ID: 906848925

View in Genome Browser
Species Human (GRCh38)
Location 1:49226615-49226637
Sequence AGTATTATTGAAGGACAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906848925_906848927 3 Left 906848925 1:49226615-49226637 CCTGCTTGTCCTTCAATAATACT 0: 1
1: 0
2: 0
3: 16
4: 185
Right 906848927 1:49226641-49226663 GCTTTCACTGCCTCTGTGAATGG 0: 1
1: 0
2: 2
3: 27
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906848925 Original CRISPR AGTATTATTGAAGGACAAGC AGG (reversed) Intronic
901396139 1:8983198-8983220 AGTATTTTGGGAGGCCAAGCTGG + Intergenic
902327295 1:15709927-15709949 AGTATAATTCTAGTACAAGCCGG + Intronic
902344249 1:15804305-15804327 AGTAGTAATGAAAGACAAGAGGG - Intergenic
903308748 1:22435295-22435317 AATATTAGTGAAGGATAAGCTGG - Intergenic
906260474 1:44384509-44384531 ATTATACTTGAAGGACAATCTGG + Intergenic
906717393 1:47980259-47980281 AGCTGTATTGAAGGACAAGTGGG - Intronic
906848925 1:49226615-49226637 AGTATTATTGAAGGACAAGCAGG - Intronic
906983366 1:50655943-50655965 GGTTTTATTGAAGGGCAAGGGGG + Intronic
907177472 1:52538413-52538435 AGCACTTTTGGAGGACAAGCTGG + Intronic
911772376 1:101762656-101762678 ACTATTATTCAAGGAAAAGTTGG - Intergenic
912708941 1:111936115-111936137 AGTATTATTGAAATACATACAGG - Intronic
913012378 1:114697105-114697127 GGAATTACTGAAGGAGAAGCAGG - Intergenic
914227628 1:145734361-145734383 AGCATTTTGGAAAGACAAGCTGG - Intronic
917546098 1:175969546-175969568 AGTATGATTGGAGGACAAAGGGG - Intronic
918268557 1:182872051-182872073 AGTATTTTTGGAGGTCAAGGCGG - Intronic
920165202 1:204030993-204031015 AGTATTTCTGAAGGACAATTTGG - Intergenic
920644843 1:207793780-207793802 AGTGTTATTTAAGGGAAAGCAGG - Exonic
921128499 1:212198783-212198805 AATACTGTTGAAGGACAAGCTGG - Intergenic
921740284 1:218676958-218676980 AATATTTTGGAAGGTCAAGCAGG - Intergenic
924026289 1:239836502-239836524 AGTGTTATTAAAGGACAGGAGGG - Intronic
924189015 1:241529341-241529363 ATTATTAATGAAGGACAAGGTGG + Intergenic
1063040209 10:2330021-2330043 AATATTATTGAAGGTCCAGAAGG + Intergenic
1063589542 10:7382827-7382849 AGTCTTATTAGAAGACAAGCGGG - Intronic
1064457487 10:15501642-15501664 TGTATTCTGGAAGGACAAACTGG - Intergenic
1068448002 10:57147603-57147625 ATTATTATTTAAGTACAAGAAGG + Intergenic
1068710623 10:60129502-60129524 AGCACTTTGGAAGGACAAGCTGG + Intronic
1069109957 10:64435063-64435085 AGTATGATTGGAGGACAAAAGGG + Intergenic
1069619586 10:69828530-69828552 AGTTTTACTGAAAGAAAAGCAGG - Intronic
1070763923 10:79045594-79045616 AGTACTCTGGAAGGAGAAGCAGG + Intergenic
1072272198 10:93787446-93787468 AGTATTTTTGCATGACAAGATGG - Intronic
1077331575 11:1986292-1986314 AGTATTTTAGAAGGCCAAGGTGG - Intergenic
1078034204 11:7785671-7785693 AGCATTTTGGGAGGACAAGCTGG + Intergenic
1078305468 11:10180585-10180607 ATTAATATTGAAGTACAAGAAGG - Intronic
1078602520 11:12746454-12746476 AATATTATTTTAGGACAAGACGG - Intronic
1079810506 11:24993672-24993694 AGTATTATTGATGTAAAAACTGG - Intronic
1080220193 11:29894107-29894129 AGTATGCTTAAAGGACAACCAGG - Intergenic
1080498169 11:32842471-32842493 AGCATTTTGGAAGGCCAAGCCGG + Intronic
1082007371 11:47426815-47426837 ACAATTATTTAAGTACAAGCTGG + Intergenic
1082743651 11:56938995-56939017 AGTATTTTGGGAGGACAAGGTGG - Intergenic
1087217568 11:95510585-95510607 AGTATAATTGAAGAACAAAAAGG - Intergenic
1087885107 11:103471287-103471309 AGTATGATTACAGGACAAGGAGG - Intronic
1088631508 11:111778227-111778249 AGTATTCCTGAAGGGCAAGTCGG + Intergenic
1089958392 11:122593944-122593966 TGTATAAATGAATGACAAGCAGG + Intergenic
1090316594 11:125796178-125796200 ATTAATATTGAAGTACAAGAAGG - Intergenic
1090492255 11:127175177-127175199 GCTTTTAATGAAGGACAAGCAGG + Intergenic
1202814556 11_KI270721v1_random:41468-41490 AGTATTTTAGAAGGCCAAGGTGG - Intergenic
1092989889 12:13886524-13886546 AGGAGTATTGATGAACAAGCAGG + Intronic
1093012084 12:14118007-14118029 AGTATTTTGGGAGGCCAAGCAGG + Intergenic
1093057785 12:14571897-14571919 AGCATTTTTGAAGGCCAAGGTGG - Intergenic
1093674009 12:21913150-21913172 AGTATTTTTGAAGTATAAGAAGG - Intronic
1095588977 12:43882210-43882232 AATATTATGGAAGGCCAAGGCGG + Intronic
1098897868 12:76084129-76084151 ATTATTTTTGAGGGAAAAGCAGG + Intronic
1099152940 12:79138018-79138040 AGTATTATTGAATGACGTGATGG - Intronic
1101316823 12:103636426-103636448 TGTATTATTTAGGGACAAGCAGG - Intronic
1103838636 12:123844885-123844907 AGCATTATGGGAGGCCAAGCTGG - Intronic
1104299952 12:127555683-127555705 ATTAATAGTGAAGGAAAAGCAGG - Intergenic
1104421681 12:128641244-128641266 AGTGTTATTGAGGGAGATGCTGG - Intronic
1105689131 13:22818279-22818301 AGTCTTATTGAAGTAAAAGTGGG - Intergenic
1106741106 13:32642696-32642718 AGTATGACTGAAGGAAAAGGTGG - Intronic
1106978832 13:35253651-35253673 AGTTTTATTGAAATACAGGCAGG + Intronic
1112843631 13:103610733-103610755 AGACTTATTGAAGGACTTGCAGG + Intergenic
1112928828 13:104710981-104711003 AGTATTATACAACCACAAGCTGG - Intergenic
1113451914 13:110416370-110416392 AGTCTTCTTAGAGGACAAGCAGG + Intronic
1113609541 13:111633680-111633702 AGTATTTTTGGAGGACAATTGGG - Intronic
1114858723 14:26488361-26488383 AGAATGAATGAACGACAAGCTGG - Intronic
1115930311 14:38483784-38483806 ATTAATATTCAAGCACAAGCAGG + Intergenic
1121670284 14:95704565-95704587 AGTATTTTTAAAGGAAAGGCTGG + Intergenic
1121933885 14:97998582-97998604 AGTATTATGGGTAGACAAGCAGG + Intergenic
1123896621 15:24836815-24836837 AGTATGATTGGAGGACAAAAGGG + Intronic
1124183006 15:27496022-27496044 AGTATCACTGAAGGCCAAGTAGG - Intronic
1124704841 15:31954958-31954980 AGGATTAGGGCAGGACAAGCTGG + Intergenic
1127186242 15:56483872-56483894 AGTATTTTAGAAGTACAGGCCGG + Intergenic
1127958358 15:63872213-63872235 AGGATGACTGAAGGACAGGCTGG + Intergenic
1130769862 15:86913614-86913636 AGAATTATGGGAGGCCAAGCTGG + Intronic
1133851269 16:9506022-9506044 AGTCTCATTGAAGAACAAGATGG - Intergenic
1135398542 16:22149490-22149512 AGTACTTTGGAAGGCCAAGCTGG - Intronic
1135599651 16:23771366-23771388 ATTATTATTGAATAATAAGCAGG - Intergenic
1135699565 16:24620182-24620204 ATGATAATTCAAGGACAAGCAGG - Intergenic
1138229853 16:55328919-55328941 AGGGTCATTGAAGGAGAAGCGGG - Exonic
1138467522 16:57202602-57202624 AGTATGATGCAAGGACCAGCTGG - Intronic
1142722718 17:1787483-1787505 AGTGCTAATGAAGGACACGCTGG + Exonic
1144195748 17:12893316-12893338 AGTATTAGTGAAAGCCAAGTAGG - Intronic
1145757940 17:27406428-27406450 AGTATTTTGGGAGGCCAAGCTGG + Intergenic
1148232904 17:45948251-45948273 AGTATTTTGGAAGGCCAAGGTGG - Intronic
1148242242 17:46007948-46007970 TGTATTATTGAAGTACAAAGTGG + Intronic
1152044024 17:77924140-77924162 AGCATTTTGGAAGGACAAGGTGG + Intergenic
1153097054 18:1419094-1419116 AGTAGACTAGAAGGACAAGCTGG - Intergenic
1156181552 18:34611505-34611527 TGTATTCTTGAAGGACATGGGGG + Intronic
1157554093 18:48601539-48601561 AATATTATTGAATGACAGCCTGG + Intronic
1157892665 18:51432871-51432893 AATATTTTTAAAGGACAAGGTGG + Intergenic
1159642215 18:70876740-70876762 ATGATTATAGAAAGACAAGCTGG - Intergenic
1160366487 18:78330429-78330451 AGCTTTATGGAAGTACAAGCGGG + Intergenic
1166324013 19:42038134-42038156 GGTTCTATTGGAGGACAAGCTGG + Intronic
1167008414 19:46790097-46790119 ATTATTACTGAAGAACAAGCTGG + Intergenic
928832645 2:35506500-35506522 AGTATTTTGGAAGGAGAAGTTGG - Intergenic
929273415 2:39999416-39999438 AATATTATTGAAGGTGAGGCAGG + Intergenic
930041306 2:47127025-47127047 AGAAATATTGAAGTACAAGAAGG - Intronic
930248099 2:49005305-49005327 AGTGTTCTGGAAGGAAAAGCTGG + Intronic
931182686 2:59918732-59918754 AGTATTATTGCATGAAAAGTTGG + Intergenic
932592992 2:73078387-73078409 AGTATTATTAGAGGTCATGCTGG + Intronic
933150932 2:78914099-78914121 AGTATTATTGAGGGAACAGGGGG + Intergenic
935530616 2:104228630-104228652 AGTATTTTTGAAGTTCAGGCTGG + Intergenic
936880716 2:117247339-117247361 AGCATTATTCAAGGAAAAGTAGG + Intergenic
940531113 2:154877443-154877465 ATTATTATTCAAGGATAAGTAGG - Intergenic
941861971 2:170292041-170292063 AGAATTATTGATGTACAAGAGGG - Intronic
947091057 2:226511930-226511952 ATTATTATTGCAGGACAATAAGG - Intergenic
947671425 2:231938912-231938934 AATCTTATGGAAGGACCAGCTGG + Intergenic
1170754318 20:19185560-19185582 AGCATTACTGAAGGACATGTTGG + Intergenic
1172068701 20:32240299-32240321 AACATTATTTAAGGGCAAGCAGG + Intergenic
1172902500 20:38345250-38345272 AGTATTTTGGAAGGCCAAGCGGG + Intergenic
1173363769 20:42367188-42367210 AATATTATTGAAGGTCACCCAGG - Intronic
1174889979 20:54381415-54381437 AGTTTTATTGAAAGACAGCCAGG + Intergenic
1175370459 20:58485293-58485315 AGTATTTTTGGAGGACAATTTGG - Intronic
1179084516 21:38205748-38205770 TGTATTAATGATTGACAAGCAGG + Intronic
1182542193 22:31049779-31049801 AGTATTTTGGAAGGCCAAGGTGG - Intergenic
950085442 3:10254321-10254343 AGTCTTACTGATGGACAAGGAGG + Intronic
951482869 3:23180127-23180149 AGTATTATTGAGGGGTAAGGGGG - Intergenic
951679492 3:25280173-25280195 AATATGATTGGAGGACAAGAGGG + Intronic
953322147 3:41982485-41982507 AGTATTTTTGGAGGCCAAGGTGG - Intergenic
953805975 3:46067548-46067570 AGTGTTATTCAAGGACACACAGG - Intergenic
955660396 3:61292745-61292767 AGGGTTATAGAAGGACAAGAAGG - Intergenic
955698147 3:61657122-61657144 AGTATGATTGGAGGACAAAGGGG + Intronic
956138629 3:66123707-66123729 AGTATAATTGGAGGACAAAAGGG - Intergenic
956247856 3:67204385-67204407 ATTAATATTGAGGGAAAAGCAGG + Intergenic
957392818 3:79600098-79600120 AATATGATTGAAGGTCAAGTGGG - Intronic
958955739 3:100464392-100464414 AGCATTTTGGGAGGACAAGCTGG - Intergenic
962560835 3:136604895-136604917 AGCATTTTTGAAGGCCAAGGTGG - Intronic
964464468 3:156975342-156975364 AGCATAATGGAAGAACAAGCAGG - Intronic
965846667 3:172970083-172970105 AGTATTATTGCAGCAGTAGCTGG + Intronic
965970953 3:174555631-174555653 AGTATGATTGGAGGACAAAAGGG + Intronic
966114614 3:176446881-176446903 ACCATTATTGAAGGACATGAAGG - Intergenic
967162400 3:186750557-186750579 AGTATTTTGGGAGGACAAGGTGG + Intergenic
967306605 3:188065798-188065820 AGTATTATTAAAGGCAAAGCTGG - Intergenic
970718484 4:18957283-18957305 AGTATTTATGAAGGCTAAGCTGG - Intergenic
971541060 4:27817374-27817396 ACCATTATTCAAGGATAAGCAGG + Intergenic
972297070 4:37749622-37749644 AGTTTTATTGAAAAACAACCAGG + Intergenic
976366126 4:84234356-84234378 AGTATTTTAGGAGGCCAAGCTGG + Intergenic
976559394 4:86484046-86484068 TGTATTATTAAAGCTCAAGCTGG + Intronic
980265736 4:130513121-130513143 AGTTTCATGTAAGGACAAGCTGG - Intergenic
982987972 4:162234076-162234098 AATATTATTGAAGGACATACAGG - Intergenic
985314807 4:188645949-188645971 AGTGTGATTGGAGGACAAACGGG + Intergenic
989649780 5:43674057-43674079 TGTATTATTAAAGGATAAGAGGG - Intronic
990124654 5:52499273-52499295 AGTATTATTGAGAGACAATAGGG - Intergenic
990727286 5:58770067-58770089 AGTATTATTAAAGAATAAGGAGG + Intronic
992211765 5:74486941-74486963 AGTATGAATGAAGGACAAATGGG - Intergenic
993316002 5:86407162-86407184 AGTATTCTTGGAGAACAAGAGGG - Intergenic
993927706 5:93891315-93891337 AGTATTATTGAGGGAGGAGGGGG - Intronic
994425604 5:99581449-99581471 AGTATGATTGGAGGACAAAAGGG - Intergenic
994435737 5:99730792-99730814 AGTATGATTGGAGGACAAAAGGG + Intergenic
994629927 5:102272706-102272728 AGTACTTTGGAAGGACAAGGTGG + Intronic
995278852 5:110309592-110309614 AGAATTATTGATGGTCAAGAGGG + Intronic
996658845 5:125974722-125974744 AGTATTATCAAAGAACAAGGAGG - Intergenic
996741646 5:126804505-126804527 AGTCTCACTCAAGGACAAGCAGG + Intronic
1001430367 5:171656688-171656710 GGGATTATTGAAGGGAAAGCAGG + Intergenic
1004151380 6:13123380-13123402 AGTATAAATGAAGGACAAGAAGG + Intronic
1007631655 6:43276176-43276198 AGTATTATTGCAGTACAAAATGG - Intronic
1009401236 6:63258689-63258711 AGTATTTCTGAATGACAACCAGG - Intergenic
1010542102 6:77104064-77104086 AGTATCATAGTTGGACAAGCTGG - Intergenic
1011710033 6:90043742-90043764 ATTATTCTTGAAGGATGAGCAGG - Intronic
1013753823 6:113437797-113437819 AGTATCATTGGAAGACAAGTAGG + Intergenic
1014046764 6:116897763-116897785 GGAAATATTGAAGGAGAAGCAGG + Intronic
1015322081 6:131887810-131887832 AGCATTTTGGAAGGACAAGGCGG - Intronic
1015824659 6:137298778-137298800 AGTATGATTAGAGGACAAGATGG - Intergenic
1016334252 6:142987242-142987264 AGTTTGATTGAAAGAGAAGCTGG - Intergenic
1016428555 6:143959205-143959227 AGTATGATTGCAAGGCAAGCAGG - Intronic
1016801005 6:148168927-148168949 AGTATGATTGGAGGACAAACGGG + Intergenic
1017336283 6:153264377-153264399 TGTGTTAATGAAGGAGAAGCAGG - Intergenic
1021291878 7:18855504-18855526 AGTGTTCTCAAAGGACAAGCAGG - Intronic
1023615405 7:42014675-42014697 AGTACTATCGATGTACAAGCAGG - Intronic
1023685373 7:42728854-42728876 AATATTAATCAAGGACAACCTGG - Intergenic
1026096865 7:67353420-67353442 AGTATTATTGGAGGAGGTGCAGG - Intergenic
1027560603 7:79724300-79724322 AGTATTATTGGAGGACAAAAGGG + Intergenic
1028619384 7:92807633-92807655 AGTACTAGTGAAGGGCAAGCAGG - Intronic
1030107936 7:106002373-106002395 AGTATGATTGGAGGACAAAAGGG + Intronic
1032362643 7:131270466-131270488 AGTATTTTGGGAGGCCAAGCCGG - Intronic
1033198674 7:139349628-139349650 AGTACTATTAAAGGAAAATCCGG - Intronic
1033400421 7:141017870-141017892 AGTGTTTTTGAAGGAGAATCTGG + Intergenic
1042939395 8:74092029-74092051 AGTATCATAGAAGGAAAATCAGG - Intergenic
1042961998 8:74313757-74313779 AGTGTTATTGAAGCAGAAACAGG + Intronic
1044168546 8:89019998-89020020 ATTATTATTGAAGGCAAAGCTGG + Intergenic
1044483136 8:92716568-92716590 AGGATTAAGGAAGGACAAGACGG - Intergenic
1046127035 8:109922634-109922656 AGTATTATTAAAAGACTAGCAGG - Intergenic
1047414025 8:124649156-124649178 AGTTTTATTGAAAGACAGCCAGG + Intronic
1047521807 8:125600717-125600739 AGAATTATTAAAGAACATGCTGG - Intergenic
1048546362 8:135391105-135391127 AGCATTATACAAGGACAAGTGGG - Intergenic
1051098000 9:13488698-13488720 GGTGTTATTGAAGCAGAAGCAGG + Intergenic
1051737591 9:20217509-20217531 AGGAATAATGAAGAACAAGCTGG + Intergenic
1052076538 9:24148418-24148440 CATATTATTGAAGGACATGAAGG - Intergenic
1052102851 9:24471478-24471500 AGAGTTATTGAAGAAAAAGCAGG + Intergenic
1055502601 9:76916493-76916515 AGTATAATTGAAGGACAAAAGGG - Intergenic
1055537284 9:77262124-77262146 AGTAATTTTAAATGACAAGCAGG - Intronic
1056148055 9:83754596-83754618 AGTATGTTTGAAGGCCATGCAGG + Intronic
1056675695 9:88675192-88675214 AGCATTGTGGAAGGCCAAGCTGG - Intergenic
1057113149 9:92493353-92493375 ATAATTATTGAAGAACAAGATGG + Intronic
1057765594 9:97915334-97915356 AGTAATATTTTAGGACATGCAGG + Intronic
1059275378 9:113092074-113092096 TACAATATTGAAGGACAAGCTGG - Intergenic
1059818383 9:117944332-117944354 GGTATTATGGAGGGACAAGAGGG + Intergenic
1186820995 X:13287775-13287797 AGTATTATTGGGGGACAAAAGGG + Intergenic
1188361465 X:29260013-29260035 AGAATTATTGAAGAAAATGCTGG - Intronic
1189507055 X:41622670-41622692 AGTATGATTTTAGAACAAGCAGG + Intronic
1194812939 X:98407853-98407875 AGTATGATTGAAGGACAAAAGGG - Intergenic
1201334925 Y:12870254-12870276 AGCACTTTTGAAGGCCAAGCAGG - Intergenic