ID: 906846468

View in Genome Browser
Species Human (GRCh38)
Location 1:49198063-49198085
Sequence TGCTTCCCAAGTTAGATCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906846466_906846468 2 Left 906846466 1:49198038-49198060 CCATGTCTTCTCACAGTCTTCTG 0: 1
1: 0
2: 3
3: 47
4: 426
Right 906846468 1:49198063-49198085 TGCTTCCCAAGTTAGATCCAGGG 0: 1
1: 0
2: 4
3: 25
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906846468 Original CRISPR TGCTTCCCAAGTTAGATCCA GGG Intronic
903856739 1:26342319-26342341 TTCTTCCCCAGTCAGCTCCACGG + Intronic
906457256 1:46007824-46007846 TCATCCCCAAGTTAGGTCCATGG + Intronic
906846468 1:49198063-49198085 TGCTTCCCAAGTTAGATCCAGGG + Intronic
907863877 1:58380085-58380107 TGCTTCCCAGGTGGCATCCAAGG - Intronic
910239564 1:85071923-85071945 TGCAGCCCAAGTCAGAACCATGG + Exonic
914771880 1:150694365-150694387 AGTTTCCCAAGTTAGATTAAAGG - Intronic
915495290 1:156278156-156278178 TGCTTCCCAAGAGACATGCAGGG + Intronic
916178168 1:162060241-162060263 TCCTTCCCGAGTTACCTCCAGGG - Intergenic
916283194 1:163075308-163075330 TGCTTCTCCAGCAAGATCCATGG - Exonic
916332635 1:163634436-163634458 TACTTCCCAAGTTATATCCAGGG + Intergenic
917527970 1:175806162-175806184 TGCTTTCCAAGTTCTATCTATGG + Intergenic
918187114 1:182137861-182137883 GTCTTCCCAAGCTAGACCCAGGG + Intergenic
919094499 1:193013789-193013811 TGCTCCCCCAGTTAGGACCATGG - Exonic
919584138 1:199415553-199415575 CACTCCCCAAGTTAGCTCCAGGG - Intergenic
921440752 1:215182863-215182885 CTCTCCCCAAGTTAGTTCCAGGG + Intronic
922068724 1:222169954-222169976 CTCTCCCCAAGTTAGCTCCAGGG - Intergenic
922130492 1:222772312-222772334 TGCTTCTCCAGTTCGCTCCATGG - Intergenic
923377593 1:233380004-233380026 AGCTGCCCCAGTTAGAACCACGG + Intronic
1062768993 10:85157-85179 TCCCTGCCAAGTGAGATCCAGGG - Intergenic
1063359938 10:5444650-5444672 TTCCTCCAAAGTTAGATCCTTGG + Intronic
1064600022 10:16984272-16984294 TACATCCCATGTTAGATCTATGG - Exonic
1064925189 10:20561934-20561956 TGCTACCCAAGTGTAATCCATGG - Intergenic
1068826752 10:61448801-61448823 TTCTTCCCCAGATAAATCCAAGG - Intronic
1071112480 10:82176050-82176072 AGCTTCCTAAGTTGGATGCAAGG - Intronic
1072252133 10:93589962-93589984 TGCTTCTGAAGTCAGATTCATGG + Exonic
1072922942 10:99591941-99591963 TGCTTCAAAAGTAAAATCCAGGG - Intergenic
1073584323 10:104694131-104694153 TGCTTTCCACGTTAGATTCAAGG + Intronic
1078087950 11:8245606-8245628 TACTTCCCCAGTGAGATCCTGGG - Intronic
1078644114 11:13123127-13123149 TGCTACCAAAGTATGATCCATGG - Intergenic
1081111381 11:39137994-39138016 CTCTCCCCAAGTTAGCTCCAGGG + Intergenic
1082948515 11:58786783-58786805 TTCTCCCCAAGTTATCTCCAGGG - Intergenic
1083010165 11:59389212-59389234 TGCTCCCTAAGTTAGATTCAAGG + Intergenic
1083127639 11:60587585-60587607 TTCTCCCTAAGTTAGCTCCAGGG + Intergenic
1085422901 11:76379550-76379572 TGCTGCCCAAGGTATCTCCATGG + Intronic
1086582506 11:88415246-88415268 AGCCTCTCAAGTCAGATCCACGG + Intergenic
1087489281 11:98802292-98802314 TGCTTTCCAAGTTATTTCCAAGG - Intergenic
1087605063 11:100366937-100366959 CTCTCCCCAAGTTAGCTCCAGGG - Intergenic
1088417203 11:109602472-109602494 TGCCCCACAAGCTAGATCCATGG - Intergenic
1089133523 11:116231167-116231189 TGCTGCCCAAGTGCCATCCAGGG - Intergenic
1090926384 11:131254142-131254164 TCGTTCCCAAGTAAGAGCCAAGG + Intergenic
1091144856 11:133269742-133269764 TGCTTCCCTAGTTAGAGAGATGG - Intronic
1095401056 12:41814822-41814844 CTCTCCCCAAGTTAGCTCCAGGG + Intergenic
1095866931 12:46982868-46982890 TTCATCCCAAGTTAGCTCCAGGG - Intergenic
1098885224 12:75954013-75954035 GGCTTCCCAAGTTTTATACATGG - Intergenic
1100341072 12:93679656-93679678 TGCTTCCCAAGTGACATGCCAGG - Intronic
1100393149 12:94161795-94161817 TGCTCCCCAAGGCAGAACCAAGG + Intronic
1100867085 12:98868525-98868547 TGTTTCCCAAGTTATCTCAAAGG + Intronic
1100931833 12:99618681-99618703 CCCTTCCCAAGTTATTTCCAAGG - Intronic
1103965184 12:124634269-124634291 TGTGTCCCAAGAGAGATCCAAGG + Intergenic
1105063122 12:133172312-133172334 CTGCTCCCAAGTTAGATCCAGGG - Intronic
1106917959 13:34535465-34535487 TTCTCCCCAAGTCACATCCAGGG - Intergenic
1107550442 13:41469583-41469605 ATTTTCCCAGGTTAGATCCAGGG + Intronic
1109217172 13:59603170-59603192 AGCTTCCCATGTTAGTTTCAGGG - Intergenic
1111420640 13:88005895-88005917 TGCTTCTCAAGTTAGATTCAGGG + Intergenic
1111464488 13:88591682-88591704 CTCTTCCCAAGTTAGCTCTAGGG - Intergenic
1113379719 13:109791533-109791555 TTCTTCCCAAGGCAGATTCAGGG + Intergenic
1115936782 14:38561242-38561264 CTCTTCTTAAGTTAGATCCAGGG - Intergenic
1118125369 14:62896546-62896568 TTCTTCCTAAGGTAGATTCACGG + Intronic
1118141849 14:63092563-63092585 TGCTTCCCAAGTCATATGAAAGG + Intronic
1122940637 14:104979490-104979512 TGGTGCCCAAGCTAGATCCCAGG - Intergenic
1124454709 15:29831098-29831120 TGGTTCCCAAGTTTTATCCAGGG - Intronic
1125841780 15:42808438-42808460 TGCTTCCCTAGCTACATCAAAGG - Intronic
1126817233 15:52466064-52466086 TGCTCCGCATGTTAGATCTAGGG - Intronic
1126867278 15:52950100-52950122 TGTTTCCCCAGTTAGATGCATGG + Intergenic
1130886572 15:88097900-88097922 TATTTCCCAAGTTAGTTTCATGG + Intronic
1132069981 15:98767866-98767888 TACCTCCCAAGTCAGATCCCTGG + Intronic
1132567182 16:628898-628920 TGCTTCCCAAGGTGGTCCCACGG + Exonic
1142138712 16:88463113-88463135 CACTTCCCAAGTCAGACCCAGGG + Intronic
1144496092 17:15746245-15746267 TCCTTTCCAAGTTGGATGCAGGG + Intronic
1144605775 17:16664276-16664298 TCCTTTCCAAGTTGGATGCAGGG + Intergenic
1152962056 18:85971-85993 TCCCTGCCAAGTAAGATCCAGGG - Intergenic
1153481781 18:5554545-5554567 TGCTGCCTAAATTAGTTCCATGG - Intronic
1154098734 18:11447670-11447692 TTCTCCCCAAGTTAGTTCCAGGG - Intergenic
1156084323 18:33380507-33380529 CTCTTTCCAAGTTAGCTCCAGGG + Intronic
1158098502 18:53803099-53803121 TGCTTGCCAAGCTAGATAAAAGG - Intergenic
1162199217 19:9008962-9008984 TGCTTCTCAGGCTAGATCCGGGG + Intergenic
1167051774 19:47083760-47083782 TTCTTCCCAAGACAGATGCAGGG + Intronic
1167644327 19:50697462-50697484 TCCTTCTCAAGTTTGATCCAGGG - Intronic
1168131982 19:54327091-54327113 TGTTCCCTAAGTCAGATCCAGGG + Intergenic
925701705 2:6645576-6645598 TGCTTCCTGAGTTAGCTGCAGGG + Intergenic
926966834 2:18424280-18424302 TTCTTCCCAAGTTAGTTGTAAGG + Intergenic
927139794 2:20122018-20122040 TACTTCCCAAGTTTGAGCAAGGG - Intergenic
927399042 2:22689493-22689515 TGCTTCCAAACTCAGAGCCAAGG - Intergenic
927716411 2:25356105-25356127 TCCTTCCCCAGATGGATCCAGGG - Intergenic
927760249 2:25746273-25746295 TAATTCCGAAGTTAGAGCCATGG + Intronic
929367990 2:41184286-41184308 TGCTTCCCATGTTATAGCCTGGG - Intergenic
930344944 2:50168388-50168410 TGCTTCCCAAGTTTCAGCCAAGG - Intronic
930530300 2:52580946-52580968 CTCTCCCCAAGTTAGCTCCAGGG + Intergenic
932098564 2:68874781-68874803 TGCTTCTGAAGTGGGATCCAAGG - Intergenic
935540150 2:104338987-104339009 TGCTTCCCAAGTTAGGTCTTTGG + Intergenic
937823075 2:126334126-126334148 ACCCTCCCAAGTTAGCTCCAGGG - Intergenic
939726145 2:145723733-145723755 GGCTTCCCATGTTAAATCCTAGG + Intergenic
946364483 2:219240227-219240249 TGCTGCCCAAGATATATCCATGG - Exonic
1169671384 20:8106425-8106447 CTCTCCCCAAGTTAGCTCCAGGG + Intergenic
1170669979 20:18423550-18423572 TGTTTTCCAAGTTAGATGCTGGG + Intronic
1173409223 20:42794776-42794798 TGCCTCCCAAGTTACCACCAAGG - Intronic
1173438965 20:43058161-43058183 TGCCTCTCAACTTAGATCCCTGG + Intronic
1174863130 20:54111228-54111250 TGAGTCCCAAGCTAGAGCCAGGG - Intergenic
1174863336 20:54112786-54112808 TGAGTCCCAAGCTAGAGCCAGGG - Intergenic
1174940202 20:54918601-54918623 TCCTTCCAAAGTTAGAACAAGGG + Intergenic
1176003360 20:62844972-62844994 TGGTTCAGAAGTTAAATCCATGG - Intronic
1176022123 20:62967251-62967273 TGGTTCCCAAGGTAGTGCCAGGG - Intronic
1178775691 21:35548268-35548290 TTTTTCCCAAGTCTGATCCATGG - Intronic
1179092228 21:38277274-38277296 TGATTCTCAAGTTAAATCCTTGG + Intronic
1183230130 22:36576936-36576958 TACTCCCCAAGTTAGCTCCCTGG - Intronic
1184441706 22:44520947-44520969 TTCTTCCCAAATTAGATTCGAGG - Intergenic
949231513 3:1756320-1756342 TAGCTCCCAAGTTAGCTCCAAGG + Intergenic
951777516 3:26325933-26325955 TTCTCCCCAAGTTAGCTCCAGGG - Intergenic
953436687 3:42882748-42882770 AGCTTCCCTAGTTAGAAACATGG - Intronic
957400290 3:79703001-79703023 TGCTTCTTAACTTATATCCAAGG - Intronic
958497669 3:94865051-94865073 CTCTTCCCAAGTTAGCTCTAAGG + Intergenic
958547013 3:95567121-95567143 TACTCCTCAAGTTACATCCAGGG - Intergenic
958771642 3:98433159-98433181 TGCTTTCTACGTTAGATCCAAGG - Intergenic
959739170 3:109695883-109695905 CTCTTCCCAAGTTAGCTCCAGGG + Intergenic
962442019 3:135429241-135429263 TGCTCCCCAAGTCAGATTCAGGG - Intergenic
963776089 3:149442482-149442504 TGCTTCCAAAGAAATATCCATGG - Intergenic
964062312 3:152538751-152538773 TGCTCTCCAAGTCAGATACAGGG - Intergenic
965709970 3:171547524-171547546 TGGTTCCCAAGTTATACCCGGGG + Intergenic
967438181 3:189475811-189475833 TGCTTCCCAAGGTTGGTCAAAGG + Intergenic
969881498 4:10177940-10177962 TGCCTCTCATATTAGATCCATGG - Intergenic
971820044 4:31539933-31539955 TCCTTCCCATGTTAGATCCAAGG + Intergenic
971841732 4:31861673-31861695 TGCTCACCAAGTCAGATCCAGGG - Intergenic
972976346 4:44641017-44641039 TGCTTTCTAAGTTAGATCTAGGG + Intronic
975630302 4:76394814-76394836 TACTTTCCAGGTTGGATCCATGG - Intronic
981447462 4:144856538-144856560 CTCTCCCCAAGTTAGCTCCAGGG - Intergenic
981739342 4:147985788-147985810 TTTTCCCCAAGTTAGCTCCAAGG + Intronic
982268284 4:153560267-153560289 TGCTTCCCAGGTGAGGTGCAGGG - Intronic
984171900 4:176369088-176369110 CGCTCCCCAAGTTAACTCCAGGG + Intergenic
986512358 5:8521586-8521608 TTCTTCCCAACTGAGATCCAGGG + Intergenic
986557490 5:9026064-9026086 ATCTCCCCAAGTTAGCTCCAGGG + Intergenic
986931379 5:12826828-12826850 TGCTGCCCAAGTTATTTGCATGG + Intergenic
989427233 5:41310621-41310643 TGCTTCCCCAGTGTGCTCCAGGG + Exonic
989456635 5:41651466-41651488 TGCTTCCCAAATTTGACTCATGG - Intergenic
990187073 5:53220777-53220799 TCCTTCCCACGATGGATCCAGGG + Intergenic
991254625 5:64600602-64600624 TTGTTCCCCAGATAGATCCAAGG - Intronic
993315895 5:86405851-86405873 TGCTTCCCAATTTAAAACTAGGG - Intergenic
995639244 5:114234798-114234820 TGCTCCCTAAGTCAGTTCCAGGG - Intergenic
995811817 5:116115197-116115219 TGCTTCCCAAGTCAAATTCAAGG + Intronic
1002551423 5:179995640-179995662 TACTCCCTAAGTAAGATCCAGGG + Intronic
1003012779 6:2441463-2441485 TGTTTCCCAAACGAGATCCAGGG - Intergenic
1004026410 6:11823504-11823526 TTGTTCCCAAGTTATATACAGGG - Intergenic
1005676563 6:28161547-28161569 TGCTTCCTGAGTTTTATCCAGGG - Intergenic
1008248829 6:49212001-49212023 CTCTCCCCAAGTTAGCTCCAGGG - Intergenic
1010411129 6:75562968-75562990 CTCTCCCCAAGTTAGCTCCAGGG - Intergenic
1011295738 6:85825312-85825334 TGCTTCCTAACTTAGATTCAGGG + Intergenic
1012676225 6:102116036-102116058 TCCCTCCCAAGTTAGCTCCAGGG + Intergenic
1014232951 6:118924787-118924809 GGCTTCCCAAGTGTGAGCCACGG - Intronic
1015289415 6:131521016-131521038 CTCTCCCCAAGTGAGATCCAGGG + Intergenic
1015350419 6:132211016-132211038 CTCTCCCCAAGTTAGCTCCAGGG + Intergenic
1017726166 6:157277335-157277357 AGCTTCCCAGGTTAGAACAAAGG - Intergenic
1020399778 7:7762275-7762297 TACTTCCCAAGTTAGAAGCTGGG - Intronic
1020982585 7:15089865-15089887 TGTTTCCCAAGGTAGAGACATGG - Intergenic
1024490360 7:49975379-49975401 TGCTCCCCAAGTCAGATTCAGGG + Intronic
1026489777 7:70852699-70852721 TTCTTCCAAAGTTGGAGCCAGGG + Intergenic
1028304430 7:89245937-89245959 CTCTCCCCAAGTTAGCTCCATGG - Intronic
1030407513 7:109133033-109133055 CTCTTCCCAAGTTAGTGCCAGGG - Intergenic
1031842419 7:126760105-126760127 TGCATCCCAGTTTAGACCCAAGG + Intronic
1031904520 7:127446299-127446321 CTCTCCCCAAGTTAGCTCCAGGG - Intergenic
1032708821 7:134444899-134444921 TTCTTCCAGAGTTTGATCCAGGG + Intronic
1036684169 8:10898173-10898195 TGTTTTCCAAGTGAGACCCATGG - Exonic
1038056473 8:23863061-23863083 AGCTCCCAAAGTTAGTTCCAAGG - Intergenic
1038585755 8:28787691-28787713 TGCCTCCCAAGTCAGACACAGGG - Intronic
1040496590 8:47970964-47970986 ATCTCCCCAAGTTAGAACCAAGG - Intronic
1042109548 8:65366705-65366727 CTCTCCCCAAGTTAGCTCCAGGG - Intergenic
1042469418 8:69166925-69166947 TGATTTCCAGTTTAGATCCATGG - Intergenic
1043034246 8:75177293-75177315 CTCTCCCCAAGTTAGCTCCAGGG - Intergenic
1043720467 8:83543170-83543192 TGCTCCCCAAGTTAGCTCCAGGG - Intergenic
1045094509 8:98784089-98784111 TTGTCCCCAAGTTAGATCCAGGG - Intronic
1045418279 8:101988714-101988736 TGCTTACCAAGTCAGCTTCAGGG + Intronic
1048164341 8:132049011-132049033 TGCTCCCCAAGATAATTCCATGG + Intronic
1049984309 9:933993-934015 TGCATCACAGGTTAGGTCCAAGG - Intronic
1050402092 9:5266755-5266777 TGCTCCCAAAGTCATATCCAGGG + Intergenic
1050687618 9:8189906-8189928 CTCTTCCCAAATTAGCTCCAGGG - Intergenic
1051920460 9:22258153-22258175 CTCTTCCCAAGTTAGCTCCAGGG + Intergenic
1060314910 9:122500234-122500256 TTCTCCCCAAGTTAACTCCAGGG + Intergenic
1060906202 9:127308272-127308294 TATTTCCCCAGTTAGATTCAGGG - Intronic
1062736086 9:138138146-138138168 TCCCTGCCAAGTAAGATCCAGGG + Intergenic
1186711688 X:12204492-12204514 AGCTTCCCAATTCAGAACCAAGG + Intronic
1190702753 X:53000427-53000449 TGCTTCCCAAGTCACAGGCAGGG - Intergenic
1192059830 X:67812605-67812627 TGCTCCCCAAATTGGATCCAGGG - Intergenic
1193418083 X:81248780-81248802 CTCTTCCCATGTTAGCTCCAGGG + Intronic
1196613596 X:117742451-117742473 CTCTCCCCAAGTTAGCTCCAGGG - Intergenic
1198975621 X:142332808-142332830 TCTCTCCCAAGTTAGCTCCATGG - Intergenic