ID: 906866138

View in Genome Browser
Species Human (GRCh38)
Location 1:49422695-49422717
Sequence AAGAGTGAGCTGGGTGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 542
Summary {0: 1, 1: 1, 2: 4, 3: 44, 4: 492}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906866138_906866142 19 Left 906866138 1:49422695-49422717 CCTTCTTCACCCAGCTCACTCTT 0: 1
1: 1
2: 4
3: 44
4: 492
Right 906866142 1:49422737-49422759 GTTTAAGTGTCACTTTCTTTAGG 0: 1
1: 0
2: 6
3: 41
4: 388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906866138 Original CRISPR AAGAGTGAGCTGGGTGAAGA AGG (reversed) Intronic
902213741 1:14922214-14922236 ATGAGTGAGCTGGGTTGAGCAGG - Intronic
903173195 1:21566078-21566100 CAGGGTGGGCTGGGAGAAGAAGG - Intronic
903781201 1:25820954-25820976 AAGAATGAGCTCGGCGAAGGGGG + Intronic
903996808 1:27310601-27310623 AAAATTGAGCTGGGGAAAGAGGG - Intergenic
904114244 1:28149928-28149950 TGGACTGAGCTGGGGGAAGAAGG - Exonic
904752830 1:32751629-32751651 AGCACTGAGCTGGGGGAAGAGGG + Intronic
904936025 1:34130315-34130337 AAGAGCGAACTGTTTGAAGATGG + Intronic
905263000 1:36732329-36732351 CAGAGTGAGCCTGGTGAGGAGGG - Intergenic
905799074 1:40831989-40832011 CAGCCTGGGCTGGGTGAAGAGGG - Intronic
906481761 1:46203813-46203835 AAGAGTGAGTGGGGTGTTGATGG + Intronic
906500734 1:46340486-46340508 AAGAGTTAGCTAGGCGAAAAGGG - Exonic
906866138 1:49422695-49422717 AAGAGTGAGCTGGGTGAAGAAGG - Intronic
906960786 1:50418574-50418596 GAGAGAGCGCTGGGCGAAGAGGG + Exonic
907909444 1:58814094-58814116 AAAAATGAGCTGGATGAAGCCGG - Intergenic
907965599 1:59325515-59325537 GAAAGTGATCTGGGTGAAGATGG - Intronic
909331285 1:74414787-74414809 AAGAGTGATTTGGATCAAGATGG - Intronic
909840042 1:80309171-80309193 AAGTGAGAGCTGAGTGAAGGGGG - Intergenic
910602000 1:89042636-89042658 AAGAGTGAGCTGAGTGGGGAGGG + Intergenic
911098821 1:94077829-94077851 AATAGGCAGCTTGGTGAAGAAGG - Exonic
911597422 1:99813245-99813267 ATGAGAGAGCTGTGTGGAGAGGG - Intergenic
912007477 1:104922250-104922272 AAGAGTGAACTGATTGTAGAAGG - Intergenic
912945519 1:114081037-114081059 AAGAGTGTGCTGGGAGAGGGTGG + Intergenic
913053581 1:115137913-115137935 AAGAGGGAGCTGCAAGAAGAAGG - Intergenic
913471800 1:119195697-119195719 ACCAGTGAGCTGGGTGACCAAGG - Intergenic
915062725 1:153199554-153199576 AAGAGGCAGCTGGGTGAGCAAGG + Intergenic
915444499 1:155967037-155967059 AAGAGGGAGGTGGGAGGAGAGGG - Intronic
915744211 1:158143594-158143616 AACACTGAGCTTGGTGGAGATGG - Intergenic
915960577 1:160263039-160263061 AAGAGTGGGCCGGGTGATGTGGG + Intergenic
916942559 1:169691151-169691173 AAAAGAGAGGTGGCTGAAGAAGG + Exonic
917530592 1:175831490-175831512 GAGAGTGGGCTGAGGGAAGATGG + Intergenic
918216969 1:182400246-182400268 AAGAGTGAGGAGGATGAACATGG + Exonic
919061765 1:192642691-192642713 ACGAGTGTGCTGAGTGAAGGAGG - Intronic
919725538 1:200880359-200880381 ATGAGAGAGCTGGGGAAAGACGG + Intergenic
920261255 1:204689464-204689486 TAGAGTGTCCTAGGTGAAGAGGG + Intergenic
920368034 1:205458339-205458361 GAAAGATAGCTGGGTGAAGATGG + Intergenic
920552000 1:206869803-206869825 CAGAGTGAGGTGGGGGAAGAAGG - Intergenic
921036002 1:211378727-211378749 AAAAGTGAGCAAGATGAAGAAGG + Intergenic
924547238 1:245041139-245041161 AGGAGTCAGCTGTGTGAAGCAGG + Intronic
1063386819 10:5621038-5621060 AGGAGTTAGCTGGGTGCTGACGG - Intergenic
1065858262 10:29848386-29848408 AAGAGTTATCTGGTAGAAGAAGG - Intergenic
1066550618 10:36552652-36552674 AGAAGTCAGCTGGGTAAAGAGGG - Intergenic
1067525178 10:47034168-47034190 AAGAATGGGCTGGGAGAGGAAGG + Intergenic
1067527784 10:47048694-47048716 AAGCGTGGGCTGGGTGATGGAGG + Intergenic
1067695449 10:48531992-48532014 TAGAGGGAGCTTGTTGAAGAAGG + Intronic
1068106727 10:52627198-52627220 AAGATGGAACTGGGAGAAGAAGG + Intergenic
1070606472 10:77901839-77901861 AAGAGTGTGCAGGGAGAAGTGGG - Intronic
1071049929 10:81435022-81435044 GAGAGTGAGCAGGATGAGGAGGG + Intergenic
1071264497 10:83952873-83952895 AAGAGTGAGAAGAGGGAAGAGGG + Intergenic
1072186656 10:93046511-93046533 AAGAGCTACCTGAGTGAAGAAGG + Intronic
1072596329 10:96875708-96875730 AAGAGTTAGCTGGGTGTGGTGGG + Intronic
1073346205 10:102784845-102784867 AAAAGTGGGCTGGGTGCAGTGGG - Intronic
1073956872 10:108882789-108882811 CAGAGTGAAGTGGGTGAAAAAGG - Intergenic
1075060308 10:119252460-119252482 AACCCTGAGCTGGGTGCAGAGGG + Intronic
1075553791 10:123414077-123414099 CTGAGTGAGCTGGGTGTATAGGG + Intergenic
1076272621 10:129167548-129167570 ATGAATGCTCTGGGTGAAGATGG + Intergenic
1076434585 10:130431368-130431390 AAGAGGGAGAAGGGTAAAGAAGG - Intergenic
1076642664 10:131929349-131929371 AAGCGTAAGCCGTGTGAAGACGG + Intronic
1077162631 11:1120707-1120729 AAAAGTGAGGAGGGTGCAGACGG + Intergenic
1077464607 11:2727711-2727733 CAGAGTGAGCTGAATGGAGAAGG + Intronic
1077556780 11:3229855-3229877 AAGAGGGAGCTGTCTGATGATGG + Intronic
1078731903 11:13982665-13982687 AAGAGGGAGCTGGGTGAAGAGGG + Intronic
1078904334 11:15670404-15670426 CAAAGTGAGCTTGGTGAACAAGG + Intergenic
1079400766 11:20104619-20104641 AATGGTGTGCTGGGTGATGATGG - Intronic
1080081705 11:28227459-28227481 GATAGTTAGCTGGGTGAAGGAGG + Intronic
1080372676 11:31670002-31670024 AAGGATGAGTTGTGTGAAGAAGG - Intronic
1080686321 11:34518244-34518266 AAGAGTGAGTTGGATGTAGGAGG - Intergenic
1081963996 11:47158441-47158463 AACAGTGGGGTGGGTGGAGAAGG - Intronic
1082219838 11:49621370-49621392 AAGAGAGAGCAGGGTGAGGGGGG - Intergenic
1083166979 11:60895679-60895701 ATGATTGAGCTTAGTGAAGAAGG - Intronic
1083962225 11:66020851-66020873 CAGCGTGAGCAAGGTGAAGAGGG + Exonic
1084190221 11:67495305-67495327 AAGAGCAGGCTGGGTGAAAAGGG - Intronic
1084357746 11:68651233-68651255 AAGACTGCACTGGGTGAGGATGG - Intergenic
1084951502 11:72668723-72668745 AAGAAAGGGCTTGGTGAAGAAGG - Intronic
1085326525 11:75610753-75610775 AAGAGGGTGCTGGGTCAAGAGGG + Intronic
1085750525 11:79157027-79157049 ATGAGTGAGATGGGTTGAGAAGG + Intronic
1085799405 11:79575050-79575072 AAGAGTGACCAGGATGATGAGGG + Intergenic
1085985206 11:81778763-81778785 AAGACTTAGCTGGGTACAGAGGG - Intergenic
1086629792 11:89003407-89003429 AAGAGAGAGCAGGGTGAGGGGGG + Intronic
1087750663 11:102003388-102003410 AAAAGTGGGCTGGGTGCAGGTGG + Intergenic
1088467566 11:110157778-110157800 AAGTGTGAGCTGGGTACAGATGG - Intronic
1088907051 11:114162840-114162862 AAGAGCGAGCTGGGGGAAAGTGG - Intronic
1089254255 11:117186029-117186051 GAGATTGAGCTGGGTGGAGGAGG + Intronic
1089325417 11:117653438-117653460 ATGAATGAGCTGGGGGAAGGGGG - Intronic
1089678209 11:120104728-120104750 AAGAGTTGACTGGGTGGAGAAGG - Intergenic
1089729302 11:120510858-120510880 AGGAGGAGGCTGGGTGAAGAGGG - Intergenic
1090702344 11:129308149-129308171 AAGAGTCAGGAGGGAGAAGAGGG - Intergenic
1091237951 11:134034234-134034256 AAGAGGGAGCTGGGTAGACAGGG - Intergenic
1091761570 12:3090847-3090869 AACAGTGATCTGGGAGGAGAAGG - Intronic
1092041576 12:5389674-5389696 AAGGGTGAGATGGGTGAGGTGGG + Intergenic
1092277511 12:7072970-7072992 AAGAGTTAGCTTTTTGAAGAAGG + Intergenic
1092464978 12:8723147-8723169 AAGATTAAGCTTAGTGAAGAAGG - Intronic
1092505455 12:9093941-9093963 AGGAGTGAGCTGGGGGAGGAGGG + Intronic
1092944616 12:13441264-13441286 ATAAGTGAGCTGGGTATAGATGG + Intergenic
1093144363 12:15546571-15546593 AAGAGTGATTTGGGTGGAGCTGG - Exonic
1093823239 12:23648015-23648037 ATGATTGAGCTTGATGAAGAAGG - Intronic
1094283025 12:28761112-28761134 AAAAGTAAGCTGAGAGAAGAAGG + Intergenic
1094443549 12:30505665-30505687 AAGAGGGTTCAGGGTGAAGAGGG - Intergenic
1096258901 12:50078824-50078846 AGGTGTAAGCTGGGAGAAGATGG - Intronic
1096638872 12:52978473-52978495 AAGAGTGAACTGGGTGAGGAAGG - Intergenic
1097712800 12:62934313-62934335 AAGAGGGAGTGGGGAGAAGAGGG + Intronic
1098393953 12:69998401-69998423 AAGAATTTGCTGGGTGAGGAGGG + Intergenic
1100443318 12:94638175-94638197 AAGAGTGATCTAGCTGGAGAAGG + Intronic
1101003638 12:100380732-100380754 AACATTGAGCTGAATGAAGAAGG + Exonic
1101021469 12:100558508-100558530 AAAAGTTAGCTGGGTGCAGTGGG - Intronic
1101234028 12:102770155-102770177 AAGAGTGGGGTGGGGGAAGGGGG - Intergenic
1101256643 12:102984371-102984393 AAGTGTCAGCCAGGTGAAGATGG + Intergenic
1101909336 12:108850290-108850312 AGGAGGGAGCTGGGGGAAAAGGG + Intronic
1102230078 12:111256332-111256354 AGGAATGAGCTGGGTTCAGAGGG - Intronic
1102250204 12:111381485-111381507 AAGGTTGACCTGGGTGAAGGAGG + Intergenic
1102296893 12:111744137-111744159 AATAGTGAGCTGAGTGATGCTGG + Intronic
1102462153 12:113106492-113106514 AAGAGTGAACTGGGGGCAGTGGG - Intronic
1102672324 12:114630617-114630639 AAGAGTGAGATGTGAGATGAAGG + Intergenic
1103394694 12:120598627-120598649 AAGAATGAGCCTCGTGAAGATGG + Intergenic
1104519596 12:129461156-129461178 AGGAATGAGCTGGGTGGAGGAGG + Intronic
1104708564 12:130968034-130968056 AACAGTGAGCTGTTTCAAGAAGG - Intronic
1105256154 13:18745077-18745099 AAGCGGGACCTGGGAGAAGAGGG + Intergenic
1105683317 13:22752122-22752144 GAGAGGGAGCAGGGAGAAGATGG - Intergenic
1106086489 13:26546913-26546935 AAGCATGAGCTTGATGAAGAGGG - Intergenic
1106101530 13:26697778-26697800 AGGAGTGAGCTGCATGAAGGTGG + Intergenic
1106668827 13:31882985-31883007 GAGAATGAGCTGAGTGAAGGGGG - Intergenic
1107015630 13:35706197-35706219 CAGGGTGAGCTAGGTGCAGAAGG + Intergenic
1107095216 13:36528289-36528311 ATGAGGGAGCTGGCTGGAGAGGG - Intergenic
1107442736 13:40442721-40442743 CAGAGAGAGCTGGGTAAAGATGG + Intergenic
1108088032 13:46816585-46816607 AAGAGTGGCATGGGTGAGGAGGG - Intergenic
1108805830 13:54155140-54155162 AAAAGTGACCTGGGTTTAGAAGG - Intergenic
1109206950 13:59493012-59493034 AAGTGTGACCTGGGTTAGGATGG - Intergenic
1109720754 13:66273320-66273342 AAGAGAGAGGTGGGAGAAGGGGG - Intergenic
1110091238 13:71450604-71450626 ATGATTCAGCTTGGTGAAGAAGG + Intronic
1110485292 13:76033910-76033932 AAAAGTTTGATGGGTGAAGATGG + Intergenic
1110493923 13:76142862-76142884 TAGAGTGAGTTAGGTGAAGAGGG + Intergenic
1111253556 13:85638396-85638418 AAGGGTGAGCAGGGTGGTGAGGG + Intergenic
1112379742 13:98877577-98877599 AGGAGTTGGCTAGGTGAAGAAGG - Intronic
1113173209 13:107530041-107530063 AAGAGTGAGCTGTGGAAAGAAGG - Intronic
1113203336 13:107890183-107890205 AAGAGTGTGCTGTGTGTGGAAGG + Intergenic
1113613437 13:111664287-111664309 GGGAGTGAGCTGGGTTCAGATGG - Intronic
1113636598 13:111923265-111923287 AAGACTGAGAAGGGTGAAGCTGG + Intergenic
1114067198 14:19071450-19071472 AAGATGGAGCTGGGAGTAGATGG + Intergenic
1114095064 14:19328578-19328600 AAGATGGAGCTGGGAGTAGATGG - Intergenic
1114470172 14:22955542-22955564 ATGAGTGAACTGGGGGAAAAGGG + Intronic
1115854918 14:37621121-37621143 GGGAGTGAGCTGGGTAAGGAAGG + Intronic
1116484233 14:45427660-45427682 AAGAGGGACCTGGGGCAAGAAGG + Intergenic
1117373240 14:55097716-55097738 AATAGGGAGCTGGGGGGAGAAGG - Intergenic
1117437863 14:55734260-55734282 AAGAGAAAGTTTGGTGAAGAGGG + Intergenic
1118004977 14:61557559-61557581 GAGAGTGAACTGAGTGATGAAGG + Intronic
1118107346 14:62675023-62675045 AACAGTGGCCTGGGTGAAAAGGG - Intergenic
1118543008 14:66851656-66851678 AAGAGAGAGCTGGGAAAAGTAGG + Intronic
1118692298 14:68351876-68351898 ATGAATTAGATGGGTGAAGAGGG + Intronic
1118774162 14:68963006-68963028 AGGAGTGGGCTGGGTGCAGCTGG - Intronic
1118780529 14:69004842-69004864 CAGGGAGAGCTGGGGGAAGAGGG - Intergenic
1118973151 14:70654242-70654264 CAGAGAGAGCTGGGGGATGAGGG - Intronic
1119780368 14:77272988-77273010 AAGCGTGAGCTGGGTAGAGTGGG - Intergenic
1121708883 14:96022058-96022080 AAGAGTTCTCTGGTTGAAGAAGG - Intergenic
1121985384 14:98500595-98500617 AAGGGAGAGCTGGGTGGAAAGGG - Intergenic
1122140032 14:99657535-99657557 AAGTGTGAGCTGGCTGGAGCAGG + Intronic
1122461468 14:101899214-101899236 AAGAGGCAGGTGGGTGAAAACGG - Intronic
1123034930 14:105468080-105468102 AGGGGCCAGCTGGGTGAAGACGG + Intronic
1202835858 14_GL000009v2_random:76951-76973 AAGTGGGACCTGGGAGAAGAGGG - Intergenic
1124801451 15:32837039-32837061 CAGAGTGAGAAGGATGAAGATGG - Intronic
1125094712 15:35837943-35837965 AAGACTGAGTTGAGTGAAGTGGG - Intergenic
1125107336 15:35988028-35988050 AAGAGTGAGTTGGGGGAACTTGG + Intergenic
1126376711 15:48004291-48004313 AAGAGTAAGGTGGGGGAAAATGG + Intergenic
1127681976 15:61306271-61306293 AGGAGTGAGCTAGGTGAAGAGGG + Intergenic
1127731737 15:61808270-61808292 AAGAGTGAGATGGTTGAAGAGGG - Intergenic
1127842980 15:62846523-62846545 GAGAGGGAGCTGGGGGCAGACGG + Intergenic
1127992679 15:64132471-64132493 AAGAGTGAGGTGCTTGACGAGGG - Intronic
1128143988 15:65322182-65322204 GAGAGGGAGCAGGGAGAAGAAGG - Intergenic
1128652673 15:69430560-69430582 AGGAGTGAGCTGTATGAAGCAGG + Intronic
1128713907 15:69893122-69893144 ACGAGTGGGCAGGGTGAACAAGG - Intergenic
1129164411 15:73768190-73768212 ATCAGTGAGCTTGCTGAAGAGGG + Intergenic
1130515959 15:84625936-84625958 AAAAGGGAGCAGGGTGAACAGGG - Intronic
1130744567 15:86637324-86637346 AGGAATGACCTGGGTGAAGGAGG + Intronic
1131251937 15:90836751-90836773 AAGAGATAGGTGGGTGATGAGGG - Intergenic
1131379853 15:91954705-91954727 ATGAGTGAGGGGGGTAAAGATGG + Intronic
1132210650 15:100019845-100019867 AAGTGTGAGCTGGAGGGAGATGG - Intronic
1132542076 16:514881-514903 CAGAGTGAACTGGGTGAACGTGG + Intronic
1133791776 16:9014559-9014581 TGGAGTGAGCTGGGTGGAGAGGG - Intergenic
1133866439 16:9648125-9648147 AAGTGTGAGATGGGACAAGAGGG + Intergenic
1133898313 16:9949906-9949928 AAGTGAGAGCTGGATGAACAGGG + Intronic
1134792166 16:16998853-16998875 AAAAATGGACTGGGTGAAGAAGG + Intergenic
1135522596 16:23188962-23188984 CAGAGTGAGCTGGGTGGAGAAGG + Intronic
1135895393 16:26396431-26396453 AAGGGTGAGCTGTGGAAAGAAGG - Intergenic
1136007718 16:27342316-27342338 AAGAGTGAGCTGGGTCCAGGTGG + Intronic
1137719129 16:50617487-50617509 CAAAGGGAGCCGGGTGAAGATGG + Intronic
1138012307 16:53394015-53394037 AAGAGTAAGCTTGGTGAGGGTGG + Intergenic
1139328441 16:66169416-66169438 AAGAGAGAGGTGGGGAAAGAAGG + Intergenic
1140239278 16:73186376-73186398 GAGAGTGAGCTAGGTGAGGGGGG - Intergenic
1140758545 16:78090680-78090702 ATGAGTGGACTGGGTGAATAGGG + Intergenic
1141322784 16:83027412-83027434 AAGAGTTAACAGGGTGAAGAAGG + Intronic
1142304706 16:89278761-89278783 GAGAGTGAGCGGCGTGAAGGGGG + Intronic
1142608761 17:1096663-1096685 AGGAGAGAGCTGGGGGAAGGTGG + Intronic
1143775869 17:9198426-9198448 AAGTGTGAGCTGCGTGCAGCTGG + Intronic
1144156915 17:12513331-12513353 AAGAATGGGGTGGGTGAAAAAGG + Intergenic
1144748067 17:17628913-17628935 ATGAGTGAGCAGGGTACAGAGGG - Intergenic
1146525809 17:33566076-33566098 AAGGGAGAGCTGAGTGAGGAGGG - Intronic
1146767118 17:35533594-35533616 AAGAGTTAATTTGGTGAAGAAGG + Intronic
1146835667 17:36108652-36108674 GAGAGTGAGCTGGGGGAGGTGGG - Intergenic
1146850299 17:36215922-36215944 GAGAGTGAGCTGGGGGAGGTGGG - Intronic
1146941665 17:36847691-36847713 AAGAATTGGCTGGGTGAAGTGGG - Intergenic
1147637920 17:41975196-41975218 AAGACTGAGCTGGGCACAGAAGG - Exonic
1147766683 17:42841484-42841506 TAGAGTGACCTGAGAGAAGAGGG - Exonic
1148517571 17:48235102-48235124 AAGACTGAGCTGGGTTTTGAAGG + Intronic
1149433168 17:56610781-56610803 AAGAGTGAGCTGGGCAAAATGGG + Intergenic
1149553558 17:57557477-57557499 AGAAGTGAGCTGGGTGGTGATGG - Intronic
1149599060 17:57881639-57881661 CAGAGTGAGGTGGGTGAGCAGGG + Intronic
1150449206 17:65251693-65251715 ATGAGTGAGGTGAGTGCAGAGGG + Intergenic
1151156233 17:72124359-72124381 TCGAGTGAGCTGTGTGTAGACGG - Exonic
1152130425 17:78472823-78472845 AAGGGTGACCTGGGTGGAGCTGG - Intronic
1152631328 17:81411855-81411877 AAGAGTGACCAGGGTGTGGAGGG - Intronic
1153126533 18:1798656-1798678 ACGATTAAGCTGGGTGAGGAAGG + Intergenic
1154070044 18:11146152-11146174 AAGAATGAGCTGGATAAAGAAGG + Intronic
1154096758 18:11424226-11424248 AGGAGTGAGGTGGGTTCAGAAGG - Intergenic
1154501821 18:15001162-15001184 CAGAGTGAGCTGGGGAAAGCGGG + Intergenic
1155195759 18:23472372-23472394 AGGAGTCAGCTGGGAGAATATGG + Intronic
1155367482 18:25063292-25063314 AAGAGTTAGCTGGCTGATGATGG + Intronic
1157189563 18:45569256-45569278 AAGAGAGAACTGGGTTTAGACGG - Intronic
1157484696 18:48078529-48078551 AAGAGTGAGTTGGGTGTACTGGG + Intronic
1157761768 18:50270553-50270575 AAGACTGCTCTGGCTGAAGAGGG + Intronic
1159060357 18:63508147-63508169 AGGGGTGAGCTGGGGGAGGAGGG + Intergenic
1159730659 18:72023135-72023157 ATGTGTGAGTTGGGGGAAGAGGG - Intergenic
1160063079 18:75549948-75549970 AAGAGGAAGCCCGGTGAAGATGG + Intergenic
1160197276 18:76766352-76766374 AAGGGAGAGCTGCGTGAAGCTGG + Intergenic
1161771990 19:6235846-6235868 AGGGGTGAGCTGGGTGGAGGAGG - Intronic
1162125218 19:8495973-8495995 AAGTTTGTGCTGGGTGAATAGGG - Intronic
1163643094 19:18472966-18472988 TAGAAGGAGCAGGGTGAAGATGG + Intronic
1163811177 19:19432767-19432789 CAGAGTGAGCAGGCTGAAGTGGG + Intronic
1165700380 19:37932847-37932869 AAGAGTGGGCCGGGTGTTGACGG + Intronic
1166181368 19:41111584-41111606 AAGAGTGAGGTGACTGAAGAGGG + Intergenic
1167357977 19:49015739-49015761 AAGAGGGAGCTCGGCGTAGAAGG + Intronic
1167472946 19:49685586-49685608 ATGTGTGAGCCGGGTGAAGCTGG + Intronic
1167485286 19:49759172-49759194 AAAAATTAGCTGGGTGAAGCCGG + Intronic
1167639369 19:50672233-50672255 AAGGGAGAGCAGTGTGAAGACGG + Intronic
1202636779 1_KI270706v1_random:50412-50434 AAGTGGGACCTGGGAGAAGAGGG + Intergenic
924977822 2:193971-193993 AAGGGAGAGCTGGGCAAAGATGG + Intergenic
925535146 2:4908765-4908787 AAGAGCGAGCTGGCTGAGGCTGG - Intergenic
926052002 2:9751315-9751337 GACAGTGAGCTGGGTGAGGAAGG - Intergenic
926775688 2:16420297-16420319 AAGAGTTTACTAGGTGAAGAGGG + Intergenic
926803395 2:16682619-16682641 AAGAGTGGGCAGGTTGAGGAGGG + Intergenic
930243943 2:48964303-48964325 AAGAGATAGCTGGATCAAGATGG - Intronic
930999589 2:57764435-57764457 AAGAGAGAGCTGGAAGAAGCAGG + Intergenic
931061452 2:58534016-58534038 AAGAATGAGCTTGGGGAAGTGGG + Intergenic
931135426 2:59394493-59394515 AATAGATAGCAGGGTGAAGAGGG - Intergenic
931642901 2:64396973-64396995 ACAACTGAGCTGGGTGAAGATGG - Intergenic
932168887 2:69535618-69535640 AACAGAGACCTGGATGAAGAAGG + Intronic
932302472 2:70676906-70676928 AAGAGTGAGCTGGCTGTTCAGGG + Intronic
932836051 2:75038541-75038563 AAAATTAAGCTGGGTGAAGTTGG + Intergenic
932841604 2:75088321-75088343 AGGAGTTAGCTGCGTGGAGAGGG - Intronic
933352463 2:81172157-81172179 AGGAGTTAGCCAGGTGAAGAAGG - Intergenic
933635176 2:84700970-84700992 AGGAGTTAACTAGGTGAAGAGGG + Intronic
934552261 2:95269648-95269670 ATGAGTGAGCCTGGTGAGGAAGG - Intergenic
934974418 2:98790550-98790572 AAGAATCAGCTGTGTCAAGAGGG - Intergenic
935092635 2:99910949-99910971 CAGAGTGAGCTTGGATAAGAGGG - Intronic
936471952 2:112806636-112806658 AAGCGAGAGATGGGGGAAGAGGG - Intergenic
936968553 2:118151734-118151756 AAGAGGGATGTGGGTGAACAAGG + Intergenic
937439864 2:121906427-121906449 AAGGGAGAGCTGTCTGAAGAGGG - Intergenic
938501002 2:131831331-131831353 CAGAGTGAGCTGGGGAAAGCGGG + Intergenic
938640264 2:133270490-133270512 AATAGTGAGGTAGGTGAATAGGG + Intronic
938944127 2:136195582-136195604 CAAAGTGAGCTGGGGGAAGATGG - Intergenic
939017510 2:136919758-136919780 AAGGGTGAGCCAGGTGCAGAGGG + Intronic
939018920 2:136935773-136935795 AAGAGTGTGCTCTGTGAAGGGGG + Intronic
940168325 2:150799755-150799777 AAAAGTGAGTGGGGTGATGAAGG - Intergenic
940282217 2:152000151-152000173 AAGAGTGAGGTGGGTGGTGGAGG - Intronic
940906545 2:159174897-159174919 CAGAAGGAGCTGTGTGAAGAGGG + Intronic
941067267 2:160917512-160917534 AACATGGAGGTGGGTGAAGAGGG - Intergenic
941079618 2:161045533-161045555 TAGAGAGTGGTGGGTGAAGATGG - Intergenic
941327478 2:164134799-164134821 AAGAGGGAGCAGGGTAAGGAAGG + Intergenic
941612964 2:167683952-167683974 AAGAAAGAGATTGGTGAAGAAGG - Intergenic
941841216 2:170086778-170086800 AAAAGTGAGCTAAGTGAAGAGGG + Intergenic
942893278 2:181017922-181017944 AAGACTGAGCTGGAAGATGATGG - Intronic
944634106 2:201657832-201657854 GAGCATGAGCAGGGTGAAGAAGG - Intronic
945339891 2:208639992-208640014 AACAGTTAGCTGTCTGAAGAAGG + Intronic
945396559 2:209325321-209325343 AGGAGGGAGCTAAGTGAAGATGG - Intergenic
945915808 2:215702798-215702820 AGCAGAGAGCTGGGTGGAGAAGG + Intergenic
945931134 2:215855615-215855637 GAATGAGAGCTGGGTGAAGAGGG - Intergenic
946013431 2:216584837-216584859 AGGGCTGAGCTGGGTGAGGAGGG + Intergenic
946328019 2:218994709-218994731 CAGAGTGAGCTGGGAAAAGGCGG + Intergenic
946891587 2:224282598-224282620 AAGACTGGGCTGGGTTGAGATGG - Intergenic
946940021 2:224760724-224760746 AAGAGGGAGATGGGTGATGCAGG + Intergenic
947479066 2:230480868-230480890 GTGAGTGAGCTGGGAGAAGGTGG + Intronic
947677110 2:231992266-231992288 AAGAGTGAGGTTGGAGTAGAGGG + Intronic
947831412 2:233144328-233144350 AAGAGTGGGAGGGGTGGAGATGG + Intronic
947941575 2:234060654-234060676 AAGAATAAGCTGGGAGAAGTAGG - Intronic
948637560 2:239349177-239349199 AAGAGTGAGCCGGGTGGGCAGGG + Intronic
1168730944 20:80182-80204 ACCAGTGATCTGGGTGCAGAAGG + Intergenic
1168761730 20:354213-354235 ATAGGTGAGGTGGGTGAAGAAGG + Exonic
1168836878 20:883516-883538 AAGAGAGGGCTGGATGGAGATGG - Intronic
1169416048 20:5417037-5417059 CAGAGTTAGCTGGGTGCAGTGGG + Intergenic
1169696001 20:8387220-8387242 AAGATTAAGCTGAGTGAGGAAGG - Intronic
1169942913 20:10957000-10957022 AAGAGTGTGTTTTGTGAAGAAGG - Intergenic
1169953096 20:11069931-11069953 AAGAGGGAGCTCTGAGAAGACGG - Intergenic
1169977229 20:11343439-11343461 AAGAGTACTCTGGGTAAAGAAGG + Intergenic
1170603631 20:17860034-17860056 AAGAGTGGGCAGGGTGGAGCAGG - Intergenic
1171163846 20:22953387-22953409 GAGAGTGAAGTGGGTGCAGAGGG + Intergenic
1171221400 20:23401162-23401184 AAGTGGGAGCTGGGTGCACAAGG + Intronic
1171880892 20:30616828-30616850 AAGTGGGACCTGGGAGAAGAGGG + Intergenic
1172106998 20:32522859-32522881 CACAGTCAGCTGGGAGAAGAGGG + Intronic
1172448665 20:35006567-35006589 AAGGATGTGCTGGGTGAGGAGGG + Exonic
1172793903 20:37524196-37524218 AGCATTAAGCTGGGTGAAGAAGG - Intronic
1173585720 20:44181716-44181738 AGGAGTGAGCCAGGTGACGAGGG - Intronic
1173726713 20:45303567-45303589 AAGAGAGAGCTGGATGGGGATGG + Intronic
1173823908 20:46035338-46035360 TGGAGTGAGCTGGGTGGCGAAGG - Intronic
1173867448 20:46321648-46321670 AGGAGTTAGCTGGGGGAAGTAGG - Intergenic
1174858622 20:54069574-54069596 AACATGAAGCTGGGTGAAGAGGG - Intronic
1175289801 20:57868160-57868182 AGGAGTGAGGGGGGTGAGGAAGG - Intergenic
1176715505 21:10346212-10346234 AGGAGTTGGCTAGGTGAAGAAGG + Intergenic
1176842157 21:13850101-13850123 AAGCGGGACCTGGGAGAAGAGGG + Intergenic
1177120588 21:17132769-17132791 CCCAGTGATCTGGGTGAAGAAGG + Intergenic
1177649702 21:23944901-23944923 AAGAGGGAGGTGGGGAAAGAGGG - Intergenic
1177816867 21:25987267-25987289 ATGAGTGAGCAGGCTGAAGGAGG - Intronic
1180364092 22:11923901-11923923 AAGTGGGACCTGGGAGAAGAGGG - Intergenic
1180485674 22:15794017-15794039 AAGATGGAGCTGGGAGTAGATGG + Intergenic
1181487537 22:23241201-23241223 AAGACCGAGATGGGGGAAGAAGG + Intronic
1182007173 22:26970475-26970497 GAGATTGGGCTGGGTGGAGATGG + Intergenic
1183698495 22:39436760-39436782 GAGAGTGAGCTGGGTCCTGAAGG - Intronic
1184259093 22:43304470-43304492 AAGAGTGTGCTGTGAGAAGCAGG + Intronic
1184445604 22:44545171-44545193 CCGGGTGAGCTGGGTGGAGATGG - Intergenic
1184460362 22:44634345-44634367 CCTAGTGAGCTGGGTGAAGGAGG + Intergenic
949149727 3:752017-752039 AGGAGTGAGTTGGGGGAAGGGGG - Intergenic
949517878 3:4823660-4823682 AAGAGTGAGTTAGGGGAAAAAGG + Intronic
949615700 3:5751711-5751733 AGGAGTAAACTAGGTGAAGATGG - Intergenic
949838051 3:8290759-8290781 AAGAGGCAGATGGGTGAGGAGGG - Intergenic
950042859 3:9931310-9931332 AAGACTGAGCTAGGGGAAGGGGG + Intronic
950515675 3:13463440-13463462 AGGGGTGAGCTTGGTGAGGAGGG + Intergenic
950789714 3:15462424-15462446 CTGAGTGAGCGGGCTGAAGAAGG - Intronic
950905106 3:16530835-16530857 AAAAGTTTACTGGGTGAAGAGGG + Intergenic
952278721 3:31902871-31902893 AAGGGTGAGCAGGGTGAAACAGG - Intronic
952970200 3:38645840-38645862 AAGAGTTTGATGGTTGAAGAGGG - Intronic
953106280 3:39883241-39883263 AAGAGTGAACTGGATGTGGAAGG + Intronic
954152186 3:48663086-48663108 AGGAGGGAGGTGGGTGAAGGCGG - Intergenic
954634390 3:52063696-52063718 AGGCGAGAGCTGGGAGAAGAGGG - Intergenic
955286657 3:57647890-57647912 GAGAGTGAGCAGGGTAAGGAGGG + Intronic
955286809 3:57649757-57649779 GAGAGTGAGCAGGGTAAGGAGGG - Intronic
956060195 3:65341164-65341186 AAGAATGAGATGGGAGAGGAGGG + Intergenic
957374174 3:79335502-79335524 AAGTGAGAGCTGAGTGAAGGGGG - Intronic
957636394 3:82791029-82791051 GAGAGTGAGGTAGGTAAAGAGGG - Intergenic
961168632 3:124780377-124780399 AACACTGAGCTGGGTGAGGATGG - Intronic
961352141 3:126310920-126310942 GAGAGAGAGCAGGGTGGAGATGG - Intergenic
962159841 3:132987594-132987616 AAGAGTGAGGTGTTTGAAGAAGG + Intergenic
962377415 3:134870139-134870161 GAGAGTGAGCTGGGTCTATATGG + Intronic
962471313 3:135711690-135711712 AAGAGCTCTCTGGGTGAAGAGGG - Intergenic
962646382 3:137444933-137444955 AAGAGGGAGCTGTGAGAAGAGGG - Intergenic
963554097 3:146764323-146764345 TAGAAAGAGCTGGTTGAAGATGG - Intergenic
966702431 3:182869973-182869995 AAGAGTGTGCTGAGTGAAAGAGG + Intronic
968443461 4:636275-636297 ACGAGTGAGCAGGGAGCAGAGGG + Intronic
968724836 4:2241965-2241987 AAGAGGCACCTGGGTGCAGACGG + Intronic
968873184 4:3251842-3251864 AAGAGTGGGCTGGCTCAAGTAGG + Intronic
969155853 4:5209154-5209176 AACAGTAGGGTGGGTGAAGAGGG + Intronic
969307737 4:6335463-6335485 AGGAGTGAGCAGGGGGAACAGGG + Intronic
969855921 4:9999609-9999631 AGGAGTGGGCTGGATGAAGTTGG + Intronic
971047732 4:22824382-22824404 GAGAGTGAGGTGGGTGGGGATGG + Intergenic
971219920 4:24695713-24695735 ATGGCTGAGCTGGGAGAAGAAGG + Intergenic
972011226 4:34184805-34184827 GACAATGAGCTGGGAGAAGAGGG - Intergenic
973394025 4:49578653-49578675 AAGCGGGACCTGGGAGAAGAGGG - Intergenic
974093507 4:57336897-57336919 AAGTGTGGACTGGGTCAAGATGG - Intergenic
974551384 4:63379671-63379693 AAGGGTGAGCAAGGTGGAGATGG - Intergenic
975454958 4:74579212-74579234 AAGACTGAAATGGGTGAACAAGG + Intergenic
976430071 4:84952577-84952599 AAGAATAAGCTGGAAGAAGAAGG - Intronic
977215836 4:94282554-94282576 AAGATTGAGCTTAGTAAAGAAGG + Intronic
977565335 4:98574935-98574957 AAGAGCTAGCCAGGTGAAGAGGG + Intronic
979322485 4:119340762-119340784 AAGAGTTAGCTGGATCGAGAAGG - Intergenic
981554361 4:145976903-145976925 GAGACTGAGCAGGGTGAGGAGGG + Intergenic
981803767 4:148688821-148688843 AAGAGTGAGCTGAGTTCGGATGG + Intergenic
982034348 4:151331081-151331103 GAGAGAGAGATGGATGAAGAGGG + Intergenic
982655160 4:158139341-158139363 ATGAGTGAGCTGAGTGGAGCTGG - Intronic
983184595 4:164687596-164687618 TAGAGTGAGTTGCTTGAAGATGG - Intergenic
983240463 4:165226375-165226397 AAGAGTTAGCTGGATCGAGAAGG - Intronic
983597204 4:169483040-169483062 AAGATTAAGCTTGGTGATGAAGG - Intronic
983639670 4:169933409-169933431 TAGAGTGACCTGGGGGAGGATGG + Intergenic
983983470 4:174028055-174028077 ACGTGTAAGCTGGGTGAAGGTGG + Intergenic
985322795 4:188733633-188733655 AAGTGTGTGCTGGGTAAAGTTGG - Intergenic
986157445 5:5190812-5190834 AAGAGCCAACTGGGTGAGGAGGG - Intronic
986460603 5:7967104-7967126 AAGAGGGAGGTGGAAGAAGAAGG + Intergenic
986532043 5:8747785-8747807 TAAAGGTAGCTGGGTGAAGAAGG - Intergenic
987723375 5:21665751-21665773 CAGAATGAGATGGGTGGAGAAGG + Intergenic
988018742 5:25596286-25596308 AGGGGTGAGCTGAGAGAAGATGG + Intergenic
989468536 5:41786402-41786424 AACAGTGAGCTGGAAGAGGAGGG + Intronic
990216669 5:53540583-53540605 AAGAGAGAGATAGGTGAAGCTGG + Intergenic
990222660 5:53610117-53610139 ATGATTAAGCTAGGTGAAGAAGG - Intronic
990850135 5:60193876-60193898 GAGAGTAAGCTGGGTGAGGAAGG - Intronic
991127878 5:63088080-63088102 AAGAGGGAGCTGGGAAGAGAAGG + Intergenic
991589143 5:68230891-68230913 AAGAGTGTGCTGGGTGTGCAAGG + Intronic
992488694 5:77220107-77220129 AAGAGTCTACTGGGTGAGGAGGG - Intronic
994223788 5:97228587-97228609 TTGACTGAGCTGGGGGAAGAAGG + Intergenic
994306375 5:98210223-98210245 AAGAGTTAACTGGGTGAATGAGG - Intergenic
994985538 5:106928433-106928455 CAGAAAGAGCTGGGGGAAGATGG + Intergenic
996365558 5:122696904-122696926 AAGAGAGAAGTGGGGGAAGAAGG + Intergenic
996453413 5:123653909-123653931 AAAAGTGAGGTAGGAGAAGATGG + Intergenic
998446774 5:142204868-142204890 AAGGGAGAGCTGGGTGATGATGG - Intergenic
998463085 5:142323829-142323851 GACAGTGAGCTGGGTGAGGGCGG - Intronic
998515528 5:142750293-142750315 TAGATTGAGCTGGGGGAAGAGGG - Intergenic
998874269 5:146583599-146583621 ATCTGTGAGCTGTGTGAAGATGG + Intronic
999340366 5:150764951-150764973 CAGACAGAGCTGTGTGAAGAGGG + Intergenic
999891467 5:155982552-155982574 GAGAGAGAGCTGGCTGAGGAAGG - Intronic
1000396378 5:160778968-160778990 AAGAGTGACCGTGGTAAAGAGGG + Intronic
1000507177 5:162135785-162135807 AAGAGGAAGCAGGGTGAGGAAGG + Intronic
1000657490 5:163898434-163898456 ATGATTAAGCTTGGTGAAGAAGG + Intergenic
1001084635 5:168691748-168691770 AGGAGGCAGCTGGGTGTAGAAGG + Intronic
1002462151 5:179379400-179379422 AGGAGGCAGCTGGGTGAAGGTGG + Intergenic
1002773100 6:305970-305992 AATAGTGAGCTGGGGGGATACGG - Intronic
1003003854 6:2362326-2362348 AAGAGAGAGGTGGGTGGGGAGGG - Intergenic
1003338728 6:5199360-5199382 AAGAGTGGGTTGGGGGAAAATGG + Intronic
1003731371 6:8828271-8828293 AAGATTTAGCTAGGTGAAGGAGG - Intergenic
1004590603 6:17047632-17047654 AGAAGAGAGCTGGGTGCAGAAGG + Intergenic
1005838599 6:29725310-29725332 AGGAGGGAGATGGGTAAAGAGGG + Intronic
1006442180 6:34059597-34059619 AAGAGGGAGCTGTGGGCAGAAGG - Intronic
1006609718 6:35287004-35287026 TAGACTTAGCTGGGGGAAGAGGG + Intronic
1006844188 6:37051225-37051247 AGGAGAGGGCTGGGTGAAGGAGG - Intergenic
1007167533 6:39839557-39839579 AAGAATGAGAAGGGTGCAGATGG + Intronic
1007318558 6:41009612-41009634 AAGAGTGGGCTGGGTAGGGAGGG + Intergenic
1007722095 6:43891075-43891097 AAGAATGAGATGGGAAAAGAGGG - Intergenic
1008102343 6:47405526-47405548 AAGAGTGAGGTGGGTGAAACTGG + Intergenic
1010265029 6:73856329-73856351 AACAGGGAGAAGGGTGAAGATGG + Intergenic
1010754816 6:79655199-79655221 ATGAGTTAGCTAGGTGAAGCTGG + Intronic
1011054869 6:83193762-83193784 TACAGTGAGCTGGGGGAAGGGGG - Intronic
1011596793 6:89024294-89024316 AAGAGTTAACTGGGCAAAGAGGG + Intergenic
1011601238 6:89062189-89062211 AAAAATTAGCTGGGTGGAGAGGG - Intergenic
1013080595 6:106808631-106808653 AAGAGAGAGCAGGGGGAAAAGGG - Intergenic
1013271474 6:108549634-108549656 AAGAGGGAAATGGGTCAAGATGG + Intergenic
1013611545 6:111800505-111800527 AAAAGTGAGCTTGATGCAGAAGG + Intronic
1014917082 6:127163767-127163789 AACAGTGAGCTTGGTGAAAAAGG - Intronic
1015185640 6:130412567-130412589 AAGTCTGAGCTGGGTAAAGAGGG - Intronic
1015225529 6:130852904-130852926 AGGAGTTAGCTCTGTGAAGAAGG - Intronic
1017236175 6:152119589-152119611 AAGTGAGTGCTGGGTGAGGAAGG - Intronic
1017352840 6:153463390-153463412 AATAGTGGGCTGGGGGAAGAGGG + Intergenic
1017522218 6:155212758-155212780 AAGAGTGAGCAGAGTGGTGAGGG + Intronic
1017875398 6:158520084-158520106 GAGAGTGGCCTGGGGGAAGAGGG - Intergenic
1018024148 6:159790654-159790676 GCGAGTGAGCTGGGAGAAGGGGG - Intronic
1018345570 6:162895555-162895577 AAGATCGGGCTGGGTGAAGAAGG - Intronic
1018945972 6:168346712-168346734 AAAACTGAGCAGGGTGCAGAAGG - Intergenic
1020369862 7:7420068-7420090 AAAAGTGATCTAGGAGAAGAGGG - Intronic
1020410524 7:7887001-7887023 AGGATTTAGCTGGGTGAAGAAGG - Intronic
1020890816 7:13875965-13875987 AAGAGATAGCTGGATGAAGATGG + Intergenic
1022054534 7:26716854-26716876 AAAAGTTAGCTGGGGCAAGATGG - Intronic
1022077670 7:26989031-26989053 AAGAATGACCTGAGTGAATAGGG - Intronic
1023188956 7:37558754-37558776 AAGACTTAGGTAGGTGAAGAAGG + Intergenic
1023562548 7:41491072-41491094 TAGAGAGTGCTGGGGGAAGAAGG - Intergenic
1023719749 7:43080512-43080534 AAGAGTAAGCATGGTGATGATGG + Intergenic
1024197724 7:47075862-47075884 AATCATGAGCTGGGTGATGAGGG - Intergenic
1024279287 7:47706179-47706201 AATAGAGAGCTGGGTGCAGGTGG + Intronic
1024953595 7:54892123-54892145 AAGGGGGAGCTGGGTGGAAATGG - Intergenic
1027057728 7:75061572-75061594 AAGAGAGGGCTGGGAGGAGAAGG - Intronic
1028455372 7:91032564-91032586 AAGAGAAAGCAGTGTGAAGAGGG + Intronic
1029542892 7:101194926-101194948 AAGAGTGAGCAGGATTTAGATGG - Intergenic
1030155161 7:106447597-106447619 AATAGTGAGTTTGGGGAAGAAGG + Intergenic
1031735868 7:125360749-125360771 ATGATTGAGCTTGGTGAGGAAGG - Intergenic
1031878804 7:127172935-127172957 AATTGTGAGCTGGCTTAAGATGG + Intronic
1032303608 7:130712382-130712404 AGGAGAGAGCTGCGTGGAGAGGG - Intergenic
1033426519 7:141249550-141249572 AAGAGTGAGAGGGCAGAAGAAGG + Intronic
1034219084 7:149430758-149430780 AAGAGAGAGCTGGAGGGAGATGG + Intergenic
1035160723 7:156948753-156948775 AGCAGTGAGCTGGGGGAAGACGG - Intergenic
1036644034 8:10601161-10601183 AAGAGGAAGATGGGTGAAGAGGG + Intergenic
1037154589 8:15684520-15684542 AACAGTGATCTAGGTGCAGAAGG - Intronic
1037666171 8:20972129-20972151 AAAAGTGAGGTGGATGAAGCTGG - Intergenic
1037812679 8:22096295-22096317 AAGGGTGAGTAGGGTAAAGAGGG - Intronic
1038290834 8:26248540-26248562 AATAGTGAGCTGTGTGAACTGGG - Intergenic
1039269782 8:35868261-35868283 CAGAGAGTGCTGGGTGGAGAGGG - Intergenic
1039998212 8:42553691-42553713 AAGAGTGAGCTGGCTGGGCACGG + Exonic
1040489771 8:47909111-47909133 AAGAGTGTTATGGCTGAAGATGG - Intronic
1040626605 8:49157155-49157177 AGGAGTGAGCAGGGAGAAGATGG - Intergenic
1040892885 8:52336045-52336067 AGGAGTTAACTAGGTGAAGAGGG - Intronic
1041085574 8:54253416-54253438 AAGAGGGAGATGGCAGAAGATGG + Intergenic
1041723794 8:60999684-60999706 AAGAGGGAGCTAGGTGGAGAAGG + Intergenic
1041907847 8:63053238-63053260 AAGAGTAATTTGGGGGAAGATGG + Intronic
1042490330 8:69390592-69390614 AAGAATTAGCTGGATGAAGAGGG - Intergenic
1042834885 8:73070479-73070501 ACAAGTGAGGTGGGTGGAGAGGG - Intronic
1043120661 8:76319220-76319242 AAGAGAGAGATGGAGGAAGAAGG + Intergenic
1043564272 8:81530809-81530831 AAGAGAGAGCAGTGTGAAAATGG + Intronic
1043973683 8:86561930-86561952 GAAAGTTAGCTAGGTGAAGAAGG + Intronic
1044021617 8:87112148-87112170 AAGAGTGAGCAGGCAGATGATGG - Intronic
1044498173 8:92916082-92916104 AGGAGAGGGTTGGGTGAAGAAGG + Intronic
1044569075 8:93698276-93698298 AGGAGTCAACTAGGTGAAGAGGG - Intergenic
1046040705 8:108900289-108900311 ATGAGTGAGCTTAGTGATGAAGG + Intergenic
1046653007 8:116859813-116859835 ATGAATAAGCTTGGTGAAGAAGG + Intronic
1047066020 8:121284086-121284108 AAGAGAGAGACGGGAGAAGATGG - Intergenic
1047358975 8:124150299-124150321 AAGGGTGAGGTGGGAGAAGCTGG - Intergenic
1047480022 8:125272962-125272984 AAGAGGGAGCTGGGTGACACGGG + Intronic
1047749099 8:127866563-127866585 AGGAGTGGGCTGGGTGAGCATGG + Intergenic
1049255865 8:141613474-141613496 GAGAGTGGGCTGGGAGGAGAAGG + Intergenic
1051053577 9:12957683-12957705 AAAAGTGAGAAGGGTGAAGGAGG - Intergenic
1051158472 9:14178121-14178143 AAGAATGAGGTGGGAGAAGAGGG - Intronic
1051358550 9:16262072-16262094 AAGACTGAGCACGGTAAAGAAGG - Intronic
1051535881 9:18157071-18157093 AAAAGTCAGCTTGGTGAAGATGG + Intergenic
1051665022 9:19460984-19461006 GAGAGTGAGAAGGATGAAGATGG - Intergenic
1051857474 9:21585494-21585516 AAGGAGGAGCTGTGTGAAGATGG + Intergenic
1052030107 9:23618927-23618949 CAGAGTGAGCAGGGAGAAGGAGG - Intergenic
1052259653 9:26499281-26499303 TAGAGTGAGGTTGGAGAAGAAGG + Intergenic
1052385328 9:27816377-27816399 AAGAGTGTGTTGGGTAATGAGGG + Intergenic
1053441672 9:38121302-38121324 AGGAGTGAGCTAGGTGATGAAGG + Intergenic
1053478256 9:38397219-38397241 GGGAGGGAGCTGGGTGAGGATGG + Exonic
1053578955 9:39383112-39383134 ATGATTGAGCTGAGTGAGGAAGG - Intergenic
1053843467 9:42211187-42211209 ATGATTGAGCTGAGTGAGGAAGG - Intergenic
1054100538 9:60941916-60941938 ATGATTGAGCTGAGTGAGGAAGG - Intergenic
1054121934 9:61217541-61217563 ATGATTGAGCTGAGTGAGGAAGG - Intergenic
1054585808 9:66964970-66964992 ATGATTGAGCTGAGTGAGGAAGG + Intergenic
1054877629 9:70113120-70113142 AAGAGTGAACTGGGTGAGCTGGG + Exonic
1055105168 9:72504660-72504682 AAGGGTGAGATGGGAGAAGCTGG + Intergenic
1055437492 9:76307246-76307268 AAGAGTCAGCCGGGTATAGATGG - Intronic
1055646746 9:78368533-78368555 AAGAGAAAGCTGGGTAAAGTAGG - Intergenic
1055755794 9:79555959-79555981 AGGAGTGTGCTAGGTGAACAGGG - Intergenic
1055985862 9:82056251-82056273 AAGTGGGACCTGGGAGAAGAGGG - Intergenic
1056307453 9:85303946-85303968 AAGAGTGGGCAGGGTGAAGGGGG + Intergenic
1056433942 9:86557109-86557131 AAGAGTGAGCTAAGTGAGGTGGG + Intergenic
1056835978 9:89955416-89955438 AAGTGTGAGATGGGAGAAGTGGG - Intergenic
1057834152 9:98430671-98430693 AAGAGAGAGCTGCATGGAGAGGG - Intronic
1058885222 9:109317865-109317887 AAGAGTGAGCCCAGTGAAGTGGG + Intronic
1059437799 9:114287062-114287084 GAGAGTGGGCAGGGTCAAGAAGG + Intronic
1059817458 9:117933582-117933604 AAGAGTCAGGTAGGTGAAGATGG - Intergenic
1060446414 9:123692381-123692403 AAGAGTGGGCTGGGCCAATAGGG + Intronic
1060528444 9:124333577-124333599 AAGAGTGAGGTGGGTGAGTGAGG + Intronic
1061363886 9:130160457-130160479 GAGAATGAGCTGAGTGAAAAGGG + Intergenic
1061640713 9:131952724-131952746 GAGAGAGAGCTGCGTGGAGAGGG - Intronic
1061884482 9:133584728-133584750 AAGGATGGGCTGGGAGAAGAAGG + Intronic
1061928698 9:133821006-133821028 GAGAGTGGGCTGGGTCCAGAGGG - Intronic
1062498669 9:136843188-136843210 CAGAGTGAGCTGGGGAAAGCGGG - Intronic
1186058644 X:5679713-5679735 ATGAGGGAGTTGGGTAAAGAGGG - Intergenic
1186604707 X:11078064-11078086 CAAAGAGAGCTGAGTGAAGAGGG - Intergenic
1186745939 X:12569061-12569083 AAGAGTGAGCTAGGAAGAGAAGG - Intronic
1187305901 X:18095008-18095030 AAGGGTGAGCTTGGTGGAGTTGG - Intergenic
1187649201 X:21381777-21381799 AAGACTTAACTAGGTGAAGAGGG - Intronic
1187760393 X:22577335-22577357 ACTAGTGAGCTGAGTGATGAGGG - Intergenic
1188236849 X:27741665-27741687 AGGAGTGAGAAGGATGAAGATGG + Intronic
1188855604 X:35191538-35191560 ATGATTGAGCTTGGTGAGGAAGG - Intergenic
1189052760 X:37663795-37663817 AGGAAAGAGCTTGGTGAAGAAGG - Intronic
1189117031 X:38353425-38353447 ATGAGTTAGCTGGGTAAACAAGG + Intronic
1189238227 X:39505345-39505367 AGGAGTGAGCTGGTTGAGCAGGG - Intergenic
1189787380 X:44571580-44571602 AAGGCAGAGCTGGGGGAAGAGGG + Intergenic
1190157727 X:48007253-48007275 GAGAGTGAGTGGGGTGAAGAAGG + Intronic
1190173499 X:48130138-48130160 GAGAGTGAGTGGGGTGAAGAAGG + Intergenic
1190262466 X:48806078-48806100 AAGAGTGAGTCAGATGAAGAGGG + Intronic
1190744279 X:53312204-53312226 TTGAGTTAGCTAGGTGAAGAAGG - Intronic
1192611887 X:72574946-72574968 AAGATTTTGCTTGGTGAAGATGG + Intergenic
1193892615 X:87069062-87069084 GGGAGTTAGCTGGGTAAAGATGG - Intergenic
1194063631 X:89235420-89235442 AAGGGTGAGCTGGTGGTAGAAGG - Intergenic
1194807827 X:98351208-98351230 AAGACTGAGGTGGGTGGAAAAGG + Intergenic
1194940228 X:100000321-100000343 ATGATTAAGCTTGGTGAAGAAGG + Intergenic
1195108943 X:101625835-101625857 AAGAGGGAGCCCAGTGAAGATGG - Exonic
1196317822 X:114249962-114249984 AAGAATGAGATGGGGAAAGAGGG + Intergenic
1197753672 X:129981305-129981327 GAGAGTCAGATGGCTGAAGAAGG - Intronic
1198599833 X:138270450-138270472 AAGAGTGTGCTGTGAGCAGAAGG - Intergenic
1199439171 X:147848957-147848979 CAGAGTCAGCTGGGTGGGGATGG - Intergenic
1200717805 Y:6569524-6569546 AAGGGTGAGCTGGTGGTAGAAGG - Intergenic
1201990781 Y:20023073-20023095 AAGACTGAGGTGGTTGGAGAAGG - Intergenic
1202025475 Y:20518303-20518325 AAGAGTGCTCTGGCTGTAGAGGG - Intergenic