ID: 906862489

View in Genome Browser
Species Human (GRCh38)
Location 1:49376506-49376528
Sequence CCCCAAATACTGAAGGGATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906862489_906862494 9 Left 906862489 1:49376506-49376528 CCTTATCCCTTCAGTATTTGGGG 0: 1
1: 0
2: 0
3: 12
4: 135
Right 906862494 1:49376538-49376560 CTTTTACTATTGCCAGTCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906862489 Original CRISPR CCCCAAATACTGAAGGGATA AGG (reversed) Intronic
900476139 1:2877259-2877281 CCAAAAATACTGCAGGAATAGGG - Intergenic
903129007 1:21266232-21266254 CCCCACATGCTGCTGGGATAGGG + Intronic
903352877 1:22728749-22728771 CCCCCAATCCCGAAGGGAAAAGG + Intronic
904763111 1:32819265-32819287 CCCTTAAAAATGAAGGGATATGG + Intronic
905320178 1:37110530-37110552 CCACAAATATTGAAGGGATCTGG + Intergenic
906525703 1:46492032-46492054 CCCCAAATACTGCAGGGGTGGGG - Intergenic
906862489 1:49376506-49376528 CCCCAAATACTGAAGGGATAAGG - Intronic
908492969 1:64664715-64664737 CCCCAAATCCTGGAGAGACATGG + Intronic
908966213 1:69767417-69767439 CCCTAAATACTGGAGGAATTTGG - Intronic
913015772 1:114733097-114733119 CCCCACAAACTGGAGGGGTAGGG + Intronic
913545763 1:119867704-119867726 CCCCAAATAGTGAAGGTACCTGG - Intergenic
917285094 1:173415089-173415111 ACCCAAATACATCAGGGATAAGG - Intergenic
920016058 1:202909820-202909842 CCCCTAAGCCTGAAGGGACAAGG - Intronic
920752028 1:208687561-208687583 CCCTAGATACTGATGGGAGAAGG - Intergenic
1064412977 10:15124246-15124268 CCCCAAACACTGAAAGGGTAGGG + Intronic
1068526634 10:58138005-58138027 CCACAGAGTCTGAAGGGATAGGG + Intergenic
1069638568 10:69940656-69940678 CCCATAACACTGAAGGGAGAGGG + Intronic
1069807443 10:71134744-71134766 CCCCACATGCAGAAGGGATGAGG + Intergenic
1070656457 10:78275046-78275068 CCACAAACACTGAATGGAAAAGG - Intergenic
1070869986 10:79743163-79743185 ACCAAAATGCTGAAGTGATATGG + Intergenic
1071636911 10:87265383-87265405 ACCAAAATGCTGAAGTGATATGG + Intergenic
1071658337 10:87472571-87472593 ACCAAAATGCTGAAGTGATATGG - Intergenic
1072940362 10:99758432-99758454 CCCCAAACAATGAAGGCATTAGG + Intergenic
1073277900 10:102328630-102328652 TCCTATACACTGAAGGGATAGGG + Intronic
1074530290 10:114292596-114292618 TCCTAAATACTGCAGCGATAGGG - Intergenic
1074822447 10:117190978-117191000 CACCAAATCCTGAAGGGATGTGG + Intergenic
1075367326 10:121903735-121903757 CTCCAAATACTGCAGGTATTTGG + Intronic
1078893357 11:15577194-15577216 CCCCAAATCCTCAAGGAAGAGGG + Intergenic
1079614782 11:22478805-22478827 CCCCAAATACTGCAAATATAAGG - Intergenic
1081010779 11:37810198-37810220 CCCCAAATACTTAAGATAAATGG - Intergenic
1085754744 11:79193110-79193132 CCTCAAATACTGAAAGAAAATGG - Intronic
1090161000 11:124495477-124495499 TCCCAAATACTGAAGAGAGCTGG - Intergenic
1094743906 12:33320797-33320819 CCCCAAAAACTCTAAGGATAAGG + Intergenic
1095943822 12:47742453-47742475 CCCCACTTCCTGAAGGGAGAAGG + Intronic
1098895404 12:76054529-76054551 CCCCAACTACTGGAGGAATCAGG + Intronic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1101715595 12:107309308-107309330 CCCCCAAGGCTGAAGGGACAAGG - Intergenic
1102298456 12:111754819-111754841 CAGCACACACTGAAGGGATAAGG - Intronic
1105241748 13:18614823-18614845 CCCCAATTCCTGAATGGAGAAGG - Intergenic
1105241870 13:18615287-18615309 CCCCCAATACTGGATGGAGAAGG - Intergenic
1107650730 13:42542097-42542119 CCTTAAAAACTGAAGGGAAAAGG - Intergenic
1112359711 13:98706434-98706456 CACGGAATACTGAAGTGATATGG + Intronic
1114065463 14:19055526-19055548 CCCCCAATACTGGATGGAGAAGG - Intergenic
1114065470 14:19055553-19055575 CCCCCAATACTGGATGGAGAAGG - Intergenic
1114096800 14:19344476-19344498 CCCCCAATACTGGATGGAGAAGG + Intergenic
1115798983 14:36971118-36971140 TCACAAATACTGAAGGGACTCGG - Intronic
1116739001 14:48731177-48731199 CCCTGAATTCAGAAGGGATAAGG + Intergenic
1118255566 14:64202249-64202271 CCCCTCATACTGAAGCGGTAGGG + Intronic
1122351224 14:101094238-101094260 CCCCAAATTCTGGAGGAATCAGG - Intergenic
1122621096 14:103057881-103057903 CCCCGAATACTGAAGGCACCGGG - Intergenic
1123489567 15:20770185-20770207 CCCCAATTCCTGAATGGAGAAGG + Intergenic
1123546066 15:21339272-21339294 CCCCAATTCCTGAATGGAGAAGG + Intergenic
1123677076 15:22721089-22721111 CCCAAAATTCTAAAGGGAGAAGG - Intergenic
1124407309 15:29404283-29404305 CCCCAAACACAGTAGGGATATGG + Intronic
1126899872 15:53304232-53304254 TTCCAAATACTGAAGGGGTAAGG + Intergenic
1128693277 15:69741870-69741892 TCCAAAATACTGAAGGCATAGGG - Intergenic
1129772335 15:78210291-78210313 CCCCAAATTCTGTAAGCATAGGG - Intronic
1132008981 15:98257505-98257527 CCTCAAATTCAGAAGGGAAATGG - Intergenic
1202954409 15_KI270727v1_random:66544-66566 CCCCAATTCCTGAATGGAGAAGG + Intergenic
1133145724 16:3785090-3785112 ACACAAATACTGAAGGGTAAGGG + Intronic
1135905213 16:26505793-26505815 CCCCAAGGAATGAAAGGATAAGG + Intergenic
1139717084 16:68822350-68822372 CCTCAAAGACAGAAGGGACAAGG - Intronic
1143289597 17:5818886-5818908 TCCCAAACACAGAAGGGATGTGG + Intronic
1143992631 17:10979569-10979591 CACCAAATACTGAATGGTCAGGG + Intergenic
1151415520 17:73960077-73960099 ACCAAAATACTGAGGGAATATGG + Intergenic
1154135062 18:11769925-11769947 TACCAAATATTGATGGGATATGG + Intronic
1154447081 18:14444591-14444613 CCCCCAATACTGGATGGAGAAGG + Intergenic
1157729285 18:49989798-49989820 CCACAAAAGCTGAGGGGATAAGG - Intronic
1161523450 19:4738691-4738713 CCCCAAATATTGAAGGGGGTGGG + Intergenic
1165996059 19:39845044-39845066 CCCCAAACACGGAAGAGAAAGGG + Intronic
1168303364 19:55419630-55419652 CCCCTGAGACTGAAGGGATGGGG - Intergenic
927973067 2:27317766-27317788 CCTCAAAGAAGGAAGGGATAAGG + Intronic
934609019 2:95720818-95720840 AACCAAATACTGAATGGATGTGG - Intergenic
936539026 2:113335137-113335159 CCCCAGATATGGAATGGATAAGG - Intergenic
937725720 2:125163526-125163548 CCCCAGATAATGAAGGCACACGG - Intergenic
938482856 2:131675725-131675747 CCCCAAGTCCTGAATGGAGAAGG - Intergenic
938482887 2:131675837-131675859 CCCCCAATACTGGATGGAGAAGG - Intergenic
941498575 2:166239655-166239677 CCCCAAATTCTGGAGGAATCAGG + Intronic
948126504 2:235568045-235568067 CCCCAGAGACTGAAGGGAACTGG - Intronic
1170000180 20:11606563-11606585 CCCCAAATTTTGAAAGGTTAAGG + Intergenic
1171879368 20:30605859-30605881 CACAAAATACGGAAGTGATATGG + Intergenic
1173227623 20:41171169-41171191 AGCCAAATAGAGAAGGGATAGGG + Intronic
1175537885 20:59727970-59727992 CACCAAATACCCAATGGATAGGG + Intronic
1175992118 20:62794717-62794739 CCACAATTACTGCAGGCATAGGG - Intergenic
1180483953 22:15778146-15778168 CCCCCAATACTGGATGGAGAAGG - Intergenic
1180924570 22:19544733-19544755 CCCCACAGACTGAAGTGACAGGG + Intergenic
1181981644 22:26771166-26771188 CCCCAAACCCTGCAGGGATGGGG - Intergenic
1184709880 22:46243313-46243335 CCCAAAATACTGAGAGTATAAGG - Exonic
951791035 3:26484954-26484976 CCCCAACTACAGAAGGGCTATGG + Intergenic
952304846 3:32136542-32136564 CCACACCTCCTGAAGGGATAAGG + Intronic
953252474 3:41259223-41259245 ACCCAAATATTGAAAGGAGATGG + Intronic
954854873 3:53635443-53635465 CCCCAAATCCAGATGGGAAATGG - Intronic
956918093 3:73895413-73895435 CCCCAAACACTGAAGAGTTTTGG + Intergenic
957201374 3:77140371-77140393 CAGTAAACACTGAAGGGATAAGG + Intronic
962777335 3:138674526-138674548 CGACAAATCCTGAAGGGAGAAGG + Intronic
965593027 3:170380250-170380272 TAACAAATACTGTAGGGATAGGG + Intronic
966476189 3:180349811-180349833 TCCCAAATACTGATATGATAAGG - Intergenic
966775106 3:183536785-183536807 GGCCAAATGCTGAAGAGATAAGG - Intronic
967392804 3:188973775-188973797 TTCCAAATACTGAAGGTTTATGG - Intronic
967532708 3:190567208-190567230 CCCCCATTCCTGAGGGGATAAGG - Intronic
968685319 4:1954099-1954121 TCCCAGCTACTGAAGGGATGAGG - Intronic
974370358 4:61008989-61009011 CCTCACATGCTGAAGGGATGAGG + Intergenic
975981737 4:80168986-80169008 CTCCAAATACAGATGGGTTAGGG - Intergenic
979028238 4:115604883-115604905 CCCCAGAAACTGATGGGGTAAGG - Intergenic
982091763 4:151885662-151885684 ACCCCAACACTGAAGGGAAAGGG + Intergenic
982412690 4:155097043-155097065 CCCAGAATATTGATGGGATAAGG - Intergenic
987284436 5:16441570-16441592 CCCCAACTGCAGAAGGGGTAGGG + Intergenic
987919779 5:24264568-24264590 CCCCAAACAGTGAGGAGATATGG - Intergenic
990692654 5:58381009-58381031 CTCCAAATTCTGAAGAAATAAGG - Intergenic
991113967 5:62932249-62932271 CCCCAAATACTCAAAATATATGG - Intergenic
991198812 5:63965696-63965718 CCCCAAATACTGTAGCAGTAGGG + Intergenic
994112148 5:96018618-96018640 CCCCAAATACTGAAATGTTGGGG - Intergenic
994181780 5:96775651-96775673 CCACTAATCCTGAAGGGATGAGG + Intronic
1003921406 6:10837087-10837109 TGCCAAAAACTGAAGAGATAAGG + Intronic
1006188977 6:32196236-32196258 CCGCAAAGCCTGAAGGGATAGGG - Intronic
1006550253 6:34816900-34816922 CCCCAATTTCTGAATTGATATGG + Intronic
1007930134 6:45683312-45683334 CCCCCAATACAGAATGGACATGG - Intergenic
1008280005 6:49585621-49585643 AACCAAATACTGGAGGGGTATGG - Intergenic
1008877088 6:56340956-56340978 CCCCTAGTACTGTAGGCATAAGG - Intronic
1013398339 6:109766764-109766786 ACCACCATACTGAAGGGATAGGG - Exonic
1013665117 6:112339859-112339881 CCCCAAATATTGTAGGGACATGG + Intergenic
1015187586 6:130435879-130435901 CTTCATACACTGAAGGGATATGG + Intronic
1016643403 6:146377334-146377356 ACCAAAATGCTGAAGTGATATGG + Intronic
1017076118 6:150620452-150620474 GCACAAATACTGAAGGGGTCTGG - Intronic
1020940939 7:14536259-14536281 CCAAAAATATAGAAGGGATAAGG + Intronic
1023492450 7:40758555-40758577 CCCCAAATCCTGAAGGTTTGGGG - Intronic
1028357669 7:89929036-89929058 CCCCAAATAAGGAAGGGTTGAGG - Intergenic
1030036005 7:105409384-105409406 CCCCCAATACTTAAGGAATCTGG + Intergenic
1030534793 7:110752714-110752736 CCCCAAACTCTGAAGGGATGTGG + Intronic
1036512368 8:9412600-9412622 CTCCAAATACTAATGGGAAATGG + Intergenic
1036684818 8:10902681-10902703 CTCCAAATAGTGAAAGGAGAAGG + Intronic
1038489951 8:27963676-27963698 GCCCAAATACTGAAAGTAAAAGG - Intronic
1041267203 8:56076756-56076778 CCTCAAATACTTAAAGGATGAGG - Intergenic
1042032001 8:64486539-64486561 ACCCAATTACTGAAGGTAGAGGG + Intergenic
1046551776 8:115727374-115727396 CCCCAAATGATGAAGGCAGAAGG + Intronic
1046586279 8:116152096-116152118 TCCCAAATACTGAAGATGTATGG + Intergenic
1048273383 8:133047035-133047057 CCCCAAATACTTAACAGCTAGGG - Intronic
1050171090 9:2817624-2817646 CCACATATAGTGAAAGGATAAGG + Intronic
1055410261 9:76021456-76021478 CCCCAAAAACTGAAGGCACGAGG + Intronic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1187509671 X:19906404-19906426 CCCCAAAGACAGAAGGTATATGG - Intergenic
1192798170 X:74441862-74441884 CCCCAGAACCTGAAGTGATAAGG - Intronic
1193766912 X:85540963-85540985 CCTCAAATACTAATAGGATATGG - Intergenic
1194013886 X:88595859-88595881 TCCAAAAAACTGGAGGGATATGG + Intergenic
1194486374 X:94491980-94492002 CCCCAAAAACGGAAGTGAAAAGG + Intergenic
1196579682 X:117364074-117364096 CCACACATAGAGAAGGGATATGG + Intergenic
1197304989 X:124830712-124830734 CCCAAATTAATGAAGGGCTATGG + Intronic
1198557616 X:137812079-137812101 CCCCTAGTCCTGAAGGGACAAGG + Intergenic