ID: 906866521

View in Genome Browser
Species Human (GRCh38)
Location 1:49427042-49427064
Sequence AAATGTCAACAGATGTAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 194}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906866519_906866521 11 Left 906866519 1:49427008-49427030 CCTCTCGTGAGCTTACATCCAAA 0: 1
1: 0
2: 0
3: 4
4: 130
Right 906866521 1:49427042-49427064 AAATGTCAACAGATGTAGTGAGG 0: 1
1: 0
2: 0
3: 15
4: 194
906866520_906866521 -7 Left 906866520 1:49427026-49427048 CCAAACAAGAGAACACAAATGTC 0: 1
1: 0
2: 0
3: 20
4: 255
Right 906866521 1:49427042-49427064 AAATGTCAACAGATGTAGTGAGG 0: 1
1: 0
2: 0
3: 15
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906866521 Original CRISPR AAATGTCAACAGATGTAGTG AGG Intronic
901617383 1:10552692-10552714 ATATATAAACAGATGTGGTGTGG + Intronic
902063249 1:13663097-13663119 AAATGTCATCATATGGTGTGTGG - Intergenic
903628667 1:24749397-24749419 AAAGGCCAAGAGATGTAATGGGG + Intronic
906866521 1:49427042-49427064 AAATGTCAACAGATGTAGTGAGG + Intronic
906994465 1:50776929-50776951 AAACGTCAACAGAGGAAGTTTGG + Intronic
909461290 1:75917475-75917497 AAATGTCAAAAGATTTGCTGAGG + Intergenic
912019474 1:105088949-105088971 AAATGTCAACAACTGTAGAATGG - Intergenic
912092059 1:106090833-106090855 AAATGTCAACATATGAATTTTGG - Intergenic
920195732 1:204225732-204225754 AAATGTCTAAGGATGTTGTGTGG - Intronic
920568477 1:206996361-206996383 AGATGTCAGCAGATTTAGTGTGG - Intergenic
921522858 1:216177920-216177942 GAAAGTCCACAGATGTAGTTTGG - Intronic
1064862880 10:19846670-19846692 CAATGTCAAGATATGCAGTGTGG + Intronic
1068224601 10:54090881-54090903 AAATGTTAATAGATGTTGAGAGG + Intronic
1068327578 10:55514591-55514613 AAATGTTAACAGACTGAGTGGGG + Intronic
1069882046 10:71599156-71599178 AAATGTCAACAAATGTTATCAGG - Intronic
1072855936 10:98946725-98946747 AAATGTAAACAAATGTAAAGAGG + Intronic
1074324303 10:112433101-112433123 AAATTTCAACAAATGTATTAAGG + Intronic
1078759344 11:14239322-14239344 AAATGACAACTCATGTAATGTGG - Intronic
1079400284 11:20101399-20101421 AAATTGCAACAGATGTATCGTGG - Intronic
1080157899 11:29134235-29134257 AAATGTTACCAAAAGTAGTGTGG - Intergenic
1085363853 11:75918930-75918952 AAATCTCACCACATGTTGTGTGG - Intronic
1085371033 11:76005669-76005691 AAATGGCACCTGATGTGGTGAGG - Intronic
1089241886 11:117088461-117088483 AAAAGTCAAAAGATGTATTAAGG + Intronic
1089423167 11:118347171-118347193 AAAGGACAAGAGAGGTAGTGTGG - Intronic
1091260558 11:134230899-134230921 CAATGCCAACACATGTGGTGAGG + Intronic
1092501656 12:9053451-9053473 AAATGAGAACAAATGTGGTGGGG - Intergenic
1093604513 12:21073856-21073878 AAATTTCAAAAGAAGTAGTGGGG + Intronic
1094429273 12:30348993-30349015 ACATGACAACTAATGTAGTGTGG - Intergenic
1095644643 12:44529190-44529212 AGATGTTAACAGAGGTGGTGAGG + Intronic
1096183061 12:49561301-49561323 AATTGTCAACTGAGGAAGTGAGG + Intronic
1098928076 12:76375615-76375637 AAATGACTACAGAAGTACTGTGG - Intronic
1099038849 12:77624905-77624927 AAAAGTCAACACATACAGTGAGG + Intergenic
1100175232 12:92022876-92022898 AAATGACAGCAAATGAAGTGTGG + Intronic
1100682957 12:96948950-96948972 AGAAGTCAACAGATGTCTTGAGG + Intronic
1102303418 12:111787546-111787568 ACATGTAAACAGAGGTGGTGGGG + Intronic
1102829372 12:115982521-115982543 AAATGACAACAGCTGGAGGGTGG + Exonic
1103052301 12:117790801-117790823 GAATGTGCACAGAGGTAGTGTGG - Intronic
1104162893 12:126197744-126197766 AATTTTCAACAGATTTACTGGGG - Intergenic
1104387372 12:128362973-128362995 AAATATCAAAAGATGAAGAGAGG + Intronic
1104563568 12:129860158-129860180 AAATGTCCACAGAGGCAGAGTGG - Intronic
1108009443 13:45989566-45989588 AAATGTCAACCCATGCAGCGTGG - Intronic
1108275927 13:48809671-48809693 AAATGTCCACAGACTTTGTGAGG + Intergenic
1108339129 13:49479154-49479176 AACTCTCAAGAGATTTAGTGTGG - Intronic
1108620619 13:52180047-52180069 CAATCTCAACAACTGTAGTGTGG + Intergenic
1108666132 13:52633000-52633022 CAATGTCAATAACTGTAGTGTGG - Intergenic
1109162959 13:58999279-58999301 AAATGTCAAAAGATGAAGAATGG + Intergenic
1109277069 13:60314902-60314924 AAAGGTCATCAGCTGGAGTGAGG + Intergenic
1112650903 13:101397195-101397217 ACATGTAAACACATGTAGTCTGG + Intronic
1112795129 13:103048467-103048489 AAATGTCCAGAGATATAGTTTGG - Intronic
1113476406 13:110585037-110585059 AAATCTCAACAGATGTTTTGTGG - Intergenic
1115813215 14:37133312-37133334 GAATGTCAACAGAGGGACTGGGG - Intronic
1118522143 14:66596897-66596919 CAATGACACCAGATGCAGTGGGG - Intronic
1119590400 14:75881910-75881932 AAATGTCAACATATATAATTAGG - Intronic
1119764188 14:77178243-77178265 AAATTTCAATAGATCCAGTGTGG - Intronic
1125110513 15:36026635-36026657 ACATGTCAACATTTTTAGTGGGG - Intergenic
1125741075 15:41965396-41965418 AAATGTGAACAGATGGGGTTTGG + Intronic
1125929570 15:43590592-43590614 AAATTTTAACAGATGTAAAGAGG + Intergenic
1125942737 15:43690424-43690446 AAATTTTAACAGATGTAAAGAGG + Intergenic
1127040566 15:54971203-54971225 AAATGCCAACAAATGTATAGGGG + Intergenic
1127497137 15:59524008-59524030 AAATGTCTTCGGAGGTAGTGTGG - Intergenic
1130197092 15:81790005-81790027 AAATGGCAGCAGAAGTAGTGGGG + Intergenic
1130342248 15:83009631-83009653 AAATGTAAACAGAGCTAGTCAGG + Intronic
1132395097 15:101466907-101466929 AAATGTTATCAGATGGGGTGCGG + Intronic
1134895992 16:17887157-17887179 AAATGCTGACAGATGGAGTGGGG - Intergenic
1137002057 16:35237709-35237731 GAATTTCCAGAGATGTAGTGGGG - Intergenic
1137262209 16:46840799-46840821 TATTGTCAACAAATGTGGTGTGG - Intergenic
1137627283 16:49917254-49917276 AAATATCCACACATGTACTGAGG + Intergenic
1141560642 16:84865534-84865556 AAAAGGCAACAGATGTATTTGGG - Intronic
1145252192 17:21302757-21302779 AAATGTTTCCAGATGCAGTGAGG - Intronic
1149106688 17:52975780-52975802 ATATGTGAATAGATGCAGTGTGG - Intergenic
1156783322 18:40878703-40878725 AAATGCAAACAGATGTAGGAGGG - Intergenic
1157044182 18:44077946-44077968 AAATCTGAACAGAGTTAGTGGGG + Intergenic
1157584647 18:48793282-48793304 AAATGTCAAGAGACTTAGAGGGG - Intronic
1159743712 18:72206360-72206382 AAATGTACACAGATGTGATGGGG - Intergenic
1164223925 19:23224994-23225016 CATTGTCAACAGATTTGGTGGGG - Intronic
926755219 2:16229020-16229042 AACTGTCCACAGCTGCAGTGAGG + Intergenic
930198749 2:48532849-48532871 AAATATCAATACATGAAGTGTGG + Intronic
931047144 2:58367226-58367248 AAAAGTGAACAGATGTATTTTGG - Intergenic
932384119 2:71315206-71315228 AAATGTAAACAAATGTAAAGAGG - Intronic
933810137 2:86027925-86027947 AAATGTCATCTGCTGTAGCGGGG + Exonic
935656904 2:105430869-105430891 TAATGGCAACAGACTTAGTGGGG - Intronic
936796578 2:116213655-116213677 CCATGTTAACAGATGTAGTCTGG + Intergenic
938703997 2:133904413-133904435 AAATGTGAATAGATGTTCTGTGG - Intergenic
939671883 2:145022804-145022826 GAATGAGAAAAGATGTAGTGTGG - Intergenic
939679470 2:145112415-145112437 GAATGTGAACATAAGTAGTGAGG + Intergenic
939921616 2:148122254-148122276 AAAAGTCAATAAATTTAGTGAGG - Intronic
940566614 2:155370196-155370218 AAATGTCAATAGATATAAAGTGG - Intergenic
941348231 2:164396998-164397020 AAATGTCAACAAAAATTGTGTGG - Intergenic
941743681 2:169063783-169063805 AAATGTCAACACAAGTATTTTGG - Intergenic
942742199 2:179194041-179194063 AAATGTCAAAAGAGCCAGTGGGG - Intronic
943009843 2:182433804-182433826 AAATGCCAGCACAGGTAGTGGGG - Intronic
944425214 2:199574192-199574214 CAATGTCAAAAGATGTAAAGGGG + Intergenic
947177269 2:227380542-227380564 AAATGTGAACAGAAGTGATGTGG - Intronic
947467334 2:230362966-230362988 AAATGTGAACAGATGTGGAGTGG + Intronic
947924685 2:233911120-233911142 AAATGTCATCAGATTTAGGGTGG - Intergenic
948159327 2:235811432-235811454 ACGTCTCAAAAGATGTAGTGAGG - Intronic
948162440 2:235835947-235835969 AAATGTTGACAGTTGTATTGTGG + Intronic
1170194801 20:13679037-13679059 AAATGTTAACAGATCTATGGAGG - Intergenic
1170689146 20:18596445-18596467 AAATGTGAACAGAAGAAGGGAGG - Intronic
1171040689 20:21759799-21759821 AAATGTTTACATTTGTAGTGTGG - Intergenic
1171256739 20:23694375-23694397 AAATGTCCACAGGTGTGGAGGGG - Intergenic
1173923154 20:46760921-46760943 AAATGTAAACAGATGAAATGAGG - Intergenic
1175192278 20:57219462-57219484 AAATGTCACCAGATATTGTCAGG - Intronic
1175343118 20:58247619-58247641 AAATCTCCATAGATGTAATGTGG - Intergenic
1177012012 21:15742178-15742200 AAAACCCAACAGATATAGTGGGG - Intronic
1177403606 21:20637940-20637962 AAATGTCAAAACATGTTTTGGGG + Intergenic
1180392999 22:12302332-12302354 AAATGTGTACTGAGGTAGTGGGG + Intergenic
1180406751 22:12562436-12562458 AAATGTGTACTGAGGTAGTGGGG - Intergenic
949826974 3:8175916-8175938 AAATATCAAAGGATGCAGTGTGG - Intergenic
952746252 3:36784248-36784270 AAATGTCATCAGATGAAATTTGG + Intergenic
955136455 3:56223579-56223601 AAGTGTCAGCAGAAATAGTGTGG - Intronic
955307375 3:57847772-57847794 TAATGTCAAAAGATGTATTTTGG - Intronic
955458143 3:59148163-59148185 CAATGTAAAAAGATGTAATGTGG - Intergenic
956072695 3:65471369-65471391 AAATGTCTACAGAATTACTGTGG - Intronic
956189690 3:66596822-66596844 ATATGTCAGGAGATTTAGTGAGG - Intergenic
956364505 3:68485337-68485359 CACTGTTAACACATGTAGTGTGG - Intronic
956737080 3:72246249-72246271 AAATGTCAACAGAGATAGATAGG + Intergenic
957678513 3:83402193-83402215 AAATTTCAAGTGATGTACTGAGG - Intergenic
958470480 3:94511393-94511415 AAATGTAAACAAATGTAAAGAGG - Intergenic
959178520 3:102948983-102949005 AAATGTAATCAGAGGTAGAGAGG - Intergenic
959260579 3:104074610-104074632 AATTTTCCACAGATGTAGAGAGG + Intergenic
960799902 3:121528043-121528065 AAATGTAAACAAATGTAAAGAGG - Intronic
963083343 3:141414867-141414889 AAGTGTCAACAGAGGCAGAGAGG - Intronic
966526711 3:180927426-180927448 AAATCTGAACAGATGTATTATGG - Intronic
966788118 3:183638607-183638629 AAATGTCAACAGTTGTCAAGTGG - Intronic
967129014 3:186453480-186453502 AAATTTCAACACATGAATTGGGG - Intergenic
970642508 4:18082770-18082792 AAATCTCAACAGATGGAGACAGG - Intergenic
970689450 4:18605745-18605767 AAATGTCAAAACATGTAGTATGG - Intergenic
976081318 4:81358236-81358258 AAATATCAACAGACGTATTCAGG - Intergenic
976258849 4:83126474-83126496 AGATGACAACAAATGTAATGTGG - Intronic
977023323 4:91785004-91785026 AAATGACAACACATGCAGTTTGG + Intergenic
978322242 4:107510507-107510529 AAATTTCAACATTTATAGTGGGG - Intergenic
979210405 4:118094114-118094136 AAGTTTCAACATATGTATTGTGG + Intronic
979391592 4:120135216-120135238 TAATGTCAACCAATGTATTGAGG - Intergenic
979904427 4:126268310-126268332 TTATGTCATCAGATGTAATGTGG - Intergenic
980747676 4:137040774-137040796 AGAAGACAACAGATGTTGTGTGG - Intergenic
981129283 4:141140480-141140502 AAAAGGAAACAGATGTATTGTGG - Intronic
981266977 4:142796775-142796797 AAATGTCAACCGATGTTCTAGGG - Intronic
982192294 4:152868544-152868566 AAATAGCAAATGATGTAGTGTGG - Intronic
982961426 4:161842958-161842980 AAATGTTAAAAAATATAGTGGGG - Intronic
984742650 4:183181055-183181077 AAATGTAAACAAATGTAAAGAGG + Intronic
985382271 4:189406929-189406951 AAATGTCTACAGAAATAGTTTGG + Intergenic
986863554 5:11956192-11956214 ATATGCCAAGAGATTTAGTGAGG - Intergenic
988835997 5:35032830-35032852 AAATGACAAAAGAAGGAGTGTGG + Intronic
989170994 5:38470054-38470076 AAATGTCAACCGACCTTGTGTGG - Intergenic
990960236 5:61386234-61386256 AAATGTCCACAGATGCACTGGGG - Intronic
992889903 5:81194618-81194640 AACTGTCAAGGGATGGAGTGTGG - Intronic
994657956 5:102617514-102617536 AAATGTCAACTTACGTAGGGTGG - Intergenic
995258899 5:110078456-110078478 AACTGTCAACAAACGTGGTGTGG + Intergenic
996491975 5:124108393-124108415 AACTATAAACATATGTAGTGGGG + Intergenic
996703242 5:126470887-126470909 AAATGGCAAAAAAGGTAGTGGGG - Intronic
997664592 5:135619997-135620019 AAATGGCAACAGAAGTAGGTTGG + Intergenic
998529511 5:142871791-142871813 AAATGTCAAAAGATGTTGGCAGG - Intronic
1000101568 5:158021980-158022002 AAATGTTAACATATGAAGAGAGG + Intergenic
1000969165 5:167694921-167694943 GAATGTCAACAGAAGTAGTTTGG - Intronic
1001306973 5:170582123-170582145 AAATTTCAACAGATGAGATGAGG + Intronic
1003861759 6:10328450-10328472 AAACGTCAAGAGCTGTACTGAGG - Intergenic
1004575895 6:16894297-16894319 AAATGTAAACAAATGTAAAGGGG + Intergenic
1006330451 6:33386597-33386619 AAATGTCAACATATGAATTTTGG - Intergenic
1007756333 6:44102047-44102069 CAACCTCAACAGATGAAGTGAGG - Intergenic
1008847522 6:55985710-55985732 AAATGTGCATGGATGTAGTGGGG - Intergenic
1010431014 6:75778691-75778713 AAATGGCAACAGAAGTAATTAGG - Intronic
1011938309 6:92810707-92810729 CAAGGTCAACAGATGTAGGTGGG + Intergenic
1013276106 6:108586300-108586322 AAATGAAAACAGAAGTAGCGTGG + Intronic
1013740896 6:113283428-113283450 AAGTAACAACAGATGTTGTGAGG + Intergenic
1015320989 6:131874532-131874554 AAAAAACAACAGATGTAGTAAGG + Intronic
1016443198 6:144106082-144106104 AAATGTCAACAAATGAATTTTGG + Intergenic
1021508654 7:21411685-21411707 AAATGTGAATAGCTGTAGGGTGG - Intergenic
1021934811 7:25619590-25619612 AAATGTGAAGAGATGTAGCATGG - Intergenic
1027433437 7:78138132-78138154 AAAAGTCAAGAGATGCAGGGTGG - Intronic
1028765743 7:94557344-94557366 AAATGTCAAAAGATTAAGTAAGG - Intergenic
1029317826 7:99730456-99730478 AAGTGGCAACAGATGTCATGGGG + Intronic
1032285202 7:130534472-130534494 AAATATCCACAGATGTCATGAGG + Intronic
1032900008 7:136296458-136296480 GAATGTCAACACATGAAGTTAGG - Intergenic
1032995184 7:137437510-137437532 AAATGTCAAGAGATGTGGCTTGG + Intronic
1034320701 7:150178770-150178792 AAATGTCAACCAATGAATTGTGG + Intergenic
1034772034 7:153788478-153788500 AAATGTCAACCAATGAATTGTGG - Intergenic
1037348985 8:17929116-17929138 AAATTTCAGCAGGGGTAGTGAGG - Intronic
1038248054 8:25877640-25877662 AAATGTCAACAGTTGGACTATGG + Intronic
1041269386 8:56096272-56096294 AATTGTGACCAGATGTACTGGGG - Intergenic
1043375759 8:79647576-79647598 TAGTGTCAACAGATGGAATGGGG - Intronic
1044952981 8:97451630-97451652 CAATGGCACCAGATGGAGTGAGG - Intergenic
1045371365 8:101527072-101527094 AAATGTCAACAGAGGGAATAAGG + Intronic
1045378006 8:101594337-101594359 AAATGTTGACAGCTGTAGTCAGG - Intronic
1048387530 8:133926466-133926488 ATATGTCAAAAGATGAAGTGAGG + Intergenic
1048952230 8:139505732-139505754 AAATATCTGCAGCTGTAGTGTGG + Intergenic
1050063127 9:1731239-1731261 AAATGTCAACATATGAATTTTGG + Intergenic
1054835101 9:69668704-69668726 GAATGCCAAGAGATGTAATGAGG - Intronic
1056841577 9:90002254-90002276 AAATGTCAACAGAGGTAGATAGG + Intergenic
1060254023 9:122010717-122010739 AAATGTAAACAGATGTGATATGG - Intronic
1060498907 9:124138083-124138105 TAATGCTAACAGATGGAGTGGGG + Intergenic
1185553576 X:1002911-1002933 AAATGGGAACAGATGTAGCCGGG - Intergenic
1186398056 X:9230360-9230382 AAATGTCAATAGTAGTATTGAGG - Intergenic
1186742431 X:12532728-12532750 AAATGTCTCCAGATGTTGTTAGG - Intronic
1186905887 X:14109983-14110005 AAATGTTAACTGAGGTATTGAGG + Intergenic
1188001234 X:24984465-24984487 AAATGTAAACACATGTAGAGGGG + Intronic
1189138796 X:38579012-38579034 AAATGTTAACAGCTGTGGTTGGG + Intronic
1189310642 X:40014978-40015000 AAATGTCAACAGATTCCGCGCGG + Intergenic
1191791128 X:64973435-64973457 AAATGTAAAGAGATGTAAAGGGG - Intronic
1192422531 X:71046244-71046266 AAATGTTAATAGCTGCAGTGAGG + Intergenic
1193797453 X:85893494-85893516 ATATGTCAACAAATGAATTGTGG - Intronic
1194018616 X:88658482-88658504 AAATGTCAACCTCTGTAGTGAGG - Intergenic
1194048205 X:89035276-89035298 GAACTTCAACAGATGTAGTTAGG + Intergenic
1195330508 X:103794635-103794657 AACTGTGAACACAGGTAGTGTGG + Intergenic
1197489002 X:127093068-127093090 AAATGAGAACAGAGGTAGAGAGG - Intergenic
1197710662 X:129664767-129664789 AAATGTAAATGGAGGTAGTGGGG - Intergenic
1201743686 Y:17348928-17348950 ATAGGTCAACAGATATAGTGGGG + Intergenic
1202139099 Y:21702382-21702404 AGATGGCAACAAATGAAGTGTGG + Intergenic
1202339417 Y:23846183-23846205 AAATGACAACATATCTAGGGTGG - Intergenic
1202531349 Y:25823885-25823907 AAATGACAACATATCTAGGGTGG + Intergenic