ID: 906842339

View in Genome Browser
Species Human (GRCh38)
Location 1:49152953-49152975
Sequence TGTCTGCCTCACAATCAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906842338_906842339 -4 Left 906842338 1:49152934-49152956 CCAGTCACACTGCTCTGAGTGTC 0: 1
1: 0
2: 0
3: 14
4: 177
Right 906842339 1:49152953-49152975 TGTCTGCCTCACAATCAGAATGG 0: 1
1: 0
2: 2
3: 11
4: 184
906842337_906842339 10 Left 906842337 1:49152920-49152942 CCGAGATCATACTGCCAGTCACA 0: 1
1: 0
2: 1
3: 23
4: 217
Right 906842339 1:49152953-49152975 TGTCTGCCTCACAATCAGAATGG 0: 1
1: 0
2: 2
3: 11
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906842339 Original CRISPR TGTCTGCCTCACAATCAGAA TGG Intronic
900391019 1:2433948-2433970 TGTCTGCCTCATGCTCCGAAGGG + Intronic
906083231 1:43107796-43107818 TGGCGGCCTCACACTCAGAGTGG - Intergenic
906842339 1:49152953-49152975 TGTCTGCCTCACAATCAGAATGG + Intronic
908618337 1:65948199-65948221 TGTCTGTCTCACAATGGGTACGG - Intronic
909612520 1:77567777-77567799 TATTAGCCTCTCAATCAGAAAGG + Intronic
910781315 1:90937735-90937757 TGTCTGCATCAGAAGAAGAAGGG - Exonic
911596801 1:99807090-99807112 AGTCAGCCACACAATCAGAAGGG - Intergenic
911671327 1:100611910-100611932 TTTCTGCCTTTCAAACAGAAAGG + Intergenic
912722652 1:112033057-112033079 TGCCTGCCTCCCCATCAGACTGG + Intergenic
914429230 1:147604825-147604847 TCTCTGCCACCCAATCAGATGGG - Exonic
921132917 1:212235126-212235148 TGCCTCCCTCACACCCAGAACGG - Intergenic
921354458 1:214273439-214273461 TTTCTGCCTCACAATGTGAGAGG + Intergenic
922232786 1:223701086-223701108 TTTCTGACTCATACTCAGAAGGG - Intergenic
1063083754 10:2793775-2793797 TGTCTGGCTCACAAAAGGAAAGG - Intergenic
1063726363 10:8641787-8641809 TGTATGCTCCACAATCAGAGGGG + Intergenic
1064312676 10:14225615-14225637 TGTGTTCCTCACAATCGGGAGGG - Intronic
1066693331 10:38055067-38055089 TGTCTGTCACACCTTCAGAAAGG + Exonic
1067094788 10:43293236-43293258 TTACTGTCTCAGAATCAGAAAGG - Intergenic
1068059122 10:52044961-52044983 TGTCTGCCTCTCAAGCAGTTTGG - Intronic
1070777362 10:79117720-79117742 TGTGTGCCCCACCAGCAGAAGGG + Intronic
1077949737 11:6943380-6943402 TCTCTGGCTCAATATCAGAAAGG - Intronic
1081444602 11:43118310-43118332 AGCCTGTCTCACAATAAGAAAGG + Intergenic
1083415670 11:62523944-62523966 TGTCTGGCTTAAAAGCAGAAGGG - Exonic
1087154113 11:94884391-94884413 CGCCTGCCTCACAGGCAGAAGGG - Intergenic
1087342556 11:96926387-96926409 TATCTGTATCTCAATCAGAAAGG + Intergenic
1087453029 11:98349122-98349144 TCTCTACCTCAAAATCACAAAGG + Intergenic
1088774127 11:113065588-113065610 TGTCTTTCTCACAATTAGACTGG - Intronic
1088961021 11:114664820-114664842 AGTCTGTCACACAATCACAAGGG + Intergenic
1089987020 11:122824357-122824379 TCTCTGAGTCACAATAAGAATGG + Intergenic
1091578500 12:1763233-1763255 AGTGTGCCTCACAATCACATAGG - Intronic
1092013755 12:5139239-5139261 TGGCTGGCTCACATTCACAATGG + Intergenic
1093184719 12:16006675-16006697 TGTCTGCCTATCTCTCAGAATGG + Intronic
1093276644 12:17136974-17136996 TGTCTGCCTCATAACCAGAAGGG + Intergenic
1094188181 12:27667856-27667878 TGGCTTCCTCACAATCCTAAGGG + Intronic
1095305574 12:40635048-40635070 TTTCTGGATCACAGTCAGAAAGG + Intergenic
1098435868 12:70467950-70467972 TGGCTGCCTCACAATCAAGGTGG - Intergenic
1100418988 12:94411012-94411034 TTTCTGCCTAACAATCTGATTGG - Intronic
1101188203 12:102304094-102304116 AGGCTGCCTCACAATCATGAAGG - Intergenic
1107571589 13:41665503-41665525 TGTATACCTTACAATCACAATGG - Intronic
1107607393 13:42073325-42073347 TGTCTCCCCCACTATAAGAAAGG - Intronic
1110579445 13:77103208-77103230 TCTCTGTCTCACAAACTGAAGGG - Intronic
1111995207 13:95158739-95158761 TGCCTGCCTCACTATCATAGAGG + Intronic
1112422112 13:99261793-99261815 TGTGTGCCTCACAATAACCATGG - Intronic
1113883133 13:113639988-113640010 TGTCAGTCACACAAACAGAACGG - Intronic
1115414996 14:33122167-33122189 TGTCTGCTCCAGAATCAGAAAGG - Intronic
1117777458 14:59197321-59197343 TGACTGCCACACAAACAGGATGG - Intronic
1120059361 14:79963948-79963970 TGGCTGCCTTAGAACCAGAATGG + Intergenic
1120845621 14:89122518-89122540 TTTCTGCCTAACAATCTGAGTGG + Intergenic
1121271627 14:92641632-92641654 TCTCTGGCTCCCACTCAGAAGGG - Intronic
1121282667 14:92710525-92710547 AGACTGGCTCCCAATCAGAAGGG + Intronic
1122690634 14:103530638-103530660 TCTCTGCTTCACCATCAGCACGG - Intronic
1123784943 15:23662084-23662106 TTTCTGCATCACATCCAGAAGGG + Intergenic
1130011409 15:80155507-80155529 TGTCAGCCTCCCAATCTGTAAGG + Intronic
1130123680 15:81074052-81074074 TCTCTGGCCAACAATCAGAAAGG + Intronic
1130236463 15:82139513-82139535 ATTCTGCCTCACACTCAGGAGGG + Intronic
1132048293 15:98584942-98584964 CGTCTGCCTCAGACTCAGAGAGG + Intergenic
1132977464 16:2717759-2717781 TGTCTGCCTCACAGTCTGGGGGG + Intronic
1133855795 16:9548098-9548120 TTTATGCCTCACAAACAGACTGG - Intergenic
1139826896 16:69764314-69764336 TGTCTGCCTCCCAAACAGCTGGG + Intronic
1142265130 16:89060933-89060955 TGTCTGCCTGAGAATCAGCCTGG - Intergenic
1147390367 17:40105688-40105710 TGTCAGCGTCACAATGAAAATGG + Intergenic
1147887588 17:43694962-43694984 TGTCTTCATAACAATCAGACGGG - Intergenic
1148489528 17:48014186-48014208 TGTCTGTCTGTCACTCAGAAGGG + Intergenic
1150993628 17:70290329-70290351 TGTCTGAATCACACTCTGAAGGG - Intergenic
1152413312 17:80142433-80142455 TTTATGACTCACAATCTGAAAGG - Intronic
1155070404 18:22309977-22309999 TGTCTGTCCCACCACCAGAATGG + Intergenic
1156163154 18:34384754-34384776 TGTCTTCCTCACATTTGGAAAGG + Intergenic
1156734940 18:40244790-40244812 TGTCTGTTTCCCCATCAGAATGG - Intergenic
1158126939 18:54110487-54110509 TGTCTGCCTCCCACTTATAAGGG + Intergenic
1160481767 18:79246380-79246402 TGTCCTCCTCACAGTCAGTAGGG - Intronic
1168197101 19:54783094-54783116 TGTGTTCCTCACAAACAGGATGG + Intronic
926078948 2:9967958-9967980 TTTCTCCCTCACAAACATAAGGG + Intronic
928057354 2:28071134-28071156 TTTCTTCCTAACAGTCAGAATGG - Intronic
928434884 2:31248565-31248587 TGGCTGCCTCACAATCATCCAGG + Intronic
929273871 2:40004528-40004550 TGTCAGCCTCAGACTCAGAGTGG + Intergenic
929666946 2:43840654-43840676 TATCTTCCTCACAACCTGAAAGG + Intronic
929925676 2:46205863-46205885 TGTCTTCCTCACAATTTCAAAGG - Intergenic
930824039 2:55677645-55677667 TGTCTACTTAACAATTAGAAGGG + Intronic
931131587 2:59342329-59342351 TGGCTGCCTCACTATCACAATGG - Intergenic
932477408 2:72014874-72014896 GTTCTGCCTCACCATCAGAGGGG - Intergenic
934705661 2:96476820-96476842 AGTCAGCCTCTCAATCACAAGGG + Intergenic
935209994 2:100931217-100931239 TGGCTGCCTGACCATCAGCACGG + Intronic
935480484 2:103581912-103581934 TGTCTGAATCACAAGAAGAATGG - Intergenic
937786700 2:125907296-125907318 TTCCTGCATCAAAATCAGAAGGG - Intergenic
937968203 2:127530607-127530629 TGCCTCACTCACAATTAGAAGGG - Intergenic
938114863 2:128596074-128596096 GCTCTGCCTCACCATCAGTAGGG - Intergenic
938176491 2:129136185-129136207 TGTCTCATTCACAATCAGAGGGG + Intergenic
938420956 2:131146325-131146347 TGTCTGCCACCCAATAAGCATGG + Intronic
938679281 2:133672917-133672939 TGACTGACTCAAAATCAGAAAGG + Intergenic
940092343 2:149934586-149934608 TTTCCTCCTCACAATCAGTAAGG - Intergenic
941285592 2:163609156-163609178 TGTTTGCCTCACAATTACATTGG - Exonic
943419608 2:187654599-187654621 TGTCTGTCTCACCATTACAATGG - Intergenic
945170977 2:206994838-206994860 TCTCAACCTCAGAATCAGAATGG + Intergenic
945440143 2:209868551-209868573 TCTCTGCCTCACTTTCATAAAGG + Intronic
945856821 2:215079047-215079069 TGTCTGCCTGAGACACAGAAGGG - Intronic
947326114 2:228978878-228978900 AGTTTGCCTCACAATCATAGTGG - Intronic
948031556 2:234821804-234821826 TGTCTGCCTCTCACACAGGATGG + Intergenic
1168834559 20:869482-869504 AGTCAGCCTCACTGTCAGAAGGG + Intergenic
1171973088 20:31576840-31576862 TGTCTGCCTTAAAATGACAAAGG - Intronic
1173847245 20:46196004-46196026 TGGCTTCCTCAAAAACAGAAGGG - Intronic
1174762264 20:53217412-53217434 TATGTGGCTCACAAGCAGAAAGG + Intronic
1177670933 21:24226092-24226114 AGTCAGACTCACAAACAGAATGG - Intergenic
1177823426 21:26056713-26056735 TGTGTCCCTCAAAATGAGAATGG + Intronic
1177870689 21:26569630-26569652 TAGCTCTCTCACAATCAGAATGG - Intronic
1180619056 22:17147922-17147944 GGTCTGCCGCACACTCTGAATGG - Intronic
1181609226 22:24001471-24001493 TGTCTGTCTGACAGTCAGTAAGG + Intergenic
949874732 3:8618702-8618724 TGCCTGCCCCACACCCAGAAGGG - Intergenic
950463424 3:13139009-13139031 TGTCTGCCTCACAACCAGCATGG + Intergenic
951800195 3:26587213-26587235 TCTCTGCCTCACAGGCACAAGGG - Intergenic
953383160 3:42489510-42489532 TGGCTTCCCCCCAATCAGAAGGG + Intronic
958013775 3:87914526-87914548 TGTCTCCTAAACAATCAGAAAGG - Intergenic
963346036 3:144097464-144097486 TGTCTTCCCCACACTCAGTAGGG - Intergenic
963388153 3:144623019-144623041 TGTAGGCCTCACATTGAGAAAGG + Intergenic
965312821 3:167152558-167152580 TGTCAGGGTCACAATCACAATGG + Intergenic
966372232 3:179261738-179261760 AGTCTGCCACACAATCATGAGGG + Intronic
967622999 3:191656973-191656995 TGCCTGCCTCACAAATAGTAAGG + Intergenic
973150882 4:46887049-46887071 TGTGTGCCTCACATTAAGGAAGG + Intronic
973736337 4:53875281-53875303 TGGCTGCTGCACAATCAGATTGG - Intronic
974708068 4:65548760-65548782 TGTCTGCCTCAGTATAACAAAGG + Intronic
976986036 4:91299187-91299209 TGTCTGCCTCACTCTTAAAAGGG - Intronic
977517866 4:98044958-98044980 GGTCTGCCTCACCATGAGACAGG + Intronic
979210326 4:118093070-118093092 TGTTTCCCTAACAATGAGAAGGG + Intronic
979429544 4:120612050-120612072 TGACTACATCAGAATCAGAAGGG - Intergenic
979476386 4:121162870-121162892 TGTCTACATCACAAACAGAGAGG - Intronic
980070437 4:128237654-128237676 TGTGTGCCTCACAATAAGGATGG + Intergenic
981467700 4:145092913-145092935 TTTCTGCCTCACTCTGAGAAAGG - Intronic
981538364 4:145823853-145823875 TGCCTGGGTCAGAATCAGAAAGG + Intronic
982357630 4:154488253-154488275 TCTCTCCTTCACTATCAGAATGG - Intronic
983915279 4:173285397-173285419 TGCCTGCTTCACAATTAGTATGG - Intronic
984127051 4:175824296-175824318 TGTCTGCCGCACAAGCAGAGTGG - Intronic
986243738 5:5985551-5985573 TCTCTGCCTCCCCATCAGAAGGG + Intergenic
986280401 5:6317408-6317430 TATGTGAGTCACAATCAGAAGGG - Intergenic
988071636 5:26297041-26297063 TGTTTGTCTCACAATCTTAATGG - Intergenic
990819007 5:59816689-59816711 AGTCTGCTCCACACTCAGAAAGG + Intronic
991614105 5:68478178-68478200 TGTCTGTCAAACAATAAGAATGG + Intergenic
995726115 5:115181918-115181940 TGTCTGCATTACAAGCAGGAAGG + Intergenic
995866444 5:116697155-116697177 TGGGTACCTCACAATCAGATTGG + Intergenic
995949334 5:117690763-117690785 TGGATGCCTCACAAACACAACGG - Intergenic
996264358 5:121517981-121518003 TTTCTTCCTCCCAATCAAAAGGG + Intergenic
998588786 5:143455541-143455563 AGTCAGCCACGCAATCAGAAGGG - Intergenic
999692699 5:154162449-154162471 TGTGTGGCTCCCAATTAGAACGG + Intronic
999777503 5:154822844-154822866 TGGCTCCCACACAATCAGAGAGG + Intronic
1001719040 5:173841417-173841439 TATCTGCCTAACAATCTGGAAGG + Intergenic
1002131547 5:177085258-177085280 TGCCTGCGTAACAATGAGAAAGG + Intergenic
1005565353 6:27087298-27087320 TGTCTGCCTATCAATCACACTGG + Intergenic
1005569864 6:27134312-27134334 TGTCTGCCTCACAGATAGGAGGG + Exonic
1008043413 6:46827298-46827320 TGTCTACTTCACAATGACAATGG + Intronic
1008801378 6:55372607-55372629 GGTTTGCCTCACAGTCATAAAGG + Intronic
1012135391 6:95549282-95549304 TATCTGACTCAAAATCAGAGAGG - Intergenic
1013023011 6:106238641-106238663 TGTCTGCCTCAGGAATAGAAAGG - Intronic
1013873336 6:114794897-114794919 TGTCTGCTTCAGAATGAGAAGGG + Intergenic
1014669027 6:124276807-124276829 TGTCTGCTCCAGAGTCAGAAAGG - Intronic
1014818751 6:125961945-125961967 TTTATGACCCACAATCAGAAAGG + Intronic
1016465984 6:144326005-144326027 TGTCTGACTTGCAATCAGGAAGG + Intronic
1018851609 6:167644575-167644597 TGTCTGCCTCACACGGAGAGGGG + Intergenic
1019163489 6:170084335-170084357 TGTCTGCCTCTCAACCTGCAAGG + Intergenic
1020545836 7:9529064-9529086 AGTCAGCCACACAATCAGGAGGG - Intergenic
1021970872 7:25964802-25964824 TCTCTGCCTCACCAGCAGCAAGG + Intergenic
1023188008 7:37551295-37551317 TGTCTTGCTCAGAATCAGGAGGG + Intergenic
1025771646 7:64513054-64513076 TGCCTGCTTCACAATGAGTAAGG + Intergenic
1028835960 7:95375504-95375526 TCTCTGCCACACATACAGAAAGG + Intronic
1029688741 7:102166348-102166370 TGTCTGCCCCACCATGAGAACGG - Intronic
1032631641 7:133659569-133659591 TGCCTGCATCAAAATCAGCAGGG + Intronic
1032781167 7:135166405-135166427 TGCCTTCCGCACACTCAGAACGG + Exonic
1034004133 7:147450307-147450329 TGTCTGGCTCACATTCAGCCAGG + Intronic
1035107583 7:156455091-156455113 GTTCTGAGTCACAATCAGAAAGG - Intergenic
1036208037 8:6819525-6819547 AGGCTGCCTCACACTCTGAATGG + Intronic
1037665460 8:20965533-20965555 TGTTTGCTACACAAACAGAAAGG - Intergenic
1037688074 8:21160858-21160880 TGTCTGCAACACAATCAACAGGG + Intergenic
1038587997 8:28808667-28808689 TGTCTGCATGACATTGAGAATGG - Intronic
1039869873 8:41536942-41536964 TATCTCCCTTACAATCAGATTGG + Intronic
1039911847 8:41832624-41832646 TGTCTGCCTCACAAGAAGAGGGG - Intronic
1041179073 8:55229158-55229180 TGCCTGCCTTACAAACAGGATGG - Intronic
1045046485 8:98283943-98283965 TGTCTGCCTCGATTTCAGAAAGG - Intronic
1045221147 8:100201716-100201738 CTTCTGACCCACAATCAGAAAGG - Intronic
1047461535 8:125070293-125070315 TGTGTGACTCACAATCAGATAGG + Intronic
1047773330 8:128048599-128048621 GGTCTGACTCACCATCAGATGGG - Intergenic
1048019967 8:130529076-130529098 AGTCAGCCACACAATCACAAAGG - Intergenic
1048494077 8:134920785-134920807 TGTCAGCCTCAGACCCAGAAAGG + Intergenic
1049927317 9:421811-421833 TGTCTCTCTGACACTCAGAAAGG + Intronic
1050929405 9:11304675-11304697 TGCCTGCTTCACAATTGGAAAGG + Intergenic
1051959278 9:22738392-22738414 AGACTGCCACACAATCATAATGG - Intergenic
1052287251 9:26800206-26800228 TGTCAGCCTCTCCATCAGCAGGG - Intergenic
1052392762 9:27900412-27900434 TATCTGCCTCATTATAAGAAAGG + Intergenic
1053478766 9:38400807-38400829 GGTCAGCCTCACACCCAGAATGG - Intergenic
1055127858 9:72739545-72739567 TTTCGGCCTCACATTTAGAAAGG - Intronic
1055914633 9:81388589-81388611 TGTCGTGCTCACAATAAGAATGG + Intergenic
1057919381 9:99084304-99084326 AGTCAGCCACACAATCACAATGG + Intergenic
1061033504 9:128100844-128100866 TGTCTCCCTCTCAAGCAGAGAGG - Intronic
1186088495 X:6017759-6017781 AGTCAGCCACACAATCACAAGGG + Intronic
1186920120 X:14269588-14269610 TCTCAGACTCACAGTCAGAAGGG - Intergenic
1187047164 X:15658373-15658395 TGGCTACCTCACAAGGAGAAAGG + Intronic
1188959405 X:36471744-36471766 TGTTTGTCTCACAATTAGACTGG - Intergenic
1189021460 X:37346236-37346258 TGTCTGCCTCATAGTTACAATGG - Intergenic
1195379612 X:104257819-104257841 TGTCTTGCTTAAAATCAGAAAGG - Intergenic
1196184312 X:112729306-112729328 TGTCACAGTCACAATCAGAAGGG + Intergenic
1199733063 X:150656014-150656036 TATCTGGCTCATAATCAGTAGGG - Intronic
1200896726 Y:8383736-8383758 TGCCTGCCTCACAACCACAGAGG - Intergenic