ID: 906861923

View in Genome Browser
Species Human (GRCh38)
Location 1:49370040-49370062
Sequence GTTTATGTGATGATGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 477
Summary {0: 1, 1: 1, 2: 12, 3: 94, 4: 369}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906861923 Original CRISPR GTTTATGTGATGATGGAGGC TGG (reversed) Intronic