ID: 906858270

View in Genome Browser
Species Human (GRCh38)
Location 1:49331367-49331389
Sequence AGGGTAGTGCCTGCCTCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 1, 2: 6, 3: 35, 4: 275}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906858260_906858270 28 Left 906858260 1:49331316-49331338 CCTCACAAGATAAGACCAACTGG 0: 2
1: 31
2: 145
3: 173
4: 311
Right 906858270 1:49331367-49331389 AGGGTAGTGCCTGCCTCAGAAGG 0: 1
1: 1
2: 6
3: 35
4: 275
906858263_906858270 13 Left 906858263 1:49331331-49331353 CCAACTGGCTTGGAATTCTAGCC 0: 10
1: 109
2: 164
3: 166
4: 235
Right 906858270 1:49331367-49331389 AGGGTAGTGCCTGCCTCAGAAGG 0: 1
1: 1
2: 6
3: 35
4: 275
906858267_906858270 -8 Left 906858267 1:49331352-49331374 CCAGCCACCGGACACAGGGTAGT 0: 1
1: 0
2: 0
3: 9
4: 66
Right 906858270 1:49331367-49331389 AGGGTAGTGCCTGCCTCAGAAGG 0: 1
1: 1
2: 6
3: 35
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906858270 Original CRISPR AGGGTAGTGCCTGCCTCAGA AGG Intronic
900522554 1:3112777-3112799 AGGGGAGTGCAGACCTCAGACGG - Intronic
901181939 1:7347842-7347864 AGGGTCGTGCCTGACTCCAATGG - Intronic
901193127 1:7424477-7424499 AGGGATTTGCCTGCCTGAGAGGG + Intronic
903765583 1:25732160-25732182 AAGGTAGTGCCTGCTGCAGGGGG + Intronic
903789509 1:25882946-25882968 ATGGTAGTGCATGCCTGAGGTGG + Intergenic
904499492 1:30906117-30906139 AGGGCAGTGCCTGCAGCAGGAGG - Intronic
904770235 1:32877062-32877084 ACAATAGTGCCTGCCTCATAGGG + Intergenic
905137268 1:35808741-35808763 AGGGTAGTTTGGGCCTCAGAAGG + Intronic
905695803 1:39972778-39972800 GGGGTAGGGACTGCTTCAGAGGG - Intergenic
906696173 1:47824869-47824891 AGGGTGCTGCCTGGCTCTGAGGG - Intronic
906858270 1:49331367-49331389 AGGGTAGTGCCTGCCTCAGAAGG + Intronic
907289794 1:53406465-53406487 ATGGTAATGCCTACCTCATAAGG - Intergenic
907491118 1:54809511-54809533 ATGATAGTGCCTGCTTCATAGGG - Intronic
910746607 1:90581582-90581604 AGGGTTGTTCCTGCCTATGATGG - Intergenic
915543550 1:156583258-156583280 AGGGTAGGGAGTGCCTCTGAGGG + Intronic
915813749 1:158944953-158944975 AGGGTTGTGCTGGCCTCTGAAGG - Exonic
916056834 1:161073826-161073848 AGGGTAGTGGCAGCCTCCCAAGG + Intronic
916192265 1:162191257-162191279 AGAGTAGTGCCTGTCTCTTAGGG - Intronic
916855319 1:168743295-168743317 AGGGAAGTGCCTATGTCAGAGGG - Intergenic
917686863 1:177425093-177425115 AGAGTAATAGCTGCCTCAGAGGG + Intergenic
920338283 1:205259326-205259348 AAGGGGCTGCCTGCCTCAGAGGG + Intronic
923364191 1:233243776-233243798 AGGACAGTGCCTGCCATAGAGGG - Intronic
924397346 1:243636336-243636358 ATAGTAGTACCTGCCTCATATGG - Intronic
1062842972 10:685556-685578 TGGGCAGTGCATGCTTCAGAAGG - Intronic
1064562210 10:16604632-16604654 GGGGTAGCGCCTGTCTCAGGGGG - Intronic
1065367030 10:24946630-24946652 GAGTTAGTGCCTGCCTCATATGG + Intronic
1066509903 10:36084023-36084045 AGGGTGGAGCCTGCCTGAGATGG - Intergenic
1067456097 10:46420281-46420303 GCGGCAGTGCCTGCCTCCGAAGG + Intergenic
1067631102 10:47964358-47964380 GCGGCAGTGCCTGCCTCCGAAGG - Intergenic
1069340444 10:67403016-67403038 AGGGTAGTGCCTGCCTGAGATGG + Intronic
1070078459 10:73161682-73161704 AGGGTAATGCTGGCCTCAGAAGG - Intronic
1071069619 10:81676252-81676274 AGTCAAGTCCCTGCCTCAGAGGG + Intergenic
1071701343 10:87940429-87940451 AGTGTAGAGCCTGCCACACAGGG - Intronic
1071701397 10:87941106-87941128 AGTGTAGAGCCTGCCACACAGGG + Intronic
1071953669 10:90733460-90733482 AGAGAAGTGCCTGCCACTGAAGG + Intergenic
1072033751 10:91545547-91545569 AGGATGATCCCTGCCTCAGAGGG - Intergenic
1072262542 10:93694309-93694331 AGGGTTGTGCCCGGCTCAGCAGG + Intronic
1072493013 10:95927570-95927592 AGCATAATGCCTGCCTCACAGGG - Intronic
1072670267 10:97424292-97424314 AAGATAGAACCTGCCTCAGAGGG + Intronic
1073380955 10:103077766-103077788 GGGGTGTAGCCTGCCTCAGAGGG + Exonic
1073605705 10:104893782-104893804 ATGGCAGTGCTTGCCTGAGAAGG - Intronic
1074109611 10:110413276-110413298 ATAGTAGTACCTGCCTCACATGG + Intergenic
1074609428 10:115007028-115007050 ATAACAGTGCCTGCCTCAGATGG - Intergenic
1074917320 10:117970074-117970096 AGGGTAGTGATTGTCTCTGAAGG + Intergenic
1075104270 10:119527593-119527615 ATAGTAGTGCCTGCCTTACAGGG - Intronic
1075154163 10:119960267-119960289 AGCTTAGTGCCTGGCTCAGTAGG + Intergenic
1075916042 10:126168410-126168432 ATGATAGTGCCTGCCTCACAGGG + Intronic
1076016641 10:127033069-127033091 GGAATAGTGCCTGCCTCAAAGGG + Intronic
1076464653 10:130670708-130670730 TGGGTAGTGGCTGCCTCTGGAGG - Intergenic
1078182253 11:9021855-9021877 AGGTGAGTGCCTGGCTCAGGTGG - Exonic
1080513846 11:33001615-33001637 AGGGTAGAGCCTGCTGGAGATGG - Intergenic
1080720160 11:34840820-34840842 AGTGTAATGCCAGCCCCAGAAGG + Intergenic
1082723398 11:56706309-56706331 AGTGCAGTGCTTGCCTCAGTGGG + Intergenic
1082808006 11:57462097-57462119 AGGGGAGTGACAGCCTCCGAGGG + Intronic
1084462322 11:69302812-69302834 AGAGCGGTGCCTGCCACAGAAGG - Intronic
1085023782 11:73224898-73224920 AGAACAGTACCTGCCTCAGAAGG - Intronic
1085130764 11:74036369-74036391 AGAATAGTGCCTGGCACAGATGG + Intronic
1085137011 11:74100261-74100283 ATAGAAGTACCTGCCTCAGAGGG + Intronic
1085348819 11:75785247-75785269 AGGAAAGTGCCTGCTTCACATGG + Intronic
1087626600 11:100603502-100603524 AGGGTGGAGCCTGCCTGAGAAGG + Intergenic
1088048960 11:105487040-105487062 AGGGTAGTGGCAGGCTCAGGAGG + Intergenic
1089194525 11:116686382-116686404 AAAGTAGTGCATACCTCAGAGGG + Intergenic
1091704785 12:2686356-2686378 TGGGTCTTGCCTGTCTCAGATGG + Intronic
1092771578 12:11902042-11902064 ATGATAGTGCCCACCTCAGAAGG + Intergenic
1093086321 12:14869610-14869632 AGGGTGGAGCCTGCCTGAGATGG - Intronic
1094719901 12:33052769-33052791 GGGGCGGTGCCTGTCTCAGAAGG + Intergenic
1095487196 12:42697449-42697471 ATAGTAGTGCCTGCCCCATAAGG - Intergenic
1096574915 12:52546648-52546670 AGGGAGGTGCCAGCCCCAGAAGG - Intronic
1096588006 12:52636288-52636310 AGGGTAGGGCCTGGCTAAGCAGG - Intergenic
1096621409 12:52867950-52867972 AGGGTAGTGCCTGCCTGGGCAGG - Intergenic
1096980666 12:55726852-55726874 TGGGAAGGGCCTGCCTCAGCCGG - Intronic
1097070601 12:56351747-56351769 ATAATAGTACCTGCCTCAGAGGG - Intronic
1097601944 12:61703872-61703894 AGGGTATAGCCTGACTCGGAGGG - Intergenic
1099263215 12:80410418-80410440 AGAGTAGTGCCTACCTCATAGGG + Intronic
1100122751 12:91388022-91388044 AAAGTAGTGCCTGTCTCATATGG - Intergenic
1100342273 12:93690617-93690639 ACAGTAGTGCCTACCTCAAAGGG - Intronic
1102340413 12:112117123-112117145 AGGACAGTGTCTGCCACAGAAGG - Intergenic
1102404450 12:112661065-112661087 ATTATAGTGCCTACCTCAGAGGG + Intronic
1102435139 12:112916913-112916935 GGCATAGTGCCTGCCTCACAGGG - Intronic
1102630381 12:114273629-114273651 ACGGTAGTACCTGCCTCATAAGG + Intergenic
1103553775 12:121753818-121753840 ACGGCAGTCCCTGCCTCACAGGG + Intronic
1104015183 12:124957200-124957222 GAGGGAGTGCCTGCCACAGACGG - Intronic
1105585118 13:21736591-21736613 AGGGCAGTGCCCGCCACTGAGGG + Intergenic
1106581959 13:31026510-31026532 AAGGGAGTGGATGCCTCAGAAGG - Intergenic
1107809826 13:44189561-44189583 AGGATAGTGCCTGGCACAGAGGG + Intergenic
1108013393 13:46046880-46046902 AGGGTAGAAACTGCCTCATAAGG + Intronic
1109845594 13:67986267-67986289 AGGATAGTGCCTACCTTAAACGG - Intergenic
1110569488 13:76989424-76989446 ATGGTAGTGGCTGCTCCAGACGG - Intergenic
1111695741 13:91621583-91621605 AAGGGAGTGCCTACCTAAGATGG + Intronic
1112000665 13:95206739-95206761 TGAGAAGTTCCTGCCTCAGAGGG - Exonic
1112248407 13:97755227-97755249 AGGGCAGAGCCTCCCTCATAAGG + Intergenic
1112322956 13:98423718-98423740 ATAGTGGTACCTGCCTCAGACGG + Intronic
1115425538 14:33254551-33254573 ACGGTAGTGCCTGGCACAGTAGG + Intronic
1115595262 14:34903113-34903135 ATAATAGTGCCTACCTCAGAGGG + Intergenic
1116493857 14:45537066-45537088 AGGGTGAGGCCTGCCTGAGATGG - Intergenic
1117173999 14:53129608-53129630 AGGGTGGTGCTTGCCTCCCAGGG - Intronic
1119670020 14:76511205-76511227 AGGGTACAGCTTGCCTCATATGG - Intergenic
1119828408 14:77678206-77678228 ATGATAGTGCCTACCTCATAAGG - Intronic
1121608077 14:95255996-95256018 AGGATAGTAGCTGCCTCATAGGG - Intronic
1121734022 14:96205535-96205557 GTGGTAGTGACTACCTCAGATGG + Intronic
1122102515 14:99424661-99424683 AGGGGGGTCCCTTCCTCAGAGGG + Intronic
1122411929 14:101529973-101529995 AGGGGAGGAGCTGCCTCAGAGGG - Intergenic
1122989122 14:105228591-105228613 AGGATAGGGCCGGCCCCAGAAGG + Intronic
1125685459 15:41560810-41560832 AGAGCAGTGCCTGCCCCAGTAGG + Intronic
1125717009 15:41825116-41825138 TGGGTCCAGCCTGCCTCAGAAGG - Intronic
1126348255 15:47718415-47718437 CGGGTAGTGCCTGCCGGCGAGGG + Intronic
1127262408 15:57335943-57335965 AGGCAAGAGCCTGCCACAGAAGG + Intergenic
1128781509 15:70361822-70361844 ATGGCAGTGCCTGCCACGGAAGG - Intergenic
1129971318 15:79780336-79780358 AGGGTAGTGCCTACCTGAGATGG + Intergenic
1134050927 16:11136843-11136865 GGGGGACTGCCTGGCTCAGATGG - Intronic
1134452614 16:14372701-14372723 AGGGCAGTGCCTGGCCCACAGGG - Intergenic
1134568717 16:15273644-15273666 GGGGGAGAGCCTGCCTGAGAAGG - Intergenic
1134733717 16:16482718-16482740 GGGGGAGAGCCTGCCTGAGAAGG + Intergenic
1134933784 16:18229564-18229586 GGGGGAGAGCCTGCCTGAGAAGG - Intergenic
1135163342 16:20116683-20116705 AGGGTAGTATTTGCCACAGAGGG + Intergenic
1135949675 16:26902318-26902340 AGGGGAGTGACTGCCTGAGCAGG + Intergenic
1137694004 16:50449056-50449078 TGGGGAGTGCCTGCCCCAGATGG - Intergenic
1138347113 16:56326820-56326842 AAGGCTGTGGCTGCCTCAGACGG + Intronic
1138352464 16:56353253-56353275 AGGGTTGGGCCTGTCTCTGAGGG - Intronic
1138510979 16:57508257-57508279 GGGGTAGTGTCTGGCTCAGCTGG + Intergenic
1138675074 16:58645393-58645415 AGAGTAGTACCTGCTTCACAGGG - Intergenic
1139016817 16:62699437-62699459 GTTATAGTGCCTGCCTCAGAGGG + Intergenic
1140412805 16:74751573-74751595 AGGTCAGTGCCTGCCTGACATGG + Intronic
1140491151 16:75337142-75337164 AGAGTAGTACCTGCCTTAGTAGG - Intronic
1141051269 16:80766578-80766600 AGAGTAGTGCCTGCCTCATTGGG - Intronic
1141246425 16:82312016-82312038 AGGGTAGTGCCTACCTAATTAGG - Intergenic
1142105424 16:88299866-88299888 GGGGCAGTGCTGGCCTCAGAGGG - Intergenic
1142903630 17:3028151-3028173 AGAGTCGTGTCTGCCTCAGAGGG + Intronic
1143754827 17:9059006-9059028 ATGATAGTACCTGTCTCAGAGGG + Intronic
1144448205 17:15351730-15351752 AGGGTAGGTCATGCCTCAGAGGG - Intergenic
1145210045 17:21005987-21006009 AGGGGAGTGACAGCCACAGAAGG + Intronic
1146272627 17:31494300-31494322 AGGCTAGTACCTCCCTCACAGGG + Intronic
1146272635 17:31494340-31494362 AGGCTAGTACCTCCCTCACAGGG + Intronic
1146662799 17:34675841-34675863 TGGGTAGAGTCAGCCTCAGAGGG - Intergenic
1147223345 17:38953957-38953979 GGTGCAGTGCCTGCCTCACAAGG + Intronic
1147892403 17:43726697-43726719 AGGATGGTGCCTACCTCAGAAGG - Intergenic
1148933284 17:51144489-51144511 AGAATAGTGCCTGCCTCATATGG + Intergenic
1150456650 17:65311723-65311745 ATCGTAGTGTCTGCCTCATAGGG - Intergenic
1151677043 17:75603960-75603982 GGGCTGGTGGCTGCCTCAGAAGG + Intergenic
1152201193 17:78947379-78947401 AGGGTAGGGCCTGCGGCCGAGGG + Intergenic
1153907471 18:9675270-9675292 AGTGTAGTGTCTGTCTCATATGG + Intergenic
1156495951 18:37525164-37525186 AGCGCAGTGCCATCCTCAGAGGG - Intronic
1157663391 18:49465518-49465540 TGGGTATTGCCTGCCTGATAAGG + Intergenic
1158799879 18:60893815-60893837 AGGGTAGGGCCTTCATCCGATGG + Intergenic
1159026383 18:63185716-63185738 AGGATAGTACCTACCTCATAGGG - Intronic
1160352864 18:78199937-78199959 AGGGTAGGGGATGCGTCAGATGG + Intergenic
1161981319 19:7631846-7631868 AGGGCAGTGCCGGCCACAGGTGG + Exonic
1165716165 19:38047052-38047074 TGGATAGTGCCTGCCTCACAGGG - Intronic
1166545738 19:43634156-43634178 ATGCCAGTGCCTGCCTCATAAGG + Intronic
1166660793 19:44646059-44646081 ACAGTAGTGCTTGCCTCAGGGGG + Intronic
1168641113 19:58032402-58032424 AGGGGAGGGGCTGCCTCAGCTGG - Intergenic
925425679 2:3747207-3747229 CGGGAAGCTCCTGCCTCAGAGGG - Intronic
925915354 2:8600594-8600616 TGGGTCCAGCCTGCCTCAGAGGG - Intergenic
926045656 2:9707915-9707937 AGGCTCGTTCCTGCCACAGAAGG - Intergenic
927377921 2:22440088-22440110 AGGCTAGTACCTGCCTCATTGGG - Intergenic
928948561 2:36793520-36793542 AGGGTATTACCTGGTTCAGATGG - Intronic
929825827 2:45309069-45309091 AAAGTAGTACCTCCCTCAGAAGG + Intergenic
932011962 2:67987685-67987707 AGGGTAGTTCCATCCTGAGAAGG - Intergenic
932235303 2:70116009-70116031 AGGGGACTGCCTGACTCACAGGG - Intergenic
932691932 2:73920882-73920904 ATGCTAGTACCTGCCTCATAGGG - Intergenic
932769824 2:74494444-74494466 AGGGTAGTCCCTACCTCATAAGG + Exonic
932838705 2:75061237-75061259 CGGGTACAGCCTGCCTCTGAGGG + Intronic
933206272 2:79512456-79512478 AAGGTAGTGACTGCCGCGGAAGG - Intronic
933546392 2:83718088-83718110 AAAGGAGTGCCTGTCTCAGAAGG - Intergenic
934767236 2:96886492-96886514 AGGGGAGAGCCTGCCTGGGAAGG + Intronic
936416767 2:112322380-112322402 ATGGTAGTGCCCACCTCAGAAGG - Intronic
937293543 2:120796445-120796467 AGGGAAGTGCAGGCATCAGAGGG - Intronic
938164073 2:129010886-129010908 AGAGTAGTATCTTCCTCAGAGGG + Intergenic
945028837 2:205644625-205644647 ACAGTAGTACCTGCCTCATAGGG + Intergenic
945041448 2:205746515-205746537 AAGGTAGGGCCTGACTCAGAAGG - Intronic
945292013 2:208135950-208135972 AGGGTGATGCCAGCCTCTGAGGG - Intergenic
948192090 2:236067235-236067257 AGTGTAGTACCTGCCTCATCAGG + Intronic
948436078 2:237955638-237955660 AGGGTAGGGCCAGCCTCCAAGGG - Intergenic
948510041 2:238458014-238458036 AGGGAACTGCCTGCCTCATTAGG + Intergenic
1169026594 20:2376733-2376755 AAAGTAGTGCCTACCTCAAAGGG - Intergenic
1169813434 20:9631783-9631805 AGGTTAATGGCTGCCTAAGATGG - Intronic
1170030146 20:11935934-11935956 TGGGTAGAGCCAGCCTCACATGG + Intergenic
1170278788 20:14623012-14623034 AAGGTAATGCCTGCCTCCCAGGG + Intronic
1170910882 20:20566671-20566693 ATAATAGTGCCTACCTCAGAGGG - Intronic
1173131442 20:40397833-40397855 AGGTTACTGCCTCCCTCAGCAGG + Intergenic
1173578370 20:44128305-44128327 GTGGTAGTACCTACCTCAGAGGG - Intronic
1173898549 20:46569543-46569565 ATGATAGTGCCTGTCCCAGAAGG + Intronic
1175090869 20:56502954-56502976 ATGGTAGTGTCTGCCTCACAGGG + Intronic
1175927806 20:62479662-62479684 ATGATAGTGCCTGCCTCTCACGG + Intergenic
1179434414 21:41350421-41350443 AAGATAGTTCCTGCCACAGAAGG + Intronic
1179591682 21:42413275-42413297 GGGCTAGTCCCTGCCACAGAGGG - Intronic
1180073255 21:45449225-45449247 AGGGGAGGGCCTGGCTCACATGG + Intronic
1181668010 22:24411765-24411787 AGGGCAGCACCTGCCTCAGCAGG + Intronic
1182276996 22:29196016-29196038 AGGGAAGGGCCTGTCTCAGGAGG - Intergenic
1182982639 22:34685705-34685727 ACAGTAGTGCCTGCCTCAGAGGG + Intergenic
1183695606 22:39420237-39420259 ATGGCAGTGACTGCCTCAGGGGG - Intronic
1184640010 22:45865704-45865726 TGGGCAAAGCCTGCCTCAGATGG - Intergenic
951834350 3:26964590-26964612 ATAGTAGTGCCTACCTCACAGGG - Intergenic
952278050 3:31896705-31896727 AGGGCAGTGCCTGCCTTAGAGGG + Intronic
952408002 3:33022429-33022451 ACAGTAGTACCTGCCTCACAGGG - Intronic
952695856 3:36264480-36264502 AGGGTGGAGCCTGCCTGAGATGG - Intergenic
952888007 3:38023478-38023500 ATGACAGTGCCTTCCTCAGAGGG - Intronic
952965158 3:38616623-38616645 AGGGTTTTGCCAGCCTGAGAGGG - Intronic
953034279 3:39198465-39198487 GGGGTAGTGCATGCCTCACTTGG + Intergenic
953905480 3:46866369-46866391 AGGTAAGTGGCTGCCTGAGAGGG - Intronic
955322721 3:57985833-57985855 AGGGGACAGCCTGCCTGAGAAGG + Intergenic
955386709 3:58486574-58486596 AGGGAAGGGCATGCCTGAGAGGG + Intergenic
955873451 3:63464334-63464356 AGGATGGTCCCTGCCTCAAAGGG + Intronic
956791807 3:72685832-72685854 TGAGTCGTACCTGCCTCAGAGGG + Intergenic
958650615 3:96931702-96931724 AGGGTGGAGCCTGTCTGAGAGGG - Intronic
959588112 3:108045138-108045160 AGGGCAGTGAATGCCTCAAAAGG + Intronic
959985029 3:112562362-112562384 AGGGTAGTCCCTGACTGTGAAGG + Intronic
960733417 3:120750781-120750803 AGGGTAGAGACTGCTGCAGACGG + Exonic
960846924 3:122012633-122012655 AAGATAATACCTGCCTCAGAGGG + Intronic
962041841 3:131715570-131715592 ATGGTAGTGCCTACCTCTCAGGG + Intronic
962069215 3:132015772-132015794 AGAGAAATGCCAGCCTCAGAGGG + Intronic
964338147 3:155679374-155679396 ATGGCAGTACCTACCTCAGAGGG + Intronic
965726695 3:171724704-171724726 AGGGAAGAGCCTGCTACAGATGG - Exonic
967397655 3:189024921-189024943 AGCGTAATGCCTGTCTGAGATGG - Intronic
967910585 3:194539387-194539409 AGGGTAGTGACTGAGGCAGAAGG + Intergenic
968404305 4:326873-326895 AGTGTAGCACCTGCCTGAGATGG + Intergenic
968510644 4:994046-994068 CCGGCAGTGCCTGCCTCATAGGG + Intronic
968866912 4:3218898-3218920 AGGCTTGTGGCTGCCTGAGAAGG + Intronic
969444294 4:7235317-7235339 AAGGTAGAGGCTGCCTAAGAAGG - Intronic
969840125 4:9875374-9875396 AGGTTAGCGTCTGTCTCAGATGG + Intronic
975297522 4:72751344-72751366 AGAGTAGAGTCTGCCTGAGATGG + Intergenic
977668761 4:99671293-99671315 AGGCTAGAGTCTGCCTGAGAAGG + Intergenic
977792399 4:101123228-101123250 AGGATAGTGCCTGGCACATAGGG + Intronic
978118410 4:105049814-105049836 AGGGTAAATCCTGCCTGAGATGG + Intergenic
980703007 4:136457168-136457190 TTGGCAGTGGCTGCCTCAGATGG - Intergenic
983873325 4:172847631-172847653 AGGATAGTGCCTGGCCCATACGG - Intronic
987260191 5:16195360-16195382 AGGGTGGAGCCTTCCTGAGATGG + Intergenic
988619195 5:32805119-32805141 ATGACAGTGCCTGCCTCAGTGGG - Intergenic
988902002 5:35743892-35743914 TTACTAGTGCCTGCCTCAGAGGG - Intronic
992199733 5:74371335-74371357 AGGATGGTGCCTGACTCAAAAGG - Intergenic
993532370 5:89040368-89040390 AGGATAGTCTCTGCCTCACAAGG - Intergenic
995441083 5:112193094-112193116 AGTGTAATTCCAGCCTCAGAAGG + Intronic
995945326 5:117638337-117638359 AGGGTAAAGCTTGCCTGAGATGG - Intergenic
996778767 5:127160645-127160667 AGGGTGGAGCCTGCCTGAGAAGG - Intergenic
997519612 5:134514410-134514432 AGGGCAGTTCCCTCCTCAGAAGG + Intergenic
998447726 5:142211416-142211438 AGCGCAGTGCCTGGCGCAGAGGG + Intergenic
998808491 5:145941788-145941810 ATGGTAGTACCTACCTCAGAGGG + Intronic
999082256 5:148855575-148855597 AGGGTAGGCCCTGCCTAAGTGGG + Intergenic
1001398667 5:171433900-171433922 AGAGCAGTGCCTGGCTCAGTAGG - Intronic
1001528701 5:172446991-172447013 AGGCTGGTGCCTGCCTCAGGAGG + Intronic
1001549186 5:172589989-172590011 AGTGTGGTGGCTGCCTCACACGG + Intergenic
1001595339 5:172895289-172895311 ATGGTAGTACCTGCCTTATAGGG - Intronic
1001685871 5:173594694-173594716 ATAGTAGTGCCTGCCTCATAAGG - Intergenic
1001843951 5:174904369-174904391 AGGGTGAAGCCTGCCTGAGATGG + Intergenic
1004759093 6:18646364-18646386 AGGGCAGTGCCTTGCTCATAAGG - Intergenic
1006257938 6:32845804-32845826 AGGGTAGTCCCCGGCTCTGACGG - Intronic
1006672890 6:35740650-35740672 AGGGTAATGACTGCCTCTGGTGG - Intronic
1007803978 6:44423586-44423608 AGGGTGGGGGCTGTCTCAGATGG + Intronic
1008967027 6:57323060-57323082 ATAGTAGTGCCTCCCTCATAGGG + Intronic
1009950500 6:70389988-70390010 AGGGTAGTGGTTTCCTCTGAAGG + Intergenic
1011137874 6:84118663-84118685 AGGGTAGAGCCTGCCTGAGAAGG - Intergenic
1012093699 6:94931997-94932019 AGGGTGGAGTCTGCCTGAGATGG - Intergenic
1013618363 6:111866209-111866231 ATAGTAGTTCCTGCCTCAGAGGG - Intronic
1016333174 6:142975442-142975464 AGGGTAGTGGTTACCTCAGGTGG + Intergenic
1017438227 6:154437977-154437999 AGCACAGTGCCTGCTTCAGAAGG - Intronic
1019499189 7:1355883-1355905 AGGGCAGGGGCTGCCCCAGAAGG + Intergenic
1021227363 7:18043780-18043802 ACAATAGTGCCTGCCTCATAAGG + Intergenic
1021964365 7:25903024-25903046 AGAGAAGGACCTGCCTCAGAGGG + Intergenic
1021988633 7:26121205-26121227 ATAATAGTGCCTACCTCAGAAGG - Intergenic
1023855037 7:44177717-44177739 AGGCTGGCCCCTGCCTCAGAGGG + Intronic
1025256079 7:57384667-57384689 ACGGCAGCGCCTCCCTCAGAAGG + Intergenic
1027525439 7:79263298-79263320 ATTATAGTGCCTACCTCAGAGGG - Intronic
1028586363 7:92456062-92456084 ATAATAGTGCCTACCTCAGAAGG + Intronic
1032784245 7:135187951-135187973 GGAATAGTGACTGCCTCAGAGGG - Intronic
1032930725 7:136666213-136666235 AGGATAGTGCCTCTCTCACAGGG + Intergenic
1033447761 7:141437272-141437294 AAGATAGTACCTGTCTCAGAAGG + Intronic
1033455028 7:141495306-141495328 ACGGTTGTGCTTTCCTCAGAGGG - Intergenic
1034270725 7:149802400-149802422 ATGGTCATTCCTGCCTCAGAAGG + Intergenic
1035242280 7:157540022-157540044 AGGGGAGTGCCAGCCTCAAGTGG + Exonic
1037527603 8:19742040-19742062 ATGGTAGTGCCTGCCTCACAGGG + Intronic
1037763323 8:21756560-21756582 AGGGCAGTGGCTGTCTCAGAAGG - Intronic
1038144388 8:24881269-24881291 AGGGTAGCTCCTTGCTCAGATGG + Intergenic
1040092104 8:43409029-43409051 AGGGTGGAGCCTGCCTGAGATGG - Intergenic
1045483738 8:102613838-102613860 AGGGAAGAGCCTACCACAGAAGG - Intergenic
1047536586 8:125725647-125725669 AGGGCAGTCCCTGGCTCTGAAGG - Intergenic
1047675763 8:127199750-127199772 ATAATAGTGCCTGCATCAGAGGG - Intergenic
1048494876 8:134926694-134926716 AGGACAGTGCTTGGCTCAGAGGG + Intergenic
1049339409 8:142104115-142104137 AGGGTGGCACCTGCCTCAGGAGG - Intergenic
1049445473 8:142628612-142628634 AGGGAAGAGCCTGCCACACAAGG + Intergenic
1050371242 9:4923591-4923613 AGAGCAGTGCCTGGCTCACAAGG - Intergenic
1051192003 9:14523066-14523088 AGGGTAGTGTCTGGCTGAGAGGG + Intergenic
1051450435 9:17192218-17192240 AGAATAGGGCCTACCTCAGAGGG - Intronic
1051679156 9:19589947-19589969 ATGGAATGGCCTGCCTCAGAAGG - Intronic
1052176811 9:25472576-25472598 AGGGTGGAGCCTTCCTGAGATGG - Intergenic
1053266381 9:36717274-36717296 ATGATAATGCCTGCCTCATAGGG - Intergenic
1053375751 9:37604941-37604963 ATAATAGAGCCTGCCTCAGAGGG - Intronic
1053593046 9:39533385-39533407 AGGGTACTCCCTGCCTCAGGTGG - Intergenic
1053850783 9:42288093-42288115 AGGGTACTCCCTGCCTCAGGTGG - Intergenic
1054573260 9:66831892-66831914 AGGGTACTCCCTGCCTCAGGTGG + Intergenic
1055564385 9:77553296-77553318 AGTGTAGTGCCTGCCACACATGG - Intronic
1057536790 9:95917828-95917850 ATAATAGTGCCTGCCTCACATGG + Intronic
1057566025 9:96166960-96166982 AAGGAGGAGCCTGCCTCAGAGGG + Intergenic
1057793949 9:98142697-98142719 AGGGTTGGGCGTGGCTCAGAAGG + Intronic
1060103132 9:120857309-120857331 AGGGCTGGGTCTGCCTCAGAAGG - Exonic
1060738363 9:126080909-126080931 AGGTTGGTGCCAGCCTCTGATGG + Intergenic
1061868734 9:133508931-133508953 ATAATAGTGCCTGCCTCATATGG - Intergenic
1062035108 9:134379503-134379525 CTGGCAGTGCCTGCCACAGACGG - Intronic
1062078341 9:134604471-134604493 AGGGAAAAGCCTCCCTCAGAGGG - Intergenic
1062572261 9:137191146-137191168 GGAGCAGCGCCTGCCTCAGACGG - Intergenic
1186590020 X:10920280-10920302 AGGGTAGTGTCTTGCCCAGAAGG - Intergenic
1187646078 X:21348581-21348603 AGGCTAGAGTCTGCCTGAGATGG + Intergenic
1188534376 X:31180177-31180199 AGGGGAGTGCCTGGCACATATGG - Intronic
1189238574 X:39507745-39507767 AGGGCAGAGCCTGCCTCCAAGGG + Intergenic
1190761865 X:53443572-53443594 ATGGTAATGCCTACCTCATAGGG - Intergenic
1192011330 X:67276965-67276987 AGTGTTGTGCCTTCCTGAGATGG + Intergenic
1192169071 X:68843300-68843322 AAGGAAGTGCCTGGATCAGATGG + Intergenic
1192185633 X:68945051-68945073 AGGAAAGTGCCTGCCTAAGGTGG - Intergenic
1192723519 X:73724621-73724643 AGGGTAGCACCTGCCTGAGATGG - Intergenic
1193530948 X:82653429-82653451 AGTGAAATGTCTGCCTCAGAGGG - Intergenic
1193758854 X:85440980-85441002 AGGGTGGAGCCTGTCTGAGATGG - Intergenic
1194127522 X:90038564-90038586 AGGGTAGCACCTGCCTCAGATGG - Intergenic
1194537270 X:95120103-95120125 AGAGTGGAGCCTGCCTGAGATGG - Intergenic
1196017722 X:110957257-110957279 ATAATAGTGCCTGCCTCATAGGG - Intronic
1196258679 X:113552689-113552711 ATGGTACTGCTTACCTCAGAAGG - Intergenic
1197705388 X:129631062-129631084 ATGATAGTGCCTGCCTCATAGGG - Intergenic
1199034306 X:143032755-143032777 AGGGTAGTGAATACCCCAGAGGG + Intronic
1199680922 X:150224052-150224074 AGGGAAGTACCTGCTTCACAAGG + Intergenic
1200121630 X:153793935-153793957 ACGTGAGTGACTGCCTCAGAAGG + Exonic