ID: 906844607

View in Genome Browser
Species Human (GRCh38)
Location 1:49178114-49178136
Sequence GGAGCTAGGCAGATTTAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 180}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906844607 Original CRISPR GGAGCTAGGCAGATTTAAGC TGG Intronic
901645870 1:10716427-10716449 TGAGCAAGCCAGATTTAAGCCGG - Intronic
903578260 1:24352560-24352582 TGAGCTTGGCAGATGTGAGCAGG + Intronic
905610344 1:39345006-39345028 GTAGTTAGGCAGATATGAGCAGG - Intronic
906844607 1:49178114-49178136 GGAGCTAGGCAGATTTAAGCTGG + Intronic
907754711 1:57300401-57300423 GGAGCAAGGCAGAGTTAACAGGG + Intronic
909731715 1:78900068-78900090 GGAGGTAGAGAAATTTAAGCAGG + Intronic
910602823 1:89050135-89050157 GGAGCAGGGCTGATTTAAGAAGG + Intergenic
910637889 1:89429108-89429130 GGAGCAGGGCTGATTTAAGAAGG - Intergenic
912940178 1:114037763-114037785 GTAGCTAGGCAGACATGAGCAGG - Intergenic
913088596 1:115460761-115460783 GGAGCTAGGGAGAGTTATGCTGG - Intergenic
919299102 1:195738442-195738464 GTAGCTAGTCAGACATAAGCAGG + Intergenic
921840858 1:219827005-219827027 GGAGTCAGGCAGCTTCAAGCTGG - Intronic
924154458 1:241162039-241162061 GTAGCTAGGCAGACGTGAGCAGG + Intronic
1068192042 10:53665202-53665224 GTAGCTAATCAGACTTAAGCAGG - Intergenic
1069844365 10:71360577-71360599 GGTGCTGGGCAGAGTTAAACTGG + Intronic
1073535639 10:104274724-104274746 GGAGCTAGGGTAATTTAACCTGG - Exonic
1074420660 10:113306115-113306137 GGAGCTAGGAAGAGGTAAGGAGG + Intergenic
1080967908 11:37234907-37234929 GTAGATAGGCAGATGTGAGCAGG - Intergenic
1081579925 11:44345222-44345244 GGAGCTCAGCAGACTTAAGCCGG + Intergenic
1084694097 11:70743752-70743774 GGAGCTGGGCAGAGTTCACCAGG - Intronic
1085652056 11:78277324-78277346 GTAGCTAGGCAGACATGAGCAGG + Intronic
1086404591 11:86488954-86488976 AGAGATAGGCAGATTTCAGCAGG + Intronic
1091893947 12:4085026-4085048 AGAAGCAGGCAGATTTAAGCTGG + Intergenic
1092800184 12:12157019-12157041 AGAGCTGGGCAGAGTTCAGCAGG + Intronic
1093273140 12:17091096-17091118 AGAACTTGGCATATTTAAGCAGG + Intergenic
1093422018 12:18984399-18984421 GTAGTTAGGCAGATGTGAGCAGG - Intergenic
1094214352 12:27924659-27924681 GGAGATAGCCAGATCTAGGCTGG - Intergenic
1095595067 12:43949734-43949756 GTAGCTAGGCAGACATGAGCAGG - Intronic
1096909005 12:54963228-54963250 GTACCCAGGCAGGTTTAAGCAGG - Exonic
1097153860 12:56998450-56998472 GGAGCGAGGCAGATTGAAACAGG - Intergenic
1097931653 12:65193798-65193820 GTAGCTAGTCAGGTATAAGCAGG - Intronic
1098175064 12:67781650-67781672 GCAGATAGTCAGATTTAACCAGG + Intergenic
1100827010 12:98483922-98483944 GGAGCCTGGCACATTTTAGCTGG - Intergenic
1102905353 12:116670395-116670417 GGAGCTAGGCAGACATGAGCAGG - Intergenic
1104432520 12:128728066-128728088 GTAGCTAGGCAGACATGAGCGGG - Intergenic
1109333801 13:60966565-60966587 GTAGCTAGTCAGGTATAAGCAGG + Intergenic
1109661145 13:65462224-65462246 GTAGCTAGTCAGACATAAGCAGG - Intergenic
1111127846 13:83935391-83935413 GGATCTAGGCAGACATGAGCAGG + Intergenic
1111521758 13:89413797-89413819 GTAGCTAGGCAGACATGAGCAGG - Intergenic
1111763668 13:92498657-92498679 GTAGCTAGTCAGATATGAGCAGG - Intronic
1112759808 13:102681514-102681536 GGAATTTGGCAGATCTAAGCTGG + Intergenic
1114805072 14:25825828-25825850 GGCTTTAGGCAGAATTAAGCAGG - Intergenic
1114967490 14:27981256-27981278 GTAGTTAGGCAGATATAAGCAGG - Intergenic
1115063730 14:29227371-29227393 GGATTTAGGCATATTTATGCAGG - Intergenic
1115527651 14:34297752-34297774 GTAGATAGGCAGATATGAGCAGG + Intronic
1115798880 14:36969834-36969856 GGATCGAGGCAGATGCAAGCAGG + Intronic
1117099791 14:52334481-52334503 GTAGCTAGGCAGACATGAGCTGG - Intergenic
1117990691 14:61430572-61430594 GTAGTTAGGCAGATATGAGCGGG + Intronic
1118422963 14:65627943-65627965 GTAGCTAGGCAGACTTAAGAGGG - Intronic
1118488248 14:66234215-66234237 TCAGCTAAGCAGATTCAAGCTGG - Intergenic
1119102074 14:71889171-71889193 GGAGGTAGGCAGATTTGATCTGG + Intergenic
1119175430 14:72564853-72564875 GGAGCTAGGGAGACTTCAGATGG + Intronic
1120384163 14:83822868-83822890 ATTGCTAGGCAGATATAAGCCGG - Intergenic
1122883906 14:104702137-104702159 GGAGCTAGGCAGGTGTATGTAGG - Intronic
1125096152 15:35854540-35854562 GGAGCGAGGGAGATCTGAGCAGG + Intergenic
1130740401 15:86592896-86592918 GTAGCTAGGCAGATATAAGCAGG - Intronic
1133731806 16:8584578-8584600 GTAGCTAAGCAGAATTAAGGAGG + Intronic
1137659875 16:50195457-50195479 GGAGGAAGTCAGAATTAAGCAGG + Intronic
1140708820 16:77657294-77657316 GGAGCAATACACATTTAAGCAGG + Intergenic
1144017056 17:11206181-11206203 GTAGATAGGCAGATATGAGCAGG - Intergenic
1145190393 17:20837007-20837029 GAACCTAGGCTGATTTGAGCAGG + Intronic
1145401605 17:22540888-22540910 GGACCTAGGCTGATTTGAGCAGG + Intergenic
1148359961 17:47003554-47003576 GGACATGGGCAGATTTTAGCTGG + Intronic
1149258042 17:54849397-54849419 GTAGCTAGGCAGACATGAGCAGG + Intergenic
1150334379 17:64319977-64319999 GGAGCTAGGCAAACATGAGCAGG - Exonic
1150786896 17:68170333-68170355 GGACACAGGCAGATTTTAGCTGG - Intergenic
1153538837 18:6133615-6133637 GTAGCTAGGCAGACATGAGCAGG + Intronic
1154112897 18:11585592-11585614 GTAGTTAGGCAGACATAAGCAGG + Intergenic
1155097252 18:22569651-22569673 GCAGCTAGGCAAACTGAAGCAGG - Intergenic
1155380470 18:25217022-25217044 GGATCTGGGCAGAGTTAAGAAGG + Intronic
1157409637 18:47452976-47452998 GTAGCTAGTCAGGTATAAGCAGG + Intergenic
1157707286 18:49818150-49818172 GTAGCTAGGCAGACTTGGGCAGG - Intronic
1158094571 18:53756159-53756181 GTAGCTAGGCAGACATGAGCAGG + Intergenic
1164655649 19:29919460-29919482 GGAGGGAGACAGATTTGAGCTGG + Intergenic
1165404390 19:35620784-35620806 GGTGCTGGGCAGATTGAGGCAGG + Intronic
1167897725 19:52594623-52594645 GCTGCTAGGCAGGTTGAAGCAGG - Intronic
925097408 2:1218237-1218259 TGAGTTAGGGAGATTTATGCAGG - Intronic
925981505 2:9180977-9180999 GGAGCTAGGCAAAGTCAAGTGGG - Intergenic
926092669 2:10060718-10060740 GGAGCCAGGCAGATCTCACCTGG + Intronic
926637272 2:15195530-15195552 GTAGCTAGGCAGACATGAGCAGG + Intronic
927815540 2:26213442-26213464 GAAGAAAGGCAGATTGAAGCTGG - Intronic
928049242 2:27972195-27972217 AGAACTAGGCATATTTAACCTGG + Intronic
929738212 2:44574393-44574415 AGCCCTAGGCAGATTTAGGCTGG + Intronic
930892285 2:56404329-56404351 GGAGCTAGGCAGAGCTGAACTGG + Intergenic
930898633 2:56476529-56476551 GTAGCTAGGCAGATATGAGCAGG + Intergenic
931997847 2:67856230-67856252 GGAGCTAGAGATCTTTAAGCTGG - Intergenic
933237639 2:79882744-79882766 GGAGCTTGGCAGGCTTAAGCAGG + Intronic
934540066 2:95166352-95166374 AGCGTTAGGCAGATTTGAGCTGG + Intronic
938779922 2:134575773-134575795 TAAGTTAGGCAGATTTCAGCAGG + Intronic
939632243 2:144538799-144538821 GGAGCCAGGCAGTTTTAACTTGG + Intergenic
940566288 2:155364862-155364884 GTAGCTAGGCAGACATGAGCAGG - Intergenic
942477900 2:176348067-176348089 GGATCTAGGCAAATGGAAGCTGG - Intergenic
943633502 2:190280343-190280365 GTAGCTAGGCAGACATGAGCAGG + Intronic
947051144 2:226044940-226044962 GTAGATAGGCAGACATAAGCAGG + Intergenic
948929538 2:241123148-241123170 GGGCCTAGGCAGATTTAAAGTGG + Intronic
1170497389 20:16939568-16939590 GCAGGTAGGCAGACATAAGCAGG + Intergenic
1174291702 20:49513505-49513527 GGAGCTAGGGAGATATCAGAAGG + Intronic
1175046599 20:56112284-56112306 AGGGCTGGGCAGATTTAAGAAGG + Intergenic
1176702928 21:10079812-10079834 ACAGATAAGCAGATTTAAGCAGG + Intergenic
1177186045 21:17798094-17798116 AAAGCTAAGCAGATTTAAACTGG - Intronic
1177260595 21:18724926-18724948 GGATCTAGGGAGATGTCAGCAGG - Intergenic
1177609120 21:23423158-23423180 GAAGATAGGCAGATGTGAGCAGG + Intergenic
1182481112 22:30609393-30609415 GGGGCCAGGCAGATTCACGCAGG - Intronic
1184216928 22:43073931-43073953 GGAACTCGGGAGATTGAAGCAGG - Intronic
1184384560 22:44166924-44166946 TGAGCTAGGCAGACTTACCCGGG + Intronic
950105710 3:10387056-10387078 GCAGTTAGGCAGATCTAAGCAGG - Intronic
950858337 3:16126073-16126095 GGGGCTAGACAGATCTAAGATGG + Intergenic
950869582 3:16217052-16217074 GTAGCTAGTCAGACATAAGCAGG - Intronic
950938582 3:16869225-16869247 GTAGCTAGGCAGATTTCACAGGG + Intronic
951933865 3:28000572-28000594 GTAGTTAGGCAGACATAAGCAGG + Intergenic
953179200 3:40580858-40580880 GGACCTAGGCAGATCTTAGCAGG - Intergenic
953790004 3:45940159-45940181 GTAGCTAGGCAGACATGAGCAGG + Intronic
953798015 3:46000361-46000383 GTAGCTAGGCAGACATGAGCAGG + Intergenic
955143361 3:56291617-56291639 GGGGCTAGGCAGTGTGAAGCTGG - Intronic
957315903 3:78576000-78576022 GTAGCTAGGCAGACATGAGCAGG - Intergenic
960692702 3:120363564-120363586 GGAGTTACTCAGATTCAAGCAGG + Intergenic
961480922 3:127180213-127180235 GTAGCTAGGCAGACATGAGCAGG + Intergenic
961565342 3:127759734-127759756 GGAGCTGGGCTGATCTGAGCAGG - Intronic
964313849 3:155422598-155422620 AGAGTTAAGCAGAGTTAAGCAGG - Intronic
965089167 3:164141542-164141564 GTAGCTAGTCAGACTTGAGCAGG + Intergenic
966287996 3:178320494-178320516 GAACTGAGGCAGATTTAAGCAGG - Intergenic
966308725 3:178569275-178569297 GGGGCCAATCAGATTTAAGCAGG - Intronic
967827012 3:193885288-193885310 GTAGTTAGGCAGACATAAGCAGG + Intergenic
968270160 3:197397372-197397394 GGAGCTAGGGAGTTGTGAGCAGG + Intergenic
970336981 4:15057984-15058006 AGAGCTTGGCAGAATTAACCAGG - Intronic
971764760 4:30815911-30815933 GTAGCTAGGCAGACATTAGCAGG - Intronic
972016385 4:34251100-34251122 GTAGTTAGGCAGACATAAGCAGG - Intergenic
972912143 4:43830771-43830793 GTAGTTAGGCAGACATAAGCAGG + Intergenic
974039103 4:56842793-56842815 GTAGTTAGGCAGATGTAGGCAGG + Intergenic
975916359 4:79330565-79330587 GTAGCTAGGCAGACGTGAGCAGG + Intergenic
978601791 4:110436281-110436303 GGAGCTAAACAGATTTTAGTGGG + Intronic
978829024 4:113060465-113060487 GGAGCTATGTAGATTCAAGCAGG - Intronic
979038682 4:115759092-115759114 GTAGCTAGGCAGACATAAGCTGG + Intergenic
979183203 4:117756109-117756131 GTAGTCAGGCAGATATAAGCAGG - Intergenic
980233441 4:130073316-130073338 GGACCTAGGTAGAATTCAGCAGG - Intergenic
980375120 4:131936186-131936208 AGATATAAGCAGATTTAAGCAGG + Intergenic
983904997 4:173172618-173172640 GCAGCTAGGCAGACATGAGCAGG - Intronic
988629593 5:32914703-32914725 GTAGCTAGGCAGAGATGAGCAGG + Intergenic
989411354 5:41122861-41122883 GTAGATAGGCAGATATGAGCCGG - Intergenic
990053078 5:51532228-51532250 GGAGCTAAACAGTTTTAAACTGG + Intergenic
990489154 5:56287258-56287280 GTAGCTAGTCAGATATGAGCAGG + Intergenic
990594125 5:57296047-57296069 GTAGCTAGGCAGACATGAGCAGG + Intergenic
990775530 5:59301746-59301768 GCAGATAGGCAGATATGAGCAGG + Intronic
995227467 5:109717683-109717705 GGAGCTAGGCAGAATGAGGCAGG + Intronic
995538820 5:113164536-113164558 TGAGCTAGGCAGAATTCATCTGG - Intronic
996151081 5:120035799-120035821 GTAGCTAGTCAGGTATAAGCAGG + Intergenic
997102911 5:130988119-130988141 GGAATTAGGCAGATTGAAGAGGG + Intergenic
997808103 5:136939817-136939839 GTAGCTAGTCAGGTATAAGCAGG + Intergenic
998068860 5:139180866-139180888 GGAGCTATGGAGACTTCAGCTGG - Intronic
1000724860 5:164757249-164757271 GGAGCTACACAGAATAAAGCTGG - Intergenic
1001490063 5:172148784-172148806 GGAGCTAGGCAGACCTGGGCTGG + Intronic
1004467737 6:15901573-15901595 GTAGATAGGCAGATATGAGCAGG - Intergenic
1004474311 6:15956940-15956962 GTAGTTAGGCAGACTTGAGCAGG - Intergenic
1005158242 6:22833314-22833336 GTAGCTAGGCAGACATGAGCAGG + Intergenic
1007327170 6:41071970-41071992 GGAGCAAGGCCGATTTAGGACGG + Intronic
1008179399 6:48309717-48309739 AGAGCTATTGAGATTTAAGCTGG + Intergenic
1008390095 6:50940389-50940411 GGACTTAGGCAGATGTAAACAGG + Intergenic
1008634446 6:53395812-53395834 GGAGGAAGGGACATTTAAGCTGG + Intergenic
1008960257 6:57259270-57259292 GGGGGTTGGCTGATTTAAGCTGG + Intergenic
1009640570 6:66330611-66330633 GAAGCTGGGTAGATTTAAACAGG - Intergenic
1009893051 6:69712082-69712104 GAAGTTAGGCAGAATGAAGCTGG - Intronic
1011592682 6:88985680-88985702 GGAGGAAGGGACATTTAAGCTGG + Intergenic
1011984996 6:93432222-93432244 GGAAATAGGCAGAATTAAGCAGG + Intergenic
1013122332 6:107151760-107151782 GGTGCTAGGCAGAGGAAAGCAGG + Intergenic
1013645804 6:112139856-112139878 AAAGCCAGGCAGGTTTAAGCTGG + Exonic
1016548479 6:145250560-145250582 GGTGCTTGGCAGATGTGAGCTGG + Intergenic
1017426843 6:154330913-154330935 GTAGCTAGGCAGACATGAGCAGG + Intronic
1020399516 7:7759668-7759690 GGAGGAAGGGAAATTTAAGCTGG + Intronic
1021641621 7:22743199-22743221 GGAGCTATGCATATTTATGAAGG + Intergenic
1023587226 7:41743339-41743361 GGAGCTATGAAGAATAAAGCAGG + Intergenic
1026274442 7:68864405-68864427 GTAGCTAGGCAGACATAAGCAGG + Intergenic
1028077883 7:86536908-86536930 GTAGCTAGGCAGACATGAGCAGG - Intergenic
1033221902 7:139532490-139532512 GCAACTAGTCAGATTCAAGCAGG + Intronic
1033302594 7:140199721-140199743 GCAGGGAGGCAGATTTAAGCTGG + Intergenic
1036095006 8:5714076-5714098 GTAGCTAGTCAGATATAAGCAGG - Intergenic
1039024366 8:33241761-33241783 GGAGGAAGTCAGATTTTAGCAGG - Intergenic
1039729186 8:40256025-40256047 GTAGCTAGTCAGATATGAGCAGG - Intergenic
1041670129 8:60483354-60483376 GTAGCTAGGCAGAGATGAGCAGG + Intergenic
1042167518 8:65959985-65960007 GAATCTAACCAGATTTAAGCAGG - Intergenic
1044267775 8:90203747-90203769 GGAGGCAGGAACATTTAAGCTGG - Intergenic
1046472767 8:114700087-114700109 GGAGCTAAGCAAAATTATGCAGG - Intergenic
1048161434 8:132025186-132025208 GTAGATAGGCAGATATGAGCAGG + Intronic
1048661864 8:136613335-136613357 GCAGATAGGCAGGTTTAAGCAGG - Intergenic
1049401375 8:142429002-142429024 GGAGCAAGTCAGAAATAAGCTGG - Intergenic
1050630044 9:7549351-7549373 GGAGCTCAGCAGGCTTAAGCAGG - Intergenic
1050914585 9:11115977-11115999 GTAGTTAGGCAGATATGAGCAGG + Intergenic
1051354671 9:16230896-16230918 GGAGCCAGGCAAATTTGGGCAGG - Intronic
1059343366 9:113612258-113612280 GGAGCCTGGCAGCTTTGAGCAGG + Intergenic
1059744055 9:117183031-117183053 TGAGGAAGGAAGATTTAAGCTGG - Intronic
1060483737 9:124033912-124033934 GGAGCCAGGCAGAATGAAGTTGG + Intergenic
1060789742 9:126478185-126478207 GGAACTAGGAAGATCTAAGCAGG - Intronic
1061072728 9:128321579-128321601 TGGGTAAGGCAGATTTAAGCAGG - Exonic
1061618550 9:131795886-131795908 GGAAGTAGGCAGATTTTAGATGG + Intergenic
1202787954 9_KI270719v1_random:49921-49943 AGATATAAGCAGATTTAAGCAGG + Intergenic
1186716691 X:12259457-12259479 GAAGCTAGGAAGATGTAAGGAGG + Intronic
1187036509 X:15545805-15545827 GTAGCTAGGCAGACATGAGCAGG - Intronic
1188978862 X:36708107-36708129 GGAGGTAGGAATATTTAAGGAGG + Intergenic
1189064881 X:37796868-37796890 GGAGCCAGGCAGTCTAAAGCAGG + Intronic
1190604501 X:52126806-52126828 GGATCCAGTCAGATTTGAGCAGG + Intergenic
1190915818 X:54810438-54810460 TGAGCTAAGCACATTTATGCAGG + Intronic
1190939104 X:55023854-55023876 GGAGCTAGGCAGATCTGAGACGG + Exonic
1193062315 X:77220035-77220057 GGAGATTGGCAGGCTTAAGCAGG - Intergenic
1198613452 X:138427438-138427460 GGAGCTCAACAGATTTAAACTGG + Intergenic
1198957671 X:142149858-142149880 GGAGTCAGGCAGACATAAGCAGG + Intergenic
1199977791 X:152904581-152904603 GGACCCAGGCTGATTTAAGCCGG - Intergenic
1200830599 Y:7685670-7685692 GGAGCTAGGCTGTTTTAAAATGG - Intergenic
1202116399 Y:21472369-21472391 GGAGCTAGCCCGTTTTAAACTGG + Intergenic