ID: 906843720

View in Genome Browser
Species Human (GRCh38)
Location 1:49167506-49167528
Sequence TAGAGCTCAAAGACCTAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 121}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906843720_906843730 22 Left 906843720 1:49167506-49167528 CCTGCCTAGGTCTTTGAGCTCTA 0: 1
1: 0
2: 0
3: 9
4: 121
Right 906843730 1:49167551-49167573 CAAAGGGAGGATATTTCCTTAGG 0: 1
1: 0
2: 0
3: 15
4: 186
906843720_906843724 6 Left 906843720 1:49167506-49167528 CCTGCCTAGGTCTTTGAGCTCTA 0: 1
1: 0
2: 0
3: 9
4: 121
Right 906843724 1:49167535-49167557 CTCCACTGCTCCTTCCCAAAGGG 0: 1
1: 0
2: 4
3: 24
4: 248
906843720_906843726 9 Left 906843720 1:49167506-49167528 CCTGCCTAGGTCTTTGAGCTCTA 0: 1
1: 0
2: 0
3: 9
4: 121
Right 906843726 1:49167538-49167560 CACTGCTCCTTCCCAAAGGGAGG 0: 1
1: 0
2: 2
3: 17
4: 197
906843720_906843731 28 Left 906843720 1:49167506-49167528 CCTGCCTAGGTCTTTGAGCTCTA 0: 1
1: 0
2: 0
3: 9
4: 121
Right 906843731 1:49167557-49167579 GAGGATATTTCCTTAGGCTGAGG 0: 1
1: 0
2: 3
3: 11
4: 200
906843720_906843723 5 Left 906843720 1:49167506-49167528 CCTGCCTAGGTCTTTGAGCTCTA 0: 1
1: 0
2: 0
3: 9
4: 121
Right 906843723 1:49167534-49167556 GCTCCACTGCTCCTTCCCAAAGG 0: 1
1: 0
2: 2
3: 33
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906843720 Original CRISPR TAGAGCTCAAAGACCTAGGC AGG (reversed) Intronic
900597892 1:3490758-3490780 TGGAGCTCAGAGACCAAGGCTGG - Intronic
901948796 1:12725046-12725068 TAAAGCCCACATACCTAGGCAGG - Intronic
902754022 1:18537390-18537412 TGGAGCTCACAGACCTGGTCAGG - Intergenic
902811787 1:18892183-18892205 TGGGGCTCAAAGACCCAGCCTGG + Intronic
906843720 1:49167506-49167528 TAGAGCTCAAAGACCTAGGCAGG - Intronic
907604565 1:55803876-55803898 TTGGTCTCAGAGACCTAGGCTGG + Intergenic
908165096 1:61449808-61449830 CAGAGATCAAAGCCCAAGGCTGG + Intronic
910297878 1:85669835-85669857 TAGCCCTCAAAGAGCTAGGTGGG - Intronic
910650788 1:89564675-89564697 GAGAGCTCAAAGGCTGAGGCAGG + Intronic
911439650 1:97909350-97909372 TAGAGTTGAAAGACATAGACAGG - Intronic
911935840 1:103970659-103970681 TAGAAATCAAAAACCAAGGCTGG - Intergenic
912727308 1:112069576-112069598 TAGAGCAGAAAGAGCTAGGCAGG + Intergenic
919793027 1:201304509-201304531 TAATGCCCAAAGACCTGGGCTGG - Intronic
921826949 1:219682836-219682858 TAGAGCCCATAGACCTATCCTGG - Intergenic
1069087597 10:64159504-64159526 CAGAGCTCTAGGACCTAAGCTGG + Intergenic
1072157201 10:92734522-92734544 CAGAGGTTAAAGACCTTGGCTGG - Intergenic
1073998258 10:109340804-109340826 TAGAGCTTAAACTCCTAGGTGGG - Intergenic
1074115908 10:110457473-110457495 CAGAGCTCAGAGTCCCAGGCAGG + Intergenic
1076440589 10:130478905-130478927 TAGAGCACAAAGGCACAGGCAGG - Intergenic
1090271437 11:125388891-125388913 TAGAGGTAAAAGCCCTAGGGAGG + Intronic
1092529477 12:9332575-9332597 TAAACCTCAAAGAGCCAGGCAGG + Intergenic
1094333353 12:29320642-29320664 TGTAGCTAAAAGACCTAGGTTGG + Intronic
1102624475 12:114224037-114224059 TAGAGCTCAGAGTTCCAGGCAGG + Intergenic
1106881729 13:34139080-34139102 TGGAGCTCACAAGCCTAGGCCGG - Intergenic
1109724960 13:66327903-66327925 GAGAGATTAAAGACCTAGGCAGG - Intronic
1113168014 13:107465449-107465471 CAGAGCACAGAGACCCAGGCAGG - Intronic
1116699289 14:48218081-48218103 TAGAAATGTAAGACCTAGGCCGG - Intergenic
1117958158 14:61138305-61138327 TAAAGGTGAAAGACCAAGGCAGG + Intergenic
1120417793 14:84242256-84242278 CAGATCTCAAAGACTTAGACAGG - Intergenic
1120487690 14:85134938-85134960 TAGTACTGAAAGACCTAGTCAGG + Intergenic
1121266061 14:92603364-92603386 GAGATCTCCAAGACCTGGGCAGG - Intronic
1121791263 14:96701458-96701480 CAGAGCTCAGAGACCATGGCAGG - Intergenic
1121870468 14:97402471-97402493 CAGAGGTCAAAGTCCCAGGCTGG - Intergenic
1123106296 14:105843288-105843310 TTGAGCTGAAAGAACAAGGCAGG - Intergenic
1123539809 15:21277566-21277588 TAGAACCCAAAGGCCTAGTCTGG + Intergenic
1123994260 15:25707279-25707301 TCGAGCACAAAGCCCTGGGCAGG - Intronic
1125283287 15:38066445-38066467 CAGATATCAAAGACCTAGGTAGG - Intergenic
1126818761 15:52480464-52480486 TAGAGCTCCAAGAACAAAGCTGG + Intronic
1130957531 15:88638334-88638356 AAGAGCTCAAAGTCCTAGCCTGG + Intronic
1131931721 15:97449821-97449843 TCTACTTCAAAGACCTAGGCAGG - Intergenic
1202948119 15_KI270727v1_random:4724-4746 TAGAACCCAAAGGCCTAGTCTGG + Intergenic
1135068910 16:19335322-19335344 TAGGTCTCAAAGACCAAGACAGG + Intergenic
1137722692 16:50636995-50637017 CAGAGCTCTATGACCTAGGGAGG - Exonic
1139959885 16:70711358-70711380 TAGAGCTCCAAGGCCGAGCCAGG - Intronic
1140309855 16:73838933-73838955 TAAAGCTCAAATATCAAGGCAGG + Intergenic
1140399121 16:74655820-74655842 TAGAGAGCACAGACATAGGCCGG - Intronic
1142182338 16:88677368-88677390 TAGAGGGCCAAGACCAAGGCCGG - Intergenic
1142208670 16:88796676-88796698 TAGTGCTCAAGGACTCAGGCTGG - Intergenic
1143530840 17:7502473-7502495 TAAAGCCCAAAGACCCAGGCTGG - Intronic
1143553316 17:7644839-7644861 AAGAGATTGAAGACCTAGGCAGG - Intergenic
1148462261 17:47845547-47845569 TATAGCTCCCAGACCTTGGCTGG + Exonic
1150136885 17:62701047-62701069 TAGGGCCCAAAGACCAAGTCAGG - Intergenic
1151937562 17:77272189-77272211 CAGAGCTCAGAGACAGAGGCAGG + Intergenic
1159484539 18:69037882-69037904 TTTACCTCAAAGACCTAGGTGGG - Intronic
1161135535 19:2617377-2617399 CAGAGCTCACAGCCCAAGGCAGG - Intronic
1164929856 19:32167006-32167028 TAGACCTCAAAAACCTAGAGTGG + Intergenic
1165317238 19:35064118-35064140 GAGAGCTCTAAGACTCAGGCAGG + Intronic
925655518 2:6143962-6143984 TTCAAGTCAAAGACCTAGGCTGG + Intergenic
925986467 2:9219318-9219340 TGGAGCAGAAAGACCTAGCCAGG + Intronic
926878121 2:17508401-17508423 AATAACTCACAGACCTAGGCAGG + Intergenic
935118994 2:100164228-100164250 TAGAGTTAAAAGTCCTAGCCTGG + Intergenic
936087336 2:109478094-109478116 CAGAGCTCAAAGCCCTTGGCAGG - Intronic
936262319 2:110972262-110972284 AAGTGCTCCAAGGCCTAGGCTGG + Intronic
936399240 2:112153401-112153423 TAGAGCTCCAAGACCTCCGATGG - Intronic
942065765 2:172270221-172270243 CAGAGCTCAAACACCTGTGCTGG + Intergenic
945170876 2:206993709-206993731 GAGAGTTGAAAGACCTGGGCTGG + Intergenic
946981175 2:225217468-225217490 TATGGTTCAAAGACCTTGGCAGG + Intergenic
948009684 2:234641555-234641577 CAGAGCTAAAAGATCTGGGCTGG - Intergenic
1170347719 20:15405550-15405572 TAGAGCTCAGACTCCAAGGCAGG - Intronic
1170927187 20:20736328-20736350 AAGAACTCAAAGATCTAGGACGG - Intergenic
1172667799 20:36612919-36612941 TAGAGATCTGAGAGCTAGGCTGG + Exonic
1174766964 20:53263761-53263783 TAGAGCCCAAAGTCCTAGTGGGG - Intronic
1176243854 20:64088113-64088135 CAGAGCTCACAGGCCTAGCCTGG + Intronic
1176887340 21:14272490-14272512 TAGAGGTCAAAGACAAATGCTGG + Intergenic
1177695235 21:24563237-24563259 TAGAGCTCTTATTCCTAGGCAGG - Intergenic
1182395385 22:30032193-30032215 TAGAGCCCACAGACCTGGGGTGG + Intergenic
1182449248 22:30408979-30409001 AAGAACACAGAGACCTAGGCAGG + Intronic
949334017 3:2953678-2953700 TAGATTGCAAAGACCTAGGTAGG - Intronic
949484146 3:4521547-4521569 TTGAGTTAAAAGACATAGGCAGG + Intronic
952775489 3:37042014-37042036 TAGAGCACTAAGACCAAGTCTGG - Intronic
954364279 3:50138003-50138025 GAGAGCTCTGAGACCTAGCCAGG - Intergenic
956538695 3:70309174-70309196 TGGACCTCAAAGACCGAGGTTGG + Intergenic
959053134 3:101543301-101543323 TAGAGCTCAAAGATTGAGGATGG + Intergenic
959753597 3:109868905-109868927 TATAGCTCAAAGACATATGTAGG + Intergenic
962306916 3:134296053-134296075 TTGAGCTAAAAGAACAAGGCTGG + Intergenic
967865297 3:194185329-194185351 TAGAGCTCAGTTACCTAGGTTGG + Intergenic
969242465 4:5909169-5909191 ATGAACTCAAAGACATAGGCAGG - Intronic
969368786 4:6717167-6717189 TAGAGCTGGAAGACACAGGCTGG - Exonic
970617695 4:17782774-17782796 TAGAAATCAAAAACCGAGGCCGG - Intergenic
970965757 4:21925887-21925909 TGGAGCTGGAAGACCTAGGTTGG + Intronic
974707009 4:65531856-65531878 GAAAGCCCAAAGACCTAGGTAGG - Intronic
975227376 4:71890343-71890365 TAGGCCTCAAAGACCTAAGCTGG - Intergenic
979848466 4:125546540-125546562 GTGACCTCAAAGCCCTAGGCGGG + Intergenic
981174396 4:141664169-141664191 TTAAGCTCTAAGACCTAAGCAGG + Intronic
982026593 4:151258346-151258368 TAGAGGCCAAGGACCTAGGGTGG + Intronic
983713483 4:170749136-170749158 TTGAGATCAAATAACTAGGCAGG + Intergenic
990556540 5:56942115-56942137 TGGAGCTCAGAGAACCAGGCTGG + Intronic
990945603 5:61245934-61245956 TGCCGCTCAAAGGCCTAGGCAGG + Intergenic
994225580 5:97248763-97248785 AATTTCTCAAAGACCTAGGCAGG + Intergenic
998395484 5:141815187-141815209 TGGAGATCCAAGACCTAGCCAGG + Intergenic
999580974 5:153037413-153037435 TACACCTCAAGGACCCAGGCTGG - Intergenic
1001062755 5:168507666-168507688 TGGAGCTCAAAGACCTTGTTGGG + Intronic
1001763333 5:174225320-174225342 TACAGGTCAAATCCCTAGGCAGG + Intronic
1008016137 6:46521863-46521885 TAGTCATCTAAGACCTAGGCAGG + Intergenic
1012502206 6:99901044-99901066 TGGATTTCAAAGACCTAGGAAGG + Intergenic
1014799781 6:125765935-125765957 AAGTGCTGAAAGACCTAGGAAGG - Intergenic
1015307175 6:131722763-131722785 TAGAGCAGAAAGAACTAGGAGGG + Intronic
1015452441 6:133386583-133386605 AAGAGATCAAAGACATAGGAAGG + Intronic
1018102431 6:160453071-160453093 CAGAGCACAAAGACCTGAGCAGG - Intergenic
1018746339 6:166765018-166765040 TGGAGCTGAGAGACCCAGGCGGG - Intronic
1019271221 7:150160-150182 TAGAGCCCAAAGTCCCAGGGAGG - Intergenic
1019980084 7:4615007-4615029 GGGAGCTCAAAGACCTGGGAAGG + Intergenic
1021527043 7:21599615-21599637 TAGATGTCAAAGATCTAAGCAGG - Intronic
1025790422 7:64682627-64682649 TTGACCTCACAGTCCTAGGCTGG + Intronic
1030775457 7:113529603-113529625 TAGAGCTCAAAAACCCAGGATGG + Intergenic
1034063728 7:148117219-148117241 AAGAGCTCAAGGACAGAGGCTGG + Intronic
1036649631 8:10634069-10634091 TAGAGCTCAGAGGACCAGGCTGG + Intronic
1036719334 8:11158416-11158438 TACAGCTGAAAGTGCTAGGCAGG + Intronic
1038343789 8:26713116-26713138 TAGAATTACAAGACCTAGGCTGG - Intergenic
1045030407 8:98129766-98129788 TAGAGCTAGGAGACCTAGGAAGG - Intronic
1048264682 8:132975121-132975143 TTGGGGTCAAAGACCTGGGCAGG - Intronic
1053305826 9:36984234-36984256 TGGAGCTCCAAGAGCAAGGCAGG + Intronic
1055413329 9:76054459-76054481 AAGATATCAAAGATCTAGGCAGG + Intronic
1055427431 9:76210806-76210828 TTGAGCTAAAAGACATGGGCTGG + Intronic
1186508239 X:10110972-10110994 TTGAGCTCAGAGTCCTAGGCAGG + Intronic
1187119137 X:16386687-16386709 TAGAGCTTAAAGAACATGGCAGG - Intergenic
1191843016 X:65526459-65526481 TAGAGCCAAGAAACCTAGGCTGG + Intronic
1192613634 X:72593635-72593657 TAAAGTTCAAAGACTTGGGCCGG - Intronic
1196298747 X:114030239-114030261 TAGAGCTCCAAGGCCTAGAGTGG - Intergenic
1196833750 X:119796432-119796454 TAAAGCTCAGACTCCTAGGCTGG - Intergenic
1198196352 X:134366737-134366759 TAAAAAACAAAGACCTAGGCCGG + Intergenic