ID: 906850933

View in Genome Browser
Species Human (GRCh38)
Location 1:49250062-49250084
Sequence GAGGCCAGTAAGGAAGTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 304}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906850933 Original CRISPR GAGGCCAGTAAGGAAGTTGG AGG Intronic
900395155 1:2450507-2450529 GGGGCCAGGCAGGGAGTTGGGGG - Intronic
904024304 1:27492440-27492462 GAGGCCAAGAAGGGAGTGGGAGG + Intergenic
904764445 1:32833019-32833041 GATACCAGAAAGGAAGTTGTTGG - Intronic
905251085 1:36648916-36648938 GAGGCCAGTAAGGTGGTCAGAGG - Intergenic
905260718 1:36716227-36716249 GAGGACAGAAATGAGGTTGGAGG - Intergenic
905872876 1:41415161-41415183 GAGGCCTGGAAGGCAGTGGGAGG - Intergenic
906850933 1:49250062-49250084 GAGGCCAGTAAGGAAGTTGGAGG + Intronic
907458368 1:54590452-54590474 GAGGGCAGTCAGGAAGGAGGAGG + Intronic
907466364 1:54640401-54640423 GAGGCCAGAGAGGAAGAGGGAGG + Intergenic
909468323 1:75999669-75999691 AAGGCCAGTTAGGAAGTTATTGG - Intergenic
910993544 1:93079816-93079838 GAGGGCAGGAAGGAACCTGGGGG + Intronic
912490424 1:110059761-110059783 GAGGCCAGCAAGGAAGGGGAAGG - Intronic
912890716 1:113526705-113526727 GAGTCCAGTTAGGAAGCTGTTGG + Intronic
915737208 1:158092669-158092691 GATGCCAGCAAGGGGGTTGGGGG + Intronic
916577550 1:166081101-166081123 GTGGTCAGAAAGGAAGTGGGCGG - Intronic
918112887 1:181473188-181473210 GAGGTCAGTAAGGGAGTTCAGGG - Intronic
918386408 1:184012752-184012774 TAGGCCATTGAGGAACTTGGAGG + Intronic
920072291 1:203311150-203311172 GAGGTAAGAAATGAAGTTGGGGG - Intergenic
920908897 1:210195695-210195717 GAGGACAGTAAGGAAATCAGAGG - Intergenic
921731709 1:218586346-218586368 GTGGCCAGGAAGGAAGTTCCTGG - Intergenic
922174502 1:223186613-223186635 GATGGCAGTAAGAAAGATGGAGG + Intergenic
922468816 1:225862720-225862742 GAGGCCAGCAAGGAAGGAGGGGG + Intronic
922707145 1:227795643-227795665 GAGGGAAGGAAGGAGGTTGGGGG - Intergenic
923021345 1:230166694-230166716 GAAGAAAGCAAGGAAGTTGGGGG - Intronic
924017698 1:239745052-239745074 GAGGCAAGAAAGGGAGTGGGAGG + Intronic
924279050 1:242417763-242417785 GAGGCCAGTACGGGGGATGGTGG + Intronic
924398339 1:243649565-243649587 GGGGCCTGTCAGGGAGTTGGGGG - Intronic
924850025 1:247818707-247818729 GAGGGTAGTAAGGAGTTTGGAGG + Intergenic
1063760555 10:9070259-9070281 GGGGCCTGTCAGGGAGTTGGGGG - Intergenic
1065689165 10:28315509-28315531 GTGGCCAGGAGGGAAGTGGGAGG - Intronic
1068550922 10:58407133-58407155 GAGGTGAGGAAGGAAGTTAGGGG - Intergenic
1068683606 10:59846419-59846441 GAGGACAGGAAGGAAGTTGTGGG - Intronic
1069053818 10:63822762-63822784 GAGGCTAGTAAGGCAGTGAGGGG + Intergenic
1069387048 10:67893299-67893321 GAGGCCTGTCAGGAGGTGGGGGG - Intronic
1069943266 10:71969659-71969681 GTGACCAGGACGGAAGTTGGGGG + Intronic
1071202621 10:83237065-83237087 GATGCCAGTAAGGAAGTGATTGG + Intergenic
1071240699 10:83701565-83701587 GAGGCCAGTGAGGACCTTGAGGG - Intergenic
1071617783 10:87092839-87092861 AAGGCAAATAAGGATGTTGGAGG - Intronic
1071975320 10:90949463-90949485 GGGGCCAGTCAGGGGGTTGGGGG - Intergenic
1072178994 10:92961355-92961377 AAGACCAGAAAAGAAGTTGGTGG - Intronic
1072546407 10:96442746-96442768 GAGGACAGGAAGGAAGACGGCGG - Intronic
1073068133 10:100776166-100776188 GAGGAAAGTATGGAAGGTGGAGG - Intronic
1074103368 10:110371216-110371238 GGGGCCTGTCAGGAGGTTGGGGG + Intergenic
1074271450 10:111957661-111957683 GGGGCTAGTCAGGACGTTGGGGG - Intergenic
1074807144 10:117065145-117065167 GGGGCCTGTAGGGAGGTTGGGGG + Intronic
1078471336 11:11589224-11589246 CAGACCAGTGAGGAAGTGGGGGG + Intronic
1078933370 11:15930191-15930213 GAGCCCAGGGATGAAGTTGGAGG + Intergenic
1078968477 11:16376017-16376039 GGGGCCTGTCAGGGAGTTGGGGG + Intronic
1079019624 11:16898763-16898785 GAGGCCAGTTAGGAGGGTGTTGG - Intronic
1080211602 11:29793049-29793071 AAATCCAGTAAGGAGGTTGGGGG + Intergenic
1080877660 11:36291166-36291188 CAGGTCAGTAATGAAGTTGTTGG - Intergenic
1082679144 11:56147041-56147063 GAGGCCAGAAAGGAAGAGTGAGG - Intergenic
1082965609 11:58963781-58963803 GAGGCCAGGAAGAAAAGTGGCGG - Intronic
1083351610 11:62033464-62033486 GAGGCTGGAAAGGAAGTTAGGGG - Intergenic
1084095615 11:66909198-66909220 AAGGCGAGTACGGGAGTTGGTGG - Intronic
1084115827 11:67042531-67042553 AACGCCAGTAAGGAAGCAGGAGG + Intronic
1085201645 11:74705689-74705711 GAGGACAGGAAGGAAAGTGGAGG + Intronic
1085201752 11:74706220-74706242 GAGGAAAGTGAGGAAGTTTGGGG + Intronic
1086763499 11:90664667-90664689 GGGGCCAGTCAGGAGGTGGGGGG - Intergenic
1090257731 11:125297642-125297664 GAGGCTGGTGAGGAAGGTGGAGG - Intronic
1091356593 11:134942284-134942306 GAGGCCAGGGAGGCAGTGGGAGG - Intergenic
1095965262 12:47863240-47863262 GGGGTCAGAAAGCAAGTTGGTGG - Intronic
1096030855 12:48413450-48413472 GAGGCCACTGAGGAGGTTGGAGG + Intergenic
1097941719 12:65316129-65316151 GGGGCCAGAAAGCAAGTTGGTGG - Intronic
1098182629 12:67864062-67864084 GAGGCCAGTCAGGGGGTCGGGGG - Intergenic
1099974311 12:89530356-89530378 GAAGTCAGAAAGCAAGTTGGTGG - Intergenic
1101102268 12:101406323-101406345 GGGGCCAGTAAGGAGGATAGTGG + Intronic
1102052180 12:109870776-109870798 GAGTGAAGTAAGGAACTTGGAGG + Intronic
1103464222 12:121129006-121129028 GAGGAAAGAAAGGAAGATGGCGG - Intergenic
1103742738 12:123102274-123102296 GGAGACAGTAAGGAAGCTGGAGG - Intronic
1104542353 12:129677781-129677803 GAAGCCAGTAAGGAGGATGAAGG - Intronic
1106315873 13:28592773-28592795 GAGGTCAAGAAGGCAGTTGGAGG - Intergenic
1107410344 13:40152346-40152368 GAGGGCAGTCAGGAAGGAGGAGG + Intergenic
1108963024 13:56260699-56260721 GAGGCTGGAAATGAAGTTGGCGG - Intergenic
1110774058 13:79385962-79385984 GAGGCCAGTACGGATGCTGGGGG - Intronic
1113060178 13:106314264-106314286 GAGGCCAACAAAGAATTTGGGGG + Intergenic
1113631937 13:111893940-111893962 AAGGCCAGGGAGGCAGTTGGGGG + Intergenic
1114561124 14:23591308-23591330 GAGGCCAGGAAGGGGGTGGGGGG - Intergenic
1116738869 14:48729840-48729862 GAGGCCAGTTATGAAGTCTGGGG - Intergenic
1116759197 14:48989875-48989897 AAGGCCACAAAGGAAGTTTGAGG + Intergenic
1117213911 14:53530045-53530067 GAGGCCAGAAAGGGGGTTGGGGG - Intergenic
1117464096 14:55975154-55975176 GATGGCAGTAAGGAAGTTTCAGG + Intergenic
1117464312 14:55976718-55976740 AAAGCCAGAAAGGAGGTTGGGGG - Intergenic
1118063858 14:62169108-62169130 GAGGATAGTAAGGAAGCAGGAGG + Intergenic
1118658049 14:67975255-67975277 GAAGCCAGCAAAGAAGATGGTGG - Intronic
1119472975 14:74910779-74910801 GAGGCCAGTCAGGCTGTTGTGGG - Intronic
1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG + Intronic
1120584769 14:86298697-86298719 GAGCACAGTAACGGAGTTGGGGG + Intergenic
1121191425 14:92034120-92034142 GAGGCTAGAAAGGGAGCTGGAGG + Intronic
1121584956 14:95056969-95056991 GAGGGAAGGAAGGAAGCTGGAGG - Intergenic
1121960646 14:98256345-98256367 GAGCCCATTCAGTAAGTTGGGGG - Intergenic
1124242100 15:28037263-28037285 GAGGGCAGGAAGGCAGCTGGTGG + Intronic
1124501508 15:30231472-30231494 GGGGCCTGTAGGGAAGTGGGGGG - Intergenic
1124742058 15:32307195-32307217 GGGGCCTGTAGGGAAGTGGGGGG + Intergenic
1124943504 15:34240825-34240847 GAGGCCTGTGAAGAGGTTGGTGG + Exonic
1126065707 15:44824796-44824818 GAGGCCTGTTGGGGAGTTGGTGG + Intergenic
1126094128 15:45075771-45075793 GAGGCCTGTTGGGGAGTTGGTGG - Exonic
1127353545 15:58176015-58176037 GAAGCCACGCAGGAAGTTGGAGG - Intronic
1128028786 15:64461194-64461216 GGGGCCAGTCAGGGAGTTGGCGG + Intronic
1128067140 15:64772408-64772430 GAGGGCAGTAAGGAATTAAGGGG - Intronic
1128353220 15:66905893-66905915 GAGGCCAGATAGTGAGTTGGGGG + Intergenic
1129168375 15:73792620-73792642 GTGGCCAGGGAGGCAGTTGGTGG + Intergenic
1129899569 15:79136087-79136109 GAAGGAAGTTAGGAAGTTGGAGG - Intergenic
1130761136 15:86821164-86821186 GAGGCCTGTCAGGAGATTGGGGG + Intronic
1130896529 15:88174432-88174454 GAGGCCAGGAGGGAAGATGCTGG - Intronic
1131511424 15:93051411-93051433 GAGGCCAGGAAGGAAGCTGGTGG - Intronic
1132169460 15:99634220-99634242 GCAGCCTGTAAGGAAGTTGGTGG + Intronic
1132196730 15:99919240-99919262 GAGGCAGGCAAGGAAGTAGGAGG - Intergenic
1133570365 16:7034447-7034469 GAGCCCAGCAAGGAAGAAGGGGG - Intronic
1134180798 16:12046176-12046198 GGGACCAGTGAGGAAGTTGTAGG + Intronic
1134812161 16:17177002-17177024 GAGGCCAGAGAGGCAGGTGGGGG - Intronic
1135189292 16:20341793-20341815 GAGGCCAGGACGCAAGTTGTAGG - Intronic
1136396331 16:29994508-29994530 GAGGACAGCAAAGAAGGTGGAGG - Exonic
1137828636 16:51522756-51522778 GGGGCCTGTCAGGGAGTTGGGGG + Intergenic
1138313341 16:56047034-56047056 GAGGCCAGGAAGGCAGTGGGAGG + Intergenic
1138475812 16:57270212-57270234 GGGGCCAGTAAAGGACTTGGGGG - Intronic
1138500651 16:57441226-57441248 GAGGCAAGTAAGAAGGTTGGAGG + Intronic
1139643365 16:68309821-68309843 GAGAGCAGTAAGGAATTTGAGGG - Intronic
1139694960 16:68667414-68667436 GAGATCAGTAGGGAAATTGGTGG + Intronic
1140242966 16:73220193-73220215 GAGGACAGGAAGGGAGTAGGGGG + Intergenic
1141609967 16:85175683-85175705 AAGGCCAGCCAGGATGTTGGGGG + Intronic
1141762476 16:86037997-86038019 GAGGCCACTTAGGAATCTGGAGG + Intergenic
1141992289 16:87617533-87617555 GGGGCCAGAGAGGAAGCTGGGGG + Intronic
1142009855 16:87708409-87708431 GAGGACAGTGAGGAGGTTGAGGG - Exonic
1144625818 17:16844001-16844023 GAGAGAAGTAAGGAAGCTGGTGG - Intergenic
1144845965 17:18219246-18219268 AGGGTCAGTAAGGAAGTGGGAGG - Intergenic
1144880614 17:18428719-18428741 GAGAGAAGTAAGGAAGCTGGTGG + Intergenic
1144956473 17:19021311-19021333 GCGGGCAGTAGGGAAGGTGGAGG - Exonic
1145151622 17:20515668-20515690 GAGAGAAGTAAGGAAGCTGGTGG - Intergenic
1146162979 17:30569926-30569948 GAGAGAAGTAAGGAAGCTGGTGG - Intergenic
1146477996 17:33178586-33178608 GAGGTCAGGAAAGAAGATGGGGG + Intronic
1146943856 17:36861208-36861230 GAGGCCAATCAGGAGGCTGGTGG + Intergenic
1147579970 17:41622692-41622714 GAGAGAAGTAAGGAAGCTGGTGG - Intronic
1148749499 17:49936395-49936417 GAGGGCAGTGAGGAGGCTGGGGG - Intergenic
1150312095 17:64137102-64137124 GAGATCAGGAAGGAAGGTGGTGG + Intergenic
1150368904 17:64618577-64618599 GAGTCCAGTAGAGAAGGTGGTGG - Intronic
1151775420 17:76198059-76198081 GTGGCCAGAAAGGAAGGTGGGGG - Intronic
1154193008 18:12245933-12245955 AAGGGCAGGAAGGAGGTTGGTGG - Intergenic
1155723453 18:29049119-29049141 GAGGCCAGTCAAGGGGTTGGGGG - Intergenic
1156368075 18:36447914-36447936 GAGGGCAGTCAGGCAGCTGGAGG + Intronic
1156627478 18:38926480-38926502 GAGGCCTGTCAGGAAAGTGGGGG - Intergenic
1157941896 18:51938160-51938182 GGGGCCTGTCAGGAAGGTGGAGG - Intergenic
1158836812 18:61339479-61339501 GAAGGCTGGAAGGAAGTTGGTGG - Intronic
1159503707 18:69307013-69307035 GAGGCCTGTCAGGAAGTGGGGGG + Intergenic
1160275310 18:77427524-77427546 GAGGCCAGGAAGGGTGGTGGAGG - Intergenic
1160708911 19:541842-541864 GCGGCCAGTCCGGAAGCTGGGGG - Exonic
1160882116 19:1325617-1325639 GAGGCCAGGAAGGAATGCGGGGG + Intergenic
1160918344 19:1508195-1508217 GAGGCCTGGAGGGAAGATGGGGG + Intronic
1162959339 19:14117146-14117168 GAGGTGAGTGAGGAAGTGGGGGG + Intronic
1164462374 19:28459986-28460008 GAGCCCAGTGAGGAAGCTGTGGG + Intergenic
1165226704 19:34359996-34360018 GAGGCAAGTTAGGAAGTCCGGGG - Intronic
1165490288 19:36119469-36119491 GAGGCCAGGGAGGAAGCTGCCGG - Intronic
1166352659 19:42207438-42207460 GAGGCCATTGTGGAAGCTGGAGG - Intronic
1166643900 19:44516980-44517002 CAGGCCAGTGAGAGAGTTGGAGG + Exonic
1167045559 19:47046859-47046881 GAGGCCAGAGAGGATGTGGGGGG - Intronic
1168241481 19:55091274-55091296 GAGGCCAGGATGGAGGTGGGAGG - Exonic
926566304 2:14478595-14478617 GAGGTAAGCAAGGGAGTTGGAGG + Intergenic
927064151 2:19453461-19453483 GAGGCCGGTCAGGAGGTGGGGGG + Intergenic
928620068 2:33079752-33079774 GAAGCCAGAAAGGAGGTGGGAGG - Intronic
929001094 2:37347478-37347500 GGGGCTAGCAGGGAAGTTGGAGG + Intronic
929384121 2:41384168-41384190 GAGGCAAGCAAGGCAGTTTGGGG - Intergenic
929581702 2:43085530-43085552 GAGCCCAGGAAGGAACTTGCAGG - Intergenic
929681693 2:43998286-43998308 GAGGTCAGAGAGGTAGTTGGAGG + Intergenic
929794178 2:45046379-45046401 CAGGCCATTAAGGAATGTGGAGG + Intergenic
932048642 2:68376917-68376939 GAGGCCAGGAAGGGAAGTGGGGG - Intronic
932073945 2:68645868-68645890 GAGCACAGAAAGGAAGCTGGTGG - Exonic
932217007 2:69972931-69972953 GAGGCTACTGAGGAGGTTGGAGG - Intergenic
932619420 2:73257074-73257096 GAGGCCTGGAAGGGAGGTGGAGG - Exonic
933298929 2:80521192-80521214 GAGACCAGTTAGTAAGTTGAGGG + Intronic
934487421 2:94728795-94728817 GAGGTCACTCAGGAAGTTAGAGG - Intergenic
934725591 2:96616125-96616147 GATGCAAGTAAGGAAGGAGGAGG + Intronic
934854378 2:97719829-97719851 GAGGGCAGGACGGAATTTGGGGG - Intronic
936688512 2:114857774-114857796 GAGCCCATAAAGGAACTTGGAGG + Intronic
937028734 2:118720645-118720667 GAGCCCAGGAAGGAAGTAGAAGG - Intergenic
938815992 2:134904653-134904675 GAGTCAAGAAAGGAAGTTGGAGG + Intergenic
942492714 2:176506053-176506075 GAGGCAAGGAAGCATGTTGGGGG + Intergenic
944300399 2:198117872-198117894 GAGAACAGGAAGGAAGTTGCTGG - Intronic
944534597 2:200696609-200696631 GAGGCTGGAAAGGAAGGTGGAGG + Intergenic
945168012 2:206966846-206966868 AAAGGCAGTAAGGAAGTTGGGGG - Intronic
945752470 2:213804849-213804871 GAGGCCAGATAGGATGCTGGAGG + Intronic
947498987 2:230658761-230658783 GAGGCCTGGCAGGAAGCTGGTGG - Intergenic
947818142 2:233051814-233051836 GAGGCCAGAACGGAGGTTGGAGG + Intergenic
948796669 2:240406431-240406453 AAGTCCAGTAAGTATGTTGGAGG - Intergenic
1170289368 20:14751176-14751198 GAGGCCAGTAAGGAAGCCCAAGG - Intronic
1173876412 20:46375105-46375127 GATGACAGTTAGGAAGCTGGTGG - Intronic
1174117002 20:48233165-48233187 GGGGACAGAAAGGAAGTGGGAGG - Intergenic
1174768230 20:53273660-53273682 GAGGCCAGCAAGGAGGCTGTTGG + Intronic
1174842390 20:53912350-53912372 GAAGGCATTTAGGAAGTTGGTGG + Intergenic
1175724550 20:61308974-61308996 GAGGTCTGTCAGGAAGTGGGAGG - Intronic
1177186315 21:17801643-17801665 GGGGCCTGTCAGGAAGTAGGGGG + Intronic
1177414193 21:20772787-20772809 GAGGAGAGTAAGGAACTTGAGGG + Intergenic
1177893686 21:26836787-26836809 TAGGAAAGAAAGGAAGTTGGAGG + Exonic
1178214436 21:30578219-30578241 GAGTCCAGGAAGGAACTTGGTGG + Intergenic
1178485191 21:33014827-33014849 GAGGCTGCTAAGGGAGTTGGCGG + Intergenic
1179349962 21:40599374-40599396 GAGGCCAGCCAGGGGGTTGGGGG - Intronic
1180952077 22:19724979-19725001 GGGGCCAGTGAGGACGTTGTGGG + Intergenic
1184157305 22:42676529-42676551 GAGGCCTGTTAGGCAGGTGGGGG + Intergenic
949543185 3:5050298-5050320 GAGGCTAATAAGAAAATTGGTGG - Intergenic
950713372 3:14829695-14829717 AAGCCGAGTAATGAAGTTGGGGG + Intronic
951161845 3:19432434-19432456 GAGGACAATAAGGAAATTTGGGG + Intronic
953021539 3:39117510-39117532 GTGGCCAGAAAGGCACTTGGGGG - Intronic
953412787 3:42699611-42699633 GGGGCCAGTAAAGAAGCTGAAGG + Intronic
953946835 3:47156617-47156639 GAGGCCAGTATAGTACTTGGAGG - Intronic
954430252 3:50466995-50467017 GAGGCCTGTAAGGGGGTGGGGGG + Intronic
954661436 3:52228952-52228974 GAGCCCAGGAAGGAGGATGGTGG + Exonic
955008027 3:54987988-54988010 GAGGCCAGTATTGAAGTAGGAGG + Intronic
955911772 3:63864523-63864545 GAGCCCAGGAAGGAAGGGGGCGG - Intergenic
956747971 3:72324380-72324402 GAGGCCAGTTAGGAAGTTGATGG - Intergenic
957145395 3:76416780-76416802 GAGGCAAGAAAGAAAGTTGACGG - Intronic
958442350 3:94171282-94171304 GTGGACACTAAGGAAGTTTGTGG - Intergenic
958775491 3:98478130-98478152 GAGGCCTGTCAGGGGGTTGGGGG - Intergenic
958996397 3:100910248-100910270 GAGGCCTGTTGGGAAGTCGGGGG + Intronic
962291109 3:134137012-134137034 GAGGCCAGTGAGCAAGAGGGAGG - Intronic
963396559 3:144741932-144741954 GAGGCCATTAGGGAAATAGGAGG - Intergenic
963854457 3:150239233-150239255 GTGGACAGGAAGGAAGTGGGAGG + Intergenic
964031861 3:152147476-152147498 GGGGCCTGTCAGGAGGTTGGGGG + Intergenic
964038669 3:152231067-152231089 GGGGCCTGTCAGGGAGTTGGGGG + Intergenic
966300114 3:178469416-178469438 GGGGCCTGTCAGGGAGTTGGGGG - Intronic
967095450 3:186173873-186173895 GAGGCCAGGCAGGAACATGGGGG - Intronic
969429837 4:7147688-7147710 GAGGCCAGCAAGGGAGGAGGAGG - Intergenic
969694716 4:8728116-8728138 AAGGCCAGCAAGGAAGAGGGTGG + Intergenic
970423182 4:15923961-15923983 GAGTCCAGAAAGGCAGGTGGAGG - Intergenic
970788407 4:19828066-19828088 GATGGCAGTAAGGAACTTGTTGG + Intergenic
971263412 4:25077016-25077038 GAGGGCTGGAAGGAGGTTGGGGG - Intergenic
971445563 4:26743295-26743317 GAGGCCACAAAAGAAGTTAGTGG + Intronic
973133142 4:46673107-46673129 GAGGCCTGTTAGGAACTGGGCGG - Intergenic
973240889 4:47954650-47954672 AAGGCCAGTAGGGAATTAGGAGG - Intronic
974283964 4:59839488-59839510 AGGGCCTGTCAGGAAGTTGGGGG - Intergenic
977009517 4:91619488-91619510 GAGGACAGTAAAGTAGATGGGGG + Intergenic
977792708 4:101127184-101127206 GAGGGCACTAATGGAGTTGGGGG - Intronic
977879609 4:102188741-102188763 GAGAGCAATATGGAAGTTGGTGG - Intergenic
978692576 4:111532935-111532957 GAGGCCTGTCAGGGAGTGGGGGG - Intergenic
981119746 4:141036303-141036325 GAGGCCAGAAAGATAGTTGAGGG + Intronic
981745523 4:148048907-148048929 GAGGCCAAAAAGGGGGTTGGGGG + Intronic
982122488 4:152156447-152156469 GAGGTCAGTGAGGACTTTGGAGG - Intergenic
982287696 4:153752451-153752473 GATGCCAGGAAAGAAGTGGGTGG - Intronic
985769494 5:1799852-1799874 GCTGCCAGGAAGGAAGATGGCGG + Exonic
986694372 5:10338983-10339005 AAGGGCAGGAGGGAAGTTGGTGG + Intergenic
986792353 5:11174138-11174160 GAGGCCTGGCAGGAAGTTGTGGG + Intronic
993179224 5:84528401-84528423 GAGGCCATGAATGAAATTGGAGG - Intergenic
994003511 5:94809728-94809750 GTGGCCTGTGAGGAAGTTGCTGG + Intronic
997259109 5:132451883-132451905 CTGGCCACTAAGGCAGTTGGTGG - Intronic
998874758 5:146587961-146587983 AAGGCCATAAAGGAAGTCGGTGG + Intronic
999104661 5:149060670-149060692 CAGACCAGTAAGGAATTAGGAGG + Intronic
999580789 5:153036546-153036568 CAGGCCTGTAAGGAGGTGGGGGG + Intergenic
999663377 5:153888668-153888690 GAGGCCAGTAGGGAGGTGAGAGG + Intergenic
999768395 5:154756884-154756906 GGAGCCAGTTAGGAGGTTGGCGG + Intronic
999797036 5:154998394-154998416 GAGGCCTGTCAGGGGGTTGGGGG - Intergenic
1000326306 5:160175341-160175363 GAGGGCAGTGGGGAAGATGGAGG + Intergenic
1000495688 5:161981686-161981708 GAGGCCTGTCAGGGGGTTGGGGG - Intergenic
1000748735 5:165068483-165068505 GGGGCCTGTCAGGAGGTTGGGGG - Intergenic
1000812222 5:165877221-165877243 GAGGACAATTAGGAAGTTAGGGG + Intergenic
1000855557 5:166393812-166393834 GAAGCCATGCAGGAAGTTGGAGG - Intergenic
1001011250 5:168100723-168100745 GAGGCCTGTCAGGGGGTTGGGGG + Intronic
1001307528 5:170586236-170586258 GAGGCCAGTCATGCATTTGGAGG - Intronic
1001886228 5:175293139-175293161 GAGGACAGTAAGGCAGCTGCAGG - Intergenic
1003286277 6:4736506-4736528 GAGGCCAGGAAGGCTGTGGGAGG - Intronic
1003518481 6:6837169-6837191 GAGGGCAGGAAGGAAGAAGGAGG + Intergenic
1004641775 6:17522689-17522711 GAGGCCAGAAAGGCAGGTTGGGG + Intronic
1005083047 6:21976560-21976582 GGGGCCTGTCAGGGAGTTGGGGG + Intergenic
1006380623 6:33695164-33695186 GAGGCCAGTGGGGAAGAGGGTGG - Intronic
1007111917 6:39317757-39317779 CAGGCCTGTAAGGGAGTTAGGGG + Intronic
1007939838 6:45770054-45770076 GAGGCCAGTGAGGATGCAGGGGG + Intergenic
1010053401 6:71535236-71535258 GAGGGCAGAAGGGAAGTTGTAGG + Intergenic
1013635644 6:112026858-112026880 GAGACCAAAAAGGAAGGTGGCGG + Intergenic
1014489361 6:122043098-122043120 AAGGCCAGTGAGGTAATTGGGGG + Intergenic
1014688014 6:124527959-124527981 GTGGCAAATAATGAAGTTGGAGG + Intronic
1015805527 6:137104749-137104771 GAGACCAAGCAGGAAGTTGGTGG + Intergenic
1015811600 6:137166666-137166688 GTTACCAGAAAGGAAGTTGGTGG + Intronic
1016784129 6:147991328-147991350 GGGGCCTGTCAGGAGGTTGGAGG + Intergenic
1017297766 6:152818427-152818449 GAGGCCTGTCAGGGAGTGGGGGG + Intergenic
1017711023 6:157168114-157168136 GAGGCCAGAAAGGAGGTGGAAGG - Intronic
1019404906 7:877912-877934 GAGGCCAGGGGGGAAGGTGGGGG - Intronic
1020125072 7:5529110-5529132 GAGGCCAGGAAGGAGGGAGGCGG + Intronic
1021984976 7:26089488-26089510 GAGGTCAGGGAGGTAGTTGGAGG + Intergenic
1023710632 7:42988649-42988671 GAGCCCATAAAGGAAGTTTGAGG - Intergenic
1023744007 7:43304992-43305014 GAGGCCAGAGAGGAAGCTGCGGG + Intronic
1028405895 7:90473381-90473403 GAGGCTAGCAAGGAAGGAGGAGG + Intronic
1028854999 7:95580893-95580915 GAAGCCAGTAAGGGATTTTGAGG + Intergenic
1030377402 7:108769758-108769780 GACGTCAGCAAGGAAGTGGGAGG + Intergenic
1030730553 7:112983025-112983047 AAGGCCAGAAAAGAAGGTGGTGG - Intergenic
1031215863 7:118889605-118889627 GAGGCCGGTAAGGATAGTGGGGG + Intergenic
1032893720 7:136226356-136226378 GGGGCCTGTCAGGGAGTTGGGGG + Intergenic
1032917958 7:136512342-136512364 GATGACAGTAGGGGAGTTGGAGG - Intergenic
1034366021 7:150548622-150548644 GGGGCCTGTCAGGAGGTTGGGGG + Intergenic
1036120201 8:6008502-6008524 GAGGCCAGTCAGGAAGGTAAGGG - Intergenic
1036482340 8:9150518-9150540 GAGGCTTGTAGGGAGGTTGGGGG - Intronic
1039064766 8:33598831-33598853 GAGGCCAGGAAGGGAGTGGAAGG - Intronic
1039307803 8:36282432-36282454 GAGGCTGGGAAGGTAGTTGGGGG - Intergenic
1039967222 8:42292222-42292244 GAGGGCAGTCTGGAAGTAGGTGG + Intronic
1040837619 8:51748734-51748756 GAGGCTACTAAGGAAGGTAGGGG - Intronic
1040925148 8:52673233-52673255 GACACCAGGAAGGAAGTTGATGG - Intronic
1042530547 8:69810415-69810437 GTGGACAGAAAGGAAGCTGGAGG + Intronic
1043215385 8:77579861-77579883 GAGACCAGTAAGGATAGTGGAGG + Intergenic
1043537954 8:81226746-81226768 CAGGCAAGGAAGGAAGATGGTGG - Intergenic
1047148607 8:122234550-122234572 GATGCAAGAAAGGAAATTGGAGG + Intergenic
1048708719 8:137183963-137183985 GAGGACAGCAAGAAAGTTAGTGG - Intergenic
1051104023 9:13557487-13557509 GGGGCCTTGAAGGAAGTTGGAGG - Intergenic
1051582339 9:18690769-18690791 GAGGCCAGAAAGGAAGGTGTTGG - Intronic
1052272047 9:26637179-26637201 GAGGGAAATAAGGATGTTGGTGG - Intergenic
1053670384 9:40355635-40355657 GAGGTCACTCAGGAAGTTAGAGG + Intergenic
1053920174 9:42981898-42981920 GAGGTCACTCAGGAAGTTAGAGG + Intergenic
1054514229 9:66020665-66020687 GAGGTCACTCAGGAAGTTAGAGG - Intergenic
1056691030 9:88808906-88808928 GAATCCAGTAAGGAAGGTGATGG - Intergenic
1057067901 9:92072578-92072600 GAAGCCAGTGGGGAAGATGGAGG - Intronic
1058116057 9:101085413-101085435 GAGGTCAGTAAGGAAGATGAAGG + Intronic
1058483658 9:105422093-105422115 GAGGATAAAAAGGAAGTTGGTGG - Intronic
1058817138 9:108694725-108694747 GGGGCCTGTAGGGAGGTTGGGGG + Intergenic
1060245626 9:121943723-121943745 GAGGCCAGTAAGTATGATGATGG - Intronic
1060423542 9:123486483-123486505 GAGGCCAGGAAGGAAGCAGCTGG + Intronic
1060901671 9:127263151-127263173 GAGGCATCTAAGGAAGGTGGTGG + Intronic
1061288316 9:129636808-129636830 GCAGCCGGTAAGGAAGTGGGTGG - Intronic
1062077498 9:134598824-134598846 GAGGCCGGTAAACAAGCTGGCGG - Intergenic
1062533486 9:137011654-137011676 GAGGACGGCAGGGAAGTTGGTGG + Exonic
1062710724 9:137973821-137973843 GAGGGCAGACAGGATGTTGGAGG + Intronic
1187078229 X:15957887-15957909 GGGGCCTGTCAGGGAGTTGGAGG - Intergenic
1190184038 X:48219405-48219427 GGTGCCAGGAAGGAAGTTGTGGG + Intronic
1190282389 X:48939637-48939659 GAGGCCAGGAAGGAGGTTGGTGG - Intronic
1190658720 X:52635359-52635381 GATGCCAGGAAGGAGGTTGTGGG + Intergenic
1190677129 X:52791845-52791867 GATGCCAGGAAGGAGGTTGTGGG + Intergenic
1191649959 X:63526241-63526263 GGGGCCTGTAAGGAGGGTGGTGG - Intergenic
1191843341 X:65528501-65528523 AAGGCCAGTAGGGGAGTTGTGGG - Intronic
1195621027 X:106955301-106955323 GGAGCCACTAAGTAAGTTGGGGG - Intronic
1197025873 X:121749088-121749110 GGGGCCAGTCAGTCAGTTGGAGG - Intergenic
1197335759 X:125207179-125207201 GAGACCAGTAAGGAAATGAGAGG - Intergenic
1198879919 X:141269152-141269174 CTGGGCAGTAAGAAAGTTGGTGG - Intergenic
1200153016 X:153960435-153960457 GAGGTCAGCAAGGAGGATGGAGG + Intronic
1200171933 X:154083322-154083344 GAAGCCAGGAAGGAAGAGGGCGG + Intronic