ID: 906855420

View in Genome Browser
Species Human (GRCh38)
Location 1:49298829-49298851
Sequence TAGAAGGTTTAGAACCTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 145}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906855420 Original CRISPR TAGAAGGTTTAGAACCTTGG AGG (reversed) Intronic
905674571 1:39816596-39816618 GAGAAGGTGGTGAACCTTGGAGG + Intergenic
906143520 1:43547107-43547129 TAGAAGGGTTACGACCCTGGGGG - Intronic
906855420 1:49298829-49298851 TAGAAGGTTTAGAACCTTGGAGG - Intronic
907129467 1:52082647-52082669 GAGAATGGTTAGAACCTGGGAGG + Intronic
910416466 1:87004299-87004321 TAGAAGTGTTTGAACCTGGGAGG + Intronic
911707367 1:101029037-101029059 TTAAAACTTTAGAACCTTGGAGG - Intergenic
913523689 1:119669955-119669977 AAGAGGGTCTAGAACCTTGAAGG - Intronic
914503969 1:148272536-148272558 TACAAGGTTTATAAACTAGGGGG + Intergenic
915773714 1:158458985-158459007 TATAAGTTTTATAACCTTTGTGG + Intergenic
916774018 1:167940762-167940784 TAGAAGGGTTAGAAAGTTGTAGG - Intronic
917297471 1:173536552-173536574 GAGGAGGTTTAGAAGCCTGGAGG - Intronic
917938864 1:179896112-179896134 TGGAATGTTTAAAACCTTGCAGG + Intronic
918374885 1:183898984-183899006 TAGGATGTTTAGTGCCTTGGTGG + Intronic
919741959 1:200986445-200986467 TAGAATGGTTCGAACCTGGGAGG - Intronic
921813618 1:219542547-219542569 TAGAAAGCTTAGATCCTTGGTGG + Intergenic
1074557382 10:114504106-114504128 TAGAAGTTTGAGGACTTTGGCGG + Intronic
1079443713 11:20540328-20540350 GGGAACGTTTAGCACCTTGGAGG + Intergenic
1080467044 11:32507429-32507451 TGGAAGGTTTAGAAGCCTGTTGG + Intergenic
1085193673 11:74651799-74651821 CAGATGGTTCAGAACCTTGTCGG + Intronic
1085606105 11:77900187-77900209 GAGAATCTTTAGAACCTGGGAGG - Intronic
1086781465 11:90911575-90911597 TAGAATGTTAAAAACATTGGAGG - Intergenic
1087705288 11:101483552-101483574 TGCCAGGTATAGAACCTTGGTGG + Intronic
1090935353 11:131336956-131336978 TAGAAGGTTTAGGGGCTTGTGGG - Intergenic
1093783901 12:23170608-23170630 CAGAAGATTAAGCACCTTGGTGG + Intergenic
1095822143 12:46489905-46489927 TAAAATGTTTTGAACCTTGTAGG + Intergenic
1096108277 12:49011945-49011967 GAGAATTTTTAGAACCTGGGAGG - Intronic
1096582512 12:52596639-52596661 TAGAATGTCTTGAACCTGGGAGG - Intronic
1099435964 12:82645423-82645445 TAAAGGGTTCAGAGCCTTGGAGG - Intergenic
1100392292 12:94154283-94154305 CAGAGGATTTAGAACCTGGGTGG + Intronic
1106625057 13:31411760-31411782 TAAAAGTTTTGGTACCTTGGTGG + Intergenic
1107950552 13:45457569-45457591 TAGGAGGTTTAGCAACATGGAGG - Intergenic
1112213611 13:97406571-97406593 TATAAAGTTTAGAATCTTCGGGG + Intergenic
1112534690 13:100240957-100240979 TAGTATGTTCAGCACCTTGGTGG - Intronic
1116254626 14:42535578-42535600 GAGAATGGTTTGAACCTTGGAGG + Intergenic
1117566020 14:56994323-56994345 TAAAAAGTTAAGGACCTTGGTGG - Intergenic
1118732389 14:68677547-68677569 TACAGGGTTTAGAACCAAGGAGG - Intronic
1121368826 14:93338345-93338367 TAGAAAGTTTATAATCATGGTGG - Intronic
1121739776 14:96243250-96243272 TAGAAGGGCTAGAACCTGGAGGG + Exonic
1121739793 14:96243326-96243348 TAGAAGGGCTAGAACCTGGAGGG + Exonic
1121739810 14:96243402-96243424 TAGAAGGGCTAGAACCTGGAGGG + Exonic
1123540405 15:21284024-21284046 TAATAGTTTTAGAACCTTTGTGG - Intergenic
1128000293 15:64185122-64185144 TGGAAGGATGAGAACCATGGGGG + Intronic
1130222567 15:82032918-82032940 TTGCGGATTTAGAACCTTGGTGG - Intergenic
1202948719 15_KI270727v1_random:11166-11188 TAATAGTTTTAGAACCTTTGTGG - Intergenic
1134143243 16:11740670-11740692 TACAAGGTTAAGAATCTAGGAGG + Intronic
1138472398 16:57248221-57248243 TAGAATCTTTTGAACCCTGGAGG + Intronic
1138754282 16:59464480-59464502 CAGAAGGTTTGGTACCATGGGGG + Intergenic
1139068253 16:63346502-63346524 TATAAGGTTGAGAATCTGGGAGG - Intergenic
1140015747 16:71182190-71182212 TAGATGGTACAGGACCTTGGAGG + Intronic
1140132190 16:72173064-72173086 AACCAGGTTTAGAAGCTTGGTGG - Intronic
1141081212 16:81054736-81054758 AAGAAGGTCTTGAACCCTGGAGG - Intronic
1143209071 17:5170009-5170031 TAAAAGGTTTAAAGCCTTGCAGG + Intronic
1144432944 17:15211960-15211982 TAGGAAGTTTACAACCTTGTTGG - Intergenic
1147038077 17:37696544-37696566 CAGAAGGTTTACAAGCATGGCGG - Intronic
1148060441 17:44832381-44832403 TAGAATCTTTTGAACCTGGGAGG - Intergenic
1150462022 17:65361314-65361336 GAGAAGGCTTAGCACTTTGGGGG - Intergenic
1151739344 17:75969254-75969276 GAGAAGCTTTTGAACCTGGGAGG - Intronic
1158330138 18:56353138-56353160 TAGAGGGTTTGGGGCCTTGGTGG - Intergenic
1160667706 19:340827-340849 TAGAAAGTTTAGCTCCGTGGTGG + Intronic
1162259669 19:9522113-9522135 TAGAAGGTGTAGAAACTCAGTGG - Intergenic
926766832 2:16329588-16329610 CAGAAGGTGTAGAATCTTTGAGG + Intergenic
928080639 2:28309443-28309465 CAGAAGGTGGAGAATCTTGGGGG + Intronic
928786644 2:34894968-34894990 TAGAAAGTTTACAACCTAGTGGG - Intergenic
931979735 2:67681787-67681809 TAGAAGATGCAGAGCCTTGGAGG - Intergenic
932741692 2:74295703-74295725 TTGAAGGTTCAGAACCATGGAGG - Intronic
939512202 2:143121367-143121389 TAGAAAGTTTATAAATTTGGGGG + Intronic
941397610 2:164992540-164992562 TAATAGTTTTAGAACCTTTGTGG - Intergenic
942244888 2:173998752-173998774 TACAATGTTTAGAACCTTATGGG + Intergenic
942251069 2:174048284-174048306 TAGAGCGTTTAGCACATTGGGGG - Intergenic
943056965 2:182993923-182993945 TAGAAGTCATAGAAACTTGGTGG + Intronic
943463196 2:188195237-188195259 TAGAAGTTTAAGAACATTGTAGG - Intergenic
944198111 2:197076596-197076618 TAAAAGGCTTAGTACCTGGGTGG - Intronic
944398051 2:199291974-199291996 TAGAAAGTTTGGAATCTTGAGGG - Intronic
945412315 2:209525640-209525662 TAGAAGGGTTGGAACTTTTGAGG - Intronic
946059386 2:216928654-216928676 TAGAAGTTTTTGAATCATGGGGG - Intergenic
948275128 2:236702613-236702635 TAGAAAGTTTATATCCTTAGTGG - Intergenic
1171993239 20:31712900-31712922 TAGAAGGTTGAAAACCTTGTTGG - Intronic
1174872585 20:54196945-54196967 TATAAGGTATAGAAACTTAGAGG + Intergenic
1175453025 20:59086543-59086565 TAGAAGGATTATAACCTTTCTGG - Intergenic
1176847602 21:13888592-13888614 TAGAATGGTTAAGACCTTGGGGG - Intergenic
1176944499 21:14962555-14962577 TGGAAGGTTTGGAGCCTTAGAGG - Exonic
1177434884 21:21038626-21038648 TAGGAAGCTTATAACCTTGGTGG - Intronic
1177480677 21:21683124-21683146 TAGCAGATTTCTAACCTTGGGGG - Intergenic
1177526696 21:22301862-22301884 TACAAAGTTTAGAACTTTAGAGG - Intergenic
1179775903 21:43661957-43661979 TGGATGTTTTAGAACCCTGGAGG - Intronic
1179776367 21:43666046-43666068 TTGAAGGTGGAGAGCCTTGGAGG - Intronic
1183741782 22:39672848-39672870 TAGAAGGGTCAGGACCTGGGAGG + Intronic
1184717758 22:46291510-46291532 TGGAAGGTTTCCCACCTTGGGGG - Intronic
952676060 3:36031335-36031357 TAGAAGGTTTCGAAAATTGGAGG - Intergenic
954380655 3:50217328-50217350 TGGAAGGGTCAGAGCCTTGGAGG + Intronic
954446032 3:50547386-50547408 CAGCAGGTTGAGGACCTTGGAGG + Intergenic
955123756 3:56088508-56088530 AAGAAGCAGTAGAACCTTGGGGG + Intronic
955251400 3:57286504-57286526 TAGATGTTTTAGGATCTTGGGGG - Intronic
959342021 3:105143897-105143919 TAGAAAGTCTATAACCTTGAGGG + Intergenic
959361311 3:105396300-105396322 TAGGAGGTTTAGGAGCTAGGAGG + Intronic
960088882 3:113618912-113618934 GAGAAGATTTTGAACCTGGGAGG - Intronic
961061163 3:123830517-123830539 AAGCAGGTTTAGCACCATGGGGG + Intronic
962503787 3:136025140-136025162 TAAAAGGTTTAGAACAGTGCTGG - Intronic
963248542 3:143084402-143084424 GAGAAGGGTGAGAACCTGGGAGG - Intergenic
964413534 3:156424086-156424108 GAGAAGGTTAAGAAACTTGGAGG + Intronic
965957770 3:174391210-174391232 TGGAAGGATTTGAACTTTGGAGG - Intergenic
967374799 3:188788788-188788810 TAAAAGGTTTAGAGCCGGGGGGG - Intronic
967900405 3:194444748-194444770 AAGATGGTTTAGATCTTTGGGGG - Exonic
975579378 4:75892764-75892786 TATAAGGTTTAGGACCTGTGTGG + Intronic
975803656 4:78089851-78089873 TACTAGGTTTAGTACCTGGGTGG - Intronic
975881727 4:78917335-78917357 GAGCAGGACTAGAACCTTGGTGG + Exonic
977482312 4:97593803-97593825 CAGAAGGTTCACAACCTTGAGGG + Intronic
981147956 4:141348193-141348215 TAGAAGCTATAGAGCCCTGGAGG + Intergenic
982044531 4:151430016-151430038 TAAAATGTTTAGAGCATTGGTGG + Intronic
985078937 4:186245171-186245193 TAAGAGGTTTAGAAGCCTGGCGG + Intronic
985887502 5:2691225-2691247 TAGAACTTTTAGGACCTTAGGGG + Intergenic
991122014 5:63028061-63028083 AAGAAGGGGTAAAACCTTGGTGG + Intergenic
996417387 5:123224846-123224868 GAGAATGTTTTGAACCTGGGAGG + Intergenic
999077387 5:148809228-148809250 TAGAATTTTTAGTAACTTGGAGG - Intergenic
1000549237 5:162638646-162638668 TAGAATGTTTATAATCTTGTAGG - Intergenic
1005188954 6:23196226-23196248 TGGAAGGTTTTGGACCATGGGGG + Intergenic
1005250965 6:23945665-23945687 TTGAAGATTTATATCCTTGGTGG - Intergenic
1009491425 6:64296947-64296969 TTGAAGGTTTACAACCTTCCAGG + Intronic
1012108407 6:95195949-95195971 ATGAAGATTTAGAATCTTGGAGG - Intergenic
1013439690 6:110150692-110150714 TTGAAGATTTTGAACTTTGGTGG + Intronic
1020423205 7:8034279-8034301 TAGAAGTTTTAGAATTTTAGAGG - Intronic
1024518745 7:50284334-50284356 TGGCAGCTCTAGAACCTTGGAGG + Intergenic
1024632884 7:51263617-51263639 TTGAAGCTTTAGTACCTGGGAGG + Intronic
1024880533 7:54080842-54080864 TAGAATGTTTATAAGCTGGGAGG - Intergenic
1024919635 7:54544216-54544238 TAGATTGTTTAGAAACTTAGAGG + Intronic
1026432128 7:70357992-70358014 TAGAATGTCTATAACCTTAGTGG + Intronic
1028331162 7:89593913-89593935 TACAAGGTTTAGTAGCTTTGAGG + Intergenic
1030255642 7:107506661-107506683 TAGAAGGTCTAGAACTTAGCTGG - Intronic
1033010785 7:137620279-137620301 TAAAAGTTTTAGAGTCTTGGAGG + Intronic
1038580399 8:28743422-28743444 CAGAAGGTTTGGAACTTGGGTGG + Intronic
1043032633 8:75156450-75156472 TAGAAGGTATTGAATCATGGGGG + Intergenic
1044554761 8:93550940-93550962 GAGAAGGGTTTGAACCCTGGAGG + Intergenic
1046383996 8:113485857-113485879 TTGTAGATTTAGCACCTTGGTGG + Intergenic
1048395303 8:134008959-134008981 AACAAGGATTAGAACCTAGGAGG + Intergenic
1048594704 8:135854135-135854157 TAGAAGTTATAGGAGCTTGGCGG + Intergenic
1048993871 8:139777045-139777067 TGGAAGGTGAAGGACCTTGGTGG - Intronic
1050251681 9:3750991-3751013 TAGAAGTTCTAGAACCTTCAGGG + Intergenic
1050286176 9:4104601-4104623 TAGATTGTTTAGGACCTTGGAGG - Intronic
1051022667 9:12563602-12563624 TAGAAAGTTCAGAAATTTGGAGG + Intergenic
1053496648 9:38553055-38553077 TGCAGGGTTTAGTACCTTGGCGG - Intronic
1053838559 9:42167426-42167448 GAGAATGGTTAGAACCTGGGAGG + Intergenic
1055557068 9:77485411-77485433 TTGAAGGTTCAGGACTTTGGTGG - Intronic
1186758235 X:12695824-12695846 TAGAATCTTTTGAACCTAGGAGG - Intronic
1187399570 X:18947517-18947539 TAGCAGCATTAGCACCTTGGTGG - Intronic
1187630513 X:21164729-21164751 TAAAAAGTTTAAAACATTGGTGG + Intergenic
1187804792 X:23107554-23107576 TAGAAGATATAACACCTTGGTGG - Intergenic
1190405177 X:50079642-50079664 TAGAAAGTTTTGGACCCTGGTGG - Intronic
1193961875 X:87936242-87936264 TAGAAGGTGGAAAACATTGGAGG - Intergenic
1196634574 X:117987343-117987365 TAGAAGGTTTAGAATCTCCAAGG + Intronic
1196773788 X:119320833-119320855 TAAGAGGTTTAGAAGCCTGGCGG + Intergenic
1197350798 X:125380836-125380858 TAGAAGATTTAAAAACTTAGTGG + Intergenic
1198751060 X:139936700-139936722 TAGAAGGTATGGAAGATTGGGGG - Intronic