergenic
1109104220 13:58229370-58229392 TTCATCAGTTAATGCTAGGTTGG - Intergenic
1113626156 13:111848776-111848798 ATAATCTACAAATGGTAGGGAGG - Intergenic
1117484673 14:56182394-56182416 TTAACCAGTAAATAGTATGATGG + Intronic
1117487588 14:56213660-56213682 TTAATAAGCCAGTGGTAGGGAGG + Intronic
1125297309 15:38217290-38217312 TTATTAAGTAAGTGCTAGGGTGG + Intergenic
1126477670 15:49082943-49082965 TTAAGCACTAAATTGTAAGGTGG - Intergenic
1132065094 15:98724528-98724550 TTAATCAGAAAATGGCACTGTGG - Intronic
1133438904 16:5804192-5804214 TTGTTCAGTAAATGTTAGTGAGG + Intergenic
1135091695 16:19522819-19522841 TTAAGCAGTTAATGGCAGGGTGG + Intergenic
1135995739 16:27246821-27246843 TTAATAAGTATATTGCAGGGAGG - Intronic
1138826597 16:60328206-60328228 CAAATCAGGAAATGGGAGGGAGG - Intergenic
1147758864 17:42784862-42784884 TTCATCTGTAAATCGCAGGGTGG - Intronic
1149126781 17:53244004-53244026 TTAATGAGCAAATGGTAGTTGGG + Intergenic
1150058391 17:62041129-62041151 TTAATCTGTAAATGGTATTTGGG - Intronic
1151096244 17:71502498-71502520 TTAAGCACTAAATGGGAAGGTGG + Intergenic
1151188441 17:72380526-72380548 ATACTCAGTAGTTGGTAGGGTGG - Intergenic
1152487853 17:80606554-80606576 TCAATCAAGAAAAGGTAGGGTGG - Intronic
1153088601 18:1318300-1318322 ATAATCAGCAAATGGTAGTGAGG + Intergenic
1154230330 18:12550678-12550700 TTAAACAGTGAATGGAAGGAGGG - Intronic
1159259408 18:65992737-65992759 TTAATCAGCAAATGGTCAGCAGG - Intergenic
1159424681 18:68270069-68270091 TTAAGCATTAAATGGAAGGCGGG + Intergenic
1160400662 18:78608869-78608891 TTATTGAGTAAGTGGTAGGAAGG + Intergenic
1160947309 19:1649721-1649743 TGTTTCAGTAAATGGGAGGGGGG - Intronic
1162546134 19:11331033-11331055 TTAAAAAATAAATGGTTGGGAGG + Intronic
1162699060 19:12500110-12500132 TAAATCAGTACATGGAAGGTAGG + Intronic
1162879021 19:13643770-13643792 TCAATCAGTGACTGGTAGGAAGG - Intergenic
927689632 2:25198946-25198968 TTATTCAGTAAATAGTACTGGGG + Intergenic
928682539 2:33717146-33717168 ATAGTCAGAAAAGGGTAGGGAGG - Intergenic
935914278 2:107932480-107932502 GGAATCTGAAAATGGTAGGGTGG - Intergenic
936047279 2:109197441-109197463 TTCATCAGTAAATGGGGGTGAGG + Intronic
942250529 2:174043947-174043969 TTAAAAAGGAAATGGTAGGCCGG + Intergenic
942373299 2:175309617-175309639 TTATGGAGTAAAAGGTAGGGAGG + Intergenic
942689203 2:178567447-178567469 TTAACCACTCAATGGTAGGTAGG + Exonic
942998663 2:182297325-182297347 TTAATAAGCAAATGGGTGGGAGG - Intronic
943852134 2:192737493-192737515 TTAATCAATAAATATAAGGGAGG - Intergenic
947318210 2:228886612-228886634 TTACTCAATAAATGGTAATGAGG + Intronic
1170430734 20:16274039-16274061 TTAATGAGTAACTGGGAGCGGGG - Intronic
1170477674 20:16732059-16732081 TAAATAAGTGAATGGTGGGGGGG + Intronic
1173549858 20:43925238-43925260 TAAATTTGTAAATGGGAGGGGGG + Intronic
1183096594 22:35555657-35555679 TTCATGAGTAAATGGGAGGCGGG + Intergenic
1183525156 22:38318202-38318224 TTAAACAGCAAATGGGAGGAAGG + Intronic
953643907 3:44735905-44735927 TTATTCAGTTAATGTCAGGGAGG - Exonic
955505615 3:59630178-59630200 ATAATTAGTAAGTGGTAAGGTGG + Intergenic
955712526 3:61795334-61795356 TTAATCTGTAAAAAGTAGGCGGG + Intronic
955804975 3:62724299-62724321 TTCATCAGTAAAAGGGAGGCAGG - Intronic
958263630 3:91411471-91411493 TTAATAAGGAAATGGTAATGTGG - Intergenic
958708852 3:97692572-97692594 TTATTCAGAAAATGGCAGTGAGG - Intronic
961682309 3:128607620-128607642 TAAATAAGTAAATGGAAGCGTGG + Intergenic
962459568 3:135597016-135597038 TTACTCAGTAAATAGTAGGCTGG + Intergenic
963571558 3:147003708-147003730 TTAATCAGTTCATGGTTTGGTGG + Intergenic
965533148 3:169795830-169795852 TTATTCAGTAAATGTTTGGGTGG + Intronic
965924730 3:173963857-173963879 TTCAGGAGTAAATGGTAGGTGGG + Intronic
967290688 3:187916973-187916995 AGAATCAGTAAATGATATGGAGG + Intergenic
971041203 4:22754184-22754206 TAAATGACTAAATGGTTGGGAGG + Intergenic
972851432 4:43055864-43055886 TTAATAAGTATTTTGTAGGGAGG + Intergenic
973149631 4:46871251-46871273 CTATTCAGTAAATGGTACTGGGG + Intronic
974699243 4:65417786-65417808 TTATTCAACAAGTGGTAGGGAGG - Intronic
974759990 4:66262834-66262856 TTAATCAGGAGATGGTAGAGAGG - Intergenic
977574445 4:98660936-98660958 CTAATCAGTAATTTGGAGGGGGG + Intergenic
981153279 4:141403579-141403601 TTTCTGAATAAATGGTAGGGTGG - Intergenic
981487057 4:145297897-145297919 TTAATCAGTATATGCTGGGCTGG - Intergenic
981845209 4:149160111-149160133 AAAATCAGTAAATAGTAGGTGGG + Intergenic
982347941 4:154382189-154382211 TTAATCAATAAATGGTGCTGGGG + Intronic
983855604 4:172640323-172640345 TGAATGAGTAAAAGGTATGGAGG - Intronic
986954920 5:13138833-13138855 TGAAACAGGAAATGGTAAGGTGG + Intergenic
987121083 5:14767279-14767301 TTAGGCAGAAAATGGTAAGGAGG + Intronic
987660144 5:20861702-20861724 TTAATCAGTCAATTATAGGCAGG + Intergenic
988094935 5:26594043-26594065 TTTATAAGTAATTTGTAGGGTGG + Intergenic
989717834 5:44485504-44485526 TTTATCTGTAAAGGGTAGGTAGG + Intergenic
990385166 5:55253257-55253279 TGAATAAGTCAATGGTAGGGAGG - Intergenic
990662027 5:58026653-58026675 TTAATCAGTAGATGGGGGGTAGG + Intergenic
990719812 5:58681759-58681781 TTGAATAGGAAATGGTAGGGTGG + Intronic
990839110 5:60055728-60055750 TCAGTCAGTAAGTGGTAGAGAGG + Intronic
990847921 5:60165059-60165081 TAAAGAAGTAAATGGTAGAGAGG - Intronic
991056322 5:62324619-62324641 TTATTCAGTAAATGGTGCTGGGG + Intronic
991178740 5:63723535-63723557 ATAAACAGAGAATGGTAGGGAGG - Intergenic
991981063 5:72231180-72231202 TACAACAGAAAATGGTAGGGAGG - Intronic
993484112 5:88461369-88461391 TAAATCAGTAAATGGTAACCTGG - Intergenic
993518822 5:88872796-88872818 CTAATCAGTAAATGGGAGGCTGG + Intronic
996756574 5:126942175-126942197 TTAATCAGTAAATGCTATGATGG - Intronic
996845263 5:127891774-127891796 TTAAACAGCAAATGAGAGGGAGG - Intergenic
998275063 5:140744607-140744629 TAAATAAATAAATGGGAGGGAGG - Intergenic
999597657 5:153223042-153223064 TTACTCTTTAAATGGTGGGGTGG + Intergenic
1001581985 5:172805288-172805310 ATAATAGGTAGATGGTAGGGAGG + Intergenic
1002671590 5:180872000-180872022 TAAATGAGTAAATGGTAATGGGG - Intergenic
1003993765 6:11516689-11516711 TTAAAAAGTAAATGTTAAGGAGG + Intergenic
1007659680 6:43476112-43476134 TGAATGAATAAATGGTATGGAGG - Intergenic
1008226104 6:48918963-48918985 TTATTCAGCAAATGGGATGGAGG - Intergenic
1008991801 6:57611511-57611533 TTAATAAGGAAATGGTAATGTGG + Intronic
1013589038 6:111604942-111604964 TTCATCAGTAAATTGATGGGGGG - Intronic
1013845965 6:114452036-114452058 TTAATCAGGAAATGAGAGGAAGG + Intergenic
1016873299 6:148839887-148839909 TTGGCCAGTAAATGGTAAGGTGG + Intronic
1020067179 7:5197282-5197304 TTAATCAGAAAATGGGAGTGGGG + Intronic
1021134850 7:16952866-16952888 TTAATCAATAAATGTTTGAGTGG - Intergenic
1021493251 7:21244053-21244075 TTAATAAGGAAATGGTAGACAGG + Intergenic
1029435471 7:100561866-100561888 TTTATCAGAACATGGCAGGGAGG - Intronic
1030766368 7:113414659-113414681 ATAATCTGTAAATGGTAGTAAGG - Intergenic
1043761110 8:84069588-84069610 CTATTCAATAAATGGTACGGGGG - Intergenic
1045233054 8:100324394-100324416 TAAATCAGTAAATATTAAGGTGG - Intronic
1045345528 8:101290309-101290331 GCAATCAGTAAATGCTATGGAGG - Intergenic
1045956307 8:107911879-107911901 TTAATAAGTAAATACTAGGCTGG + Intronic
1046536331 8:115516928-115516950 TAAAAAAGTAAAGGGTAGGGAGG + Intronic
1046655687 8:116891667-116891689 TTAATCAGTAAATAAAAGGAAGG - Intergenic
1052457816 9:28723180-28723202 TGACTCAGTAAATGTTAGGTAGG + Intergenic
1057113412 9:92497326-92497348 TTAAAAAGTAAAGGGTAGGCTGG + Intronic
1058073693 9:100628548-100628570 TCAATCAGAAAAAGGTTGGGGGG - Intergenic
1059705942 9:116823348-116823370 TCAGTCAGTAAATGACAGGGTGG - Intronic
1062247787 9:135578367-135578389 TGAATGAATAAATGGAAGGGTGG - Intergenic
1185748866 X:2594352-2594374 TTTATCTGACAATGGTAGGGAGG + Intergenic
1186928987 X:14366919-14366941 TTCATGAGGAAATGATAGGGTGG + Intergenic
1187477498 X:19625223-19625245 TTAATGAATTAATGGGAGGGAGG + Intronic
1189027540 X:37412776-37412798 TTAATAAGTAAATGGCAGAGAGG - Intronic
1193603394 X:83536350-83536372 AAAATCAGTAAATGGAAGTGGGG + Intergenic
1193963740 X:87957551-87957573 CTATTCAGTAAATGGTGGTGAGG + Intergenic
1195101967 X:101563570-101563592 TAAATAAGTAAATGATAGTGTGG - Intergenic
1196510900 X:116510918-116510940 CTATTCAATAAATGGTAGTGGGG - Intergenic
1196731626 X:118946826-118946848 TGAGTCAATAAATGGTAGGAAGG + Intergenic
1197133371 X:123031945-123031967 TTAATTTGTAGTTGGTAGGGAGG - Intergenic
1197671053 X:129278101-129278123 ATAATCAGTAAATGTTGGTGTGG - Intergenic
1199213921 X:145245707-145245729 TTTGTGAGTAAGTGGTAGGGAGG + Intergenic
1201426209 Y:13853749-13853771 TTAATCTGGAAATAGTAGGTTGG + Intergenic