ID: 906870900

View in Genome Browser
Species Human (GRCh38)
Location 1:49479607-49479629
Sequence TGTCCTTTGCATGACATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 10, 2: 31, 3: 58, 4: 248}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906870900_906870902 18 Left 906870900 1:49479607-49479629 CCATCCATGTCATGCAAAGGACA 0: 1
1: 10
2: 31
3: 58
4: 248
Right 906870902 1:49479648-49479670 TATAGCTGCACAGCATTTCATGG 0: 1
1: 4
2: 94
3: 1942
4: 27278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906870900 Original CRISPR TGTCCTTTGCATGACATGGA TGG (reversed) Intronic
900524867 1:3123639-3123661 TGGCCTTTGGATGCCAAGGAAGG - Intronic
900758387 1:4454023-4454045 TGTCCTGGGCAAGAGATGGAGGG - Intergenic
901663672 1:10814453-10814475 TGACCTTGGCATGACACAGATGG - Intergenic
902086951 1:13870280-13870302 TGTCCTTTGCAGGACACAGGAGG - Intergenic
904026175 1:27504972-27504994 TGTCCTCTGCAAAACAGGGAAGG - Intergenic
906020290 1:42622240-42622262 TGTCATTTGCAATACATGGATGG - Intronic
906870900 1:49479607-49479629 TGTCCTTTGCATGACATGGATGG - Intronic
908215088 1:61943444-61943466 TGTCCTGTGCCTGGCTTGGAGGG + Intronic
908452136 1:64266262-64266284 AGTCCTTTGCATGACATATGAGG + Intronic
909460160 1:75902506-75902528 TGTCCTTTACACAACATAGATGG - Intronic
909716915 1:78719294-78719316 TATTCTTGGCATGAAATGGAAGG + Intergenic
910733644 1:90427287-90427309 TGTCATTTGCAACAAATGGATGG + Intergenic
911710590 1:101067106-101067128 CCTCCTTTGCAGGACATGGATGG - Intergenic
913715061 1:121525204-121525226 TGTCCTTTGTAGGAAATAGATGG + Intergenic
914994258 1:152527576-152527598 TGTCTTTTACAGAACATGGATGG - Intronic
915763990 1:158344428-158344450 TGCCCTTTATAGGACATGGATGG - Intergenic
917635550 1:176932248-176932270 TGTCCCTTGCATGTCACAGAAGG + Intronic
919204586 1:194405750-194405772 TGTTCTTTGCAGGACATGGATGG + Intergenic
919598744 1:199596594-199596616 TGTCCTTTGCAGGAAATGGATGG - Intergenic
921099367 1:211915159-211915181 TGTCATCAGCATCACATGGAGGG - Intergenic
921298846 1:213730075-213730097 TGTTCTTTACTGGACATGGATGG - Intergenic
921892459 1:220366874-220366896 TGTCCTTTGCTTGAAAAGGGTGG + Intergenic
923406045 1:233661711-233661733 TGTTGTGTGCATGGCATGGATGG + Intronic
1062991310 10:1821845-1821867 TGTCCCTTCCATGACATGTGGGG + Intergenic
1063352034 10:5364924-5364946 TGTCGTCTGCATGACGTGGACGG + Intergenic
1065357688 10:24858523-24858545 AGTCCTTTGAATTAGATGGATGG - Intronic
1065700014 10:28415732-28415754 TGTCTTTTGCGGAACATGGATGG - Intergenic
1068031326 10:51708827-51708849 TGACCTCTCCATGACCTGGAAGG - Intronic
1068334403 10:55613513-55613535 TGTCCTTTCAATGAAAGGGAAGG - Intronic
1069147605 10:64915392-64915414 GGTCCTTTTCATGACATGTGGGG + Intergenic
1069345969 10:67470251-67470273 TGTCATTTGCAAAACATGGTTGG - Intronic
1069935792 10:71915228-71915250 TGGCCTTAGCAGGACATGGGTGG - Intergenic
1070053985 10:72916476-72916498 TGTCCTTTGCAGGGAGTGGATGG - Intronic
1071035354 10:81238332-81238354 GGTCCCTTGCATGACATGTGTGG + Intergenic
1073952948 10:108831848-108831870 TGTCCTTTCCAGGACATGGATGG + Intergenic
1074022718 10:109600824-109600846 CATCCTTTGAAGGACATGGATGG + Intergenic
1075187598 10:120277033-120277055 TGTCCTTTGAAGGACATGGATGG + Intergenic
1075795119 10:125114762-125114784 TGTACTCTGCATGGCATGGAAGG + Intronic
1078517753 11:12039156-12039178 TGTCCTTTGCAGCACATGGATGG + Intergenic
1078864670 11:15286185-15286207 TGTGCTTTGCAGGACATGAGAGG + Intergenic
1078975287 11:16467475-16467497 TGTCCTTTGCAGGACATGGATGG + Intronic
1081216058 11:40399811-40399833 TATTTTTCGCATGACATGGAAGG - Intronic
1081307330 11:41529538-41529560 TGTCCTTTGCATGAGATAGAAGG + Intergenic
1082904093 11:58287185-58287207 TGTCTTTTGCAGAACATAGATGG + Intergenic
1083677794 11:64336705-64336727 TGTCCTTCGTGGGACATGGATGG - Intergenic
1083919649 11:65775433-65775455 TGTCCTTTGAAGGATATGGATGG + Intergenic
1084765800 11:71307549-71307571 AGTCCTTTACAAGACATGGAAGG - Intergenic
1085141304 11:74144754-74144776 TGTCCTTTGCAGGACATGGATGG - Intronic
1086236564 11:84638251-84638273 TGTCCTTGGCACCAAATGGAAGG + Intronic
1087585311 11:100112035-100112057 TATCCTTTCCAGCACATGGAGGG + Intronic
1088852948 11:113720351-113720373 TGTCCTTAGCATGGCATGAAAGG + Intergenic
1089144038 11:116311319-116311341 TGTCCTTTTCAGACCATGGAGGG - Intergenic
1090586941 11:128223197-128223219 TGTCCTTTGCAGGACATGGATGG - Intergenic
1091019272 11:132084498-132084520 TCTCTTTTGGATGCCATGGAGGG - Intronic
1091348666 11:134874774-134874796 AGTCCTTGGAAGGACATGGAAGG + Intergenic
1093084937 12:14856439-14856461 TGTCTTTTGGATGTCATGGATGG - Intronic
1094300352 12:28957808-28957830 TCTCCTTTGAAAGAAATGGAGGG - Intergenic
1097419318 12:59354369-59354391 TGTCCTTTCAGAGACATGGATGG - Intergenic
1097538359 12:60902502-60902524 TGTCATTTGCAACACATGGATGG + Intergenic
1098118439 12:67206702-67206724 TGTCATTTGCACAACATAGATGG + Intergenic
1099035461 12:77581919-77581941 TGTCCTTTGCATAACAGTGTGGG + Intergenic
1099186883 12:79524807-79524829 TGTCATTTGCATTATTTGGATGG - Intergenic
1099374867 12:81886782-81886804 AGTCCTTTACAAGACATGCAAGG - Intergenic
1100240495 12:92706556-92706578 TGTTCTCTGGATCACATGGAGGG - Exonic
1102137289 12:110586030-110586052 TGTCCTGTGCATGCGTTGGAGGG + Intergenic
1102402192 12:112639336-112639358 TGTCCTTTGCAGGCTATGGATGG + Intronic
1102742240 12:115217965-115217987 TGTCCCTTGCCTGATGTGGATGG - Intergenic
1102806916 12:115790120-115790142 TGTCATTTGCAGAACATGGATGG - Intergenic
1104796459 12:131523204-131523226 TATCCTTTGCAGGACATGGATGG + Intergenic
1105899351 13:24742351-24742373 TGTCCTTGGCATGTCTGGGATGG - Intergenic
1107643540 13:42470256-42470278 TGTCATTTGCACAAGATGGATGG + Intergenic
1108395742 13:49989529-49989551 TGTCTTTTGCCTGACTGGGAGGG + Intergenic
1109137151 13:58666762-58666784 TGTCCTTTCCATGACATTTCAGG + Intergenic
1110290400 13:73799099-73799121 CGTCTTTTGCAGCACATGGATGG + Intronic
1110440023 13:75517369-75517391 TCTCCTTTGCAAGTCATTGAGGG - Intergenic
1111036298 13:82678374-82678396 TGTCCCTTACATGACATGTGGGG + Intergenic
1111205101 13:84997029-84997051 TGTCTTTTGAATGACCTAGATGG + Intergenic
1112477599 13:99746733-99746755 TGTCAAGTGCATGACATGGGAGG - Intronic
1114829139 14:26118231-26118253 TGTCCTTTGCAGGACATGGATGG + Intergenic
1115764714 14:36611837-36611859 TGTTTTTTGCAGGACATGGATGG + Intergenic
1116035544 14:39622798-39622820 TGTCCTTGGCAGGACATGGATGG - Intergenic
1116943687 14:50816036-50816058 TGTCCTTTGCAAGACATAGATGG + Intronic
1117511368 14:56454787-56454809 TATCCTGTGCATGGCTTGGAGGG + Intergenic
1117842462 14:59873976-59873998 TGTCATTTGCACAACATGGATGG - Intergenic
1119583492 14:75809869-75809891 TGTCATTTGCAGAACATAGATGG - Intronic
1119811521 14:77524692-77524714 TGTCATTTGCACAAGATGGATGG + Intronic
1120058955 14:79959374-79959396 TGTCCTTTGAGGGACATGGATGG + Intergenic
1120493182 14:85202549-85202571 TGTCCTGTGCATTACATTGTAGG - Intergenic
1120900650 14:89572866-89572888 ACTCATTTGCATGGCATGGAAGG - Intronic
1122198320 14:100106577-100106599 TCTCCTTTGCAGTACATGTAAGG + Intronic
1123835501 15:24187097-24187119 TGTCCTTTTAATCACATGGCTGG - Intergenic
1123850270 15:24348448-24348470 TGTCCTTTTAATCACATGGCTGG - Intergenic
1123855212 15:24403009-24403031 TGTCCTTTTAATCACATGGCTGG - Intergenic
1123871239 15:24575943-24575965 TGTCCTTTTAATCACATGGCTGG - Intergenic
1123920719 15:25068002-25068024 TTTCCTCTGTATGACATAGACGG + Intergenic
1124348026 15:28935316-28935338 TGTCATCTGCATGGCAAGGATGG + Intronic
1125419061 15:39485932-39485954 AGTCCTTGGCATGACATATAAGG - Intergenic
1126331045 15:47531850-47531872 TGTTCTTTGCATGTGTTGGAGGG + Intronic
1128849379 15:70937109-70937131 TGTCCTTTGTTTGACATTCACGG + Intronic
1130109310 15:80951670-80951692 TGTCCTTTGCATTGCTTGGAAGG + Exonic
1130181045 15:81628909-81628931 TGTCCTTTGCAGGGCGCGGATGG + Intergenic
1131665757 15:94569619-94569641 TGTGCTGTACATGCCATGGAAGG - Intergenic
1132245293 15:100291679-100291701 TGTCCTCTGCAGCACATGGATGG + Intronic
1132248813 15:100318045-100318067 GGACATTTGCAGGACATGGAAGG + Intronic
1135937109 16:26791011-26791033 TTTCCTTTTCCTGACATGCATGG + Intergenic
1137811424 16:51356487-51356509 TGGCCTCTGCGTGACATGGAGGG - Intergenic
1137906106 16:52323525-52323547 GGTCCTTAGCACGACCTGGAAGG - Intergenic
1138275716 16:55732789-55732811 CGTCCCTTGCAAGACATAGATGG - Intergenic
1138281612 16:55776181-55776203 CATCCTTTGCAAGACATAGATGG - Intergenic
1138584933 16:57963392-57963414 TGTCCTAAGCATCCCATGGAGGG - Intronic
1138872977 16:60915075-60915097 TTTCCTTTGCAAAACATAGAGGG + Intergenic
1139083258 16:63552087-63552109 AGTCCTTTCCATGACATGTGGGG + Intergenic
1139744021 16:69059898-69059920 ACTCCTTTGCATGACATACAAGG + Intronic
1141810399 16:86371950-86371972 TGTCCTTCCCATGTTATGGATGG + Intergenic
1144356148 17:14448267-14448289 TGTCCTTTACATGCCAAAGAGGG - Intergenic
1145939650 17:28736077-28736099 TGTCCTTTGTAGGACATGGATGG - Intronic
1146370728 17:32264443-32264465 TGTCATTTGCATGACCGGTATGG - Intergenic
1146732345 17:35204599-35204621 TATCCTGTGCATGACTTGGAGGG - Intergenic
1151973777 17:77472474-77472496 GCTCCTTTGCAGGACCTGGAAGG - Intronic
1153474841 18:5488260-5488282 TGTCCTTTTCAGGACATGGATGG + Intronic
1153779241 18:8479482-8479504 TCTCCTTTGCACCACATGCAGGG + Intergenic
1153837250 18:8974975-8974997 TGTCATTTGCAAAACATGGATGG + Intergenic
1154302811 18:13209246-13209268 TGTCCTTTGCAGGATGTGGATGG - Intergenic
1155630801 18:27889835-27889857 TGTCCTTTGCACAACATTCAAGG + Intergenic
1156668841 18:39442723-39442745 TGTCCCTCTCATGACATGTAGGG - Intergenic
1156715364 18:40002561-40002583 TGTATTTTGCAGAACATGGATGG + Intergenic
1159249516 18:65856088-65856110 TGGCATGTGCATGGCATGGATGG - Intronic
1160081765 18:75734559-75734581 TGTCCTTTGCAGGACATGGATGG - Intergenic
1161846875 19:6716770-6716792 TCTCATTTGCAGGACATGGCAGG + Intronic
1164377483 19:27701229-27701251 TATCCCTTGCATGGCTTGGAGGG - Intergenic
1165892565 19:39122888-39122910 TGGATTTTGCATGACAGGGAGGG + Intergenic
926349325 2:11981072-11981094 TGTGGTTTGCATGAGTTGGACGG - Intergenic
927061410 2:19425997-19426019 TATCATTTGCATGAAAAGGAAGG + Intergenic
927342053 2:21993510-21993532 GGTCCTTTCCATGACATGTGGGG + Intergenic
928571116 2:32609660-32609682 TGTCCTTTGAATGACAAAGTTGG + Intronic
928634146 2:33225884-33225906 TGTCATTTGTGTAACATGGATGG - Intronic
929923920 2:46193743-46193765 TCAGCTTTGCATGGCATGGAAGG + Intergenic
930180047 2:48346461-48346483 AGTCCATTGTATGACATAGAGGG + Exonic
930191593 2:48465723-48465745 TGTCCTTTGCAGTACTTGGATGG - Intronic
931117925 2:59184523-59184545 TGGCCTTTGCATGAGGGGGAGGG + Intergenic
931502148 2:62881080-62881102 TGTTCTTTGCAGCACATGGATGG + Intronic
931531605 2:63221005-63221027 TGTCCTTTGAGGGACAGGGATGG - Intronic
931599214 2:63986412-63986434 TGTCATTTGCAACAGATGGATGG - Intronic
931779762 2:65568808-65568830 TGGCCTTTGCAGCACATGGGTGG - Intergenic
931798415 2:65734362-65734384 TTTTTTTTGCAGGACATGGATGG - Intergenic
931835833 2:66097627-66097649 TGTCATGTGCATGATATGGTGGG + Intergenic
932647463 2:73518268-73518290 TGTCTTTTGCAGAACATGGATGG - Intronic
932977293 2:76618693-76618715 TGTCATTTGCAGTACATGGGTGG - Intergenic
934627946 2:95879136-95879158 TCTCATTCACATGACATGGATGG + Intronic
935627380 2:105182536-105182558 AGTCATTTGCACCACATGGATGG - Intergenic
936948932 2:117957617-117957639 TGTCCTTAACATGGCTTGGATGG + Intronic
937442971 2:121932604-121932626 TGTCTTGTGCGTGCCATGGAGGG + Intergenic
937464304 2:122116921-122116943 TGTCATTTTCAGCACATGGATGG - Intergenic
937735966 2:125289750-125289772 TGTCCTTTGCGGGACATGGATGG - Intergenic
938960579 2:136336855-136336877 TGTCCTTTGCATGTCCTGCCTGG + Intergenic
939162009 2:138601942-138601964 TCTCCTTTGCATGTCATTCATGG + Intergenic
940621854 2:156122495-156122517 GGTCCTTCCCATGACATGTAGGG - Intergenic
940660930 2:156544280-156544302 TGTCCTTTTAATGACATTGGTGG + Intronic
941169559 2:162120071-162120093 TGACCTTTGCATGACGTGACAGG - Intergenic
941263328 2:163325001-163325023 TGTCCTTTCCATGGCTTGGGTGG - Intergenic
945377472 2:209096304-209096326 TGCTCTTTGCAGAACATGGATGG - Intergenic
947584919 2:231349267-231349289 AGTCATTTGCAAAACATGGATGG + Intronic
1170282260 20:14663170-14663192 TGTTCTTTGTAGGACAGGGATGG + Intronic
1170708810 20:18770229-18770251 CGTCATTTGCAAAACATGGATGG - Intergenic
1170809766 20:19664870-19664892 TGTCCTTTTCATGACACACATGG - Intronic
1173740974 20:45401529-45401551 GGTCCTTTCCATGACATGTGGGG - Intronic
1173890785 20:46508355-46508377 TCTTCTTTGCATTACATGTAGGG - Intronic
1174431739 20:50475113-50475135 TGTCCTCTGCAGGGCATGGCAGG + Intergenic
1178148253 21:29764522-29764544 TTTCCTTTGAATGACATTCAGGG - Intronic
1180048012 21:45318606-45318628 TGCACTGGGCATGACATGGAGGG + Intergenic
1180818035 22:18805188-18805210 TGTCCTTCGCATGAGAGTGAGGG - Intergenic
1180908093 22:19430211-19430233 TGTGTTTTGCCTGGCATGGAAGG - Intronic
1181204253 22:21239643-21239665 TGTCCTTCGCATGAGAGTGAGGG - Intergenic
1183492367 22:38123388-38123410 TGTCCTATGCAGGACAGCGAGGG + Intronic
1203222669 22_KI270731v1_random:55772-55794 TGTCCTTCGCATGAGAGTGAGGG + Intergenic
1203268160 22_KI270734v1_random:31042-31064 TGTCCTTCGCATGAGAGTGAGGG - Intergenic
950099489 3:10348209-10348231 GGTGGTTTGCATGTCATGGAGGG - Intronic
950953877 3:17029910-17029932 TGTCCTTTGCAAAACATGCCAGG - Intronic
952303720 3:32126944-32126966 TGTCCCTTTCCTGACATAGAAGG - Intronic
953816016 3:46157387-46157409 TGTCCTTTGCAAGGAATGGATGG - Intergenic
955420228 3:58728525-58728547 TGGCCTTAGGATGAAATGGAAGG + Intronic
955969488 3:64423497-64423519 TGTCTTATGCATGAAATGTAAGG - Intronic
956687811 3:71847400-71847422 TATCATTTGCAGGAGATGGAGGG - Intergenic
957266825 3:77977636-77977658 TGTACTTAGAATCACATGGAGGG - Intergenic
957482732 3:80819356-80819378 TGTCCTTTGTGCAACATGGATGG + Intergenic
959182052 3:102993458-102993480 GGTCCTTCGCATGACATGTGGGG - Intergenic
959773740 3:110132074-110132096 TGTCCTTTGCAGGACATAGATGG + Intergenic
961556610 3:127700551-127700573 TGTCCTCTGCATGGCCTGCACGG + Intronic
962089391 3:132227327-132227349 TGTCCTTTGCAGGGAATGGAGGG - Intronic
963532545 3:146489006-146489028 TGTCCTTTGCAGGACATGGATGG + Intronic
963747381 3:149138513-149138535 TGTAATTTGGAGGACATGGATGG + Intronic
964737036 3:159927983-159928005 TGGCCTTTGCCTGACTTTGAGGG + Intergenic
965178501 3:165367507-165367529 AGTCCTTTGCATGACATATGAGG - Intergenic
965989265 3:174796526-174796548 TGTCTTTAGCACAACATGGATGG - Intronic
965993851 3:174854218-174854240 TATCTTTTGCAGTACATGGATGG + Intronic
966654800 3:182343833-182343855 TGTTCTTTGCAGCACATGGATGG - Intergenic
967787605 3:193514384-193514406 TGTCCTTTTCAGGACATGGATGG - Intronic
968376042 4:42344-42366 TATCCTGTGCATGGCTTGGAGGG - Intergenic
969082570 4:4630667-4630689 TGTCCCCTGCAGGACATGGATGG + Intergenic
970457529 4:16239853-16239875 TGTCCTTTGCAAGGAATGGGTGG + Intergenic
970836104 4:20409373-20409395 TGTCCTTTTAGGGACATGGATGG - Intronic
971308433 4:25503876-25503898 TATCCTTGGCATGTCATGGGTGG + Intergenic
971620199 4:28845786-28845808 TGTTCTTTGCAGGACATGGATGG - Intergenic
972213176 4:36863092-36863114 TGTCTTTTGCACAACTTGGATGG + Intergenic
972310338 4:37876277-37876299 AGTCCTATGTGTGACATGGAAGG - Intergenic
972910663 4:43812649-43812671 TGTCCTTTGCAGAGCGTGGATGG + Intergenic
972984854 4:44750733-44750755 TGTCCTTTCCGGGACATGGATGG - Intergenic
972986729 4:44774220-44774242 TGTCCTTAGGATGACCTGGAGGG - Intergenic
974392200 4:61285889-61285911 TCTCCTTTGCATGAGTTGGAGGG - Intronic
975889090 4:79003447-79003469 TGTCCTTTCAGGGACATGGATGG + Intergenic
976793270 4:88904456-88904478 TGTCCTTTCTAGGACATGGATGG + Intronic
977520153 4:98072248-98072270 TGTCCTTTGCGGGACATGAATGG + Intronic
978658979 4:111100429-111100451 TATCCTGTGCATGGCTTGGAGGG - Intergenic
979553787 4:122021589-122021611 TGTCCTTTGCACAACATCGTTGG + Intergenic
980162312 4:129180547-129180569 AAACCTTTGCATGAAATGGATGG - Intergenic
980282758 4:130741797-130741819 TATCCTTTGGAGAACATGGATGG - Intergenic
980857486 4:138456601-138456623 TGTGCTGTGCAGGACATGGATGG + Intergenic
981700912 4:147606326-147606348 TTTCCTTGGCATAACATAGAGGG - Intergenic
983155620 4:164344063-164344085 TGTCCTTTGCACAGCATGGATGG + Intronic
983419459 4:167499643-167499665 TTTTTTTTGCAGGACATGGATGG - Intergenic
983462341 4:168043008-168043030 TGTACTTTGCAGCACTTGGATGG + Intergenic
983809721 4:172045998-172046020 TGCTATTTGCAAGACATGGATGG - Intronic
984628016 4:182030384-182030406 TGTCTTTTGCAGGACAGGGATGG - Intergenic
986632132 5:9784105-9784127 TGACCATTGCATGCCATGTAAGG + Intergenic
986706049 5:10455603-10455625 TATCCTGTGCAGGACAGGGATGG - Intronic
987381375 5:17289008-17289030 TGTCCTCTGCATGGCTTGCAAGG - Intergenic
988959186 5:36352113-36352135 TGTACTTTGCATAACATGACTGG + Intergenic
989518905 5:42377758-42377780 TGACCTTTGCATGCCATTCACGG - Intergenic
989962678 5:50435250-50435272 TGTCCTTTGTAGGAAATAGACGG - Intronic
990797039 5:59555188-59555210 TGTCCTCTGCAAAACGTGGATGG + Intronic
991127040 5:63081183-63081205 TTTTCTTTGCATGCCATTGATGG - Intergenic
993071139 5:83165787-83165809 TGTCCTTTGCAGGACATGGATGG - Intronic
993247684 5:85471655-85471677 TGTCCTTTGCAAAACATGGATGG + Intergenic
993568689 5:89508562-89508584 TGTCTTTTGCGGAACATGGATGG + Intergenic
993795118 5:92257490-92257512 TGTCCTTTGCAGCATACGGATGG + Intergenic
993820605 5:92611011-92611033 TATCCTTTGCAGGACATGGATGG + Intergenic
993889903 5:93461172-93461194 TGTCCTTTGCAAGACATGGATGG + Intergenic
994057371 5:95433422-95433444 GGTCCTTCTCATGACATGTAGGG + Intronic
994543291 5:101128142-101128164 CGTCCTTTGCAGGGCATGGATGG + Intergenic
995018075 5:107335264-107335286 TGTCCTTAGCATGACCTTCAAGG + Intergenic
995059044 5:107794179-107794201 TGTCCTTTGCAAAACATGGATGG + Intergenic
995212616 5:109557787-109557809 ACTCCTGTGCATGACAGGGAAGG - Intergenic
995357641 5:111257835-111257857 TGTCCTTCGCAGGACATGGATGG + Intronic
995621904 5:114034868-114034890 TGTTCTTTGCAGAACATGGATGG - Intergenic
996796816 5:127356617-127356639 TGTACTTAGCATGAAATTGAGGG + Intronic
997785989 5:136714456-136714478 TGTCCTTTGCAGAAAATGGATGG - Intergenic
998046909 5:138995012-138995034 TGTCCTTTGCAGGACATGAATGG - Intronic
998604717 5:143621948-143621970 TGTCTTTTGCAGAACATGGATGG + Intergenic
998634406 5:143937020-143937042 TGTCATTTGCACAGCATGGATGG + Intergenic
998921498 5:147073277-147073299 GGTTCTTTGCATAACATTGAAGG - Intronic
999939221 5:156522423-156522445 TGCCCTTTTCAGGACATAGATGG + Intronic
1000189600 5:158897255-158897277 TGTCCTTTGCGGGACATGGATGG + Intronic
1000588463 5:163129143-163129165 TGTCCTTTGCAGAACATGGATGG + Intergenic
1000668121 5:164024329-164024351 TGTCCTTTGCAGGAACTGGATGG - Intergenic
1001178895 5:169499782-169499804 TGTCCTTTGTGCAACATGGATGG - Intergenic
1001448862 5:171808654-171808676 TGTCCTTTGCAGAACGTGGATGG + Intergenic
1002063766 5:176642138-176642160 TGTTCTCTGCCTGACCTGGATGG - Exonic
1002069790 5:176672338-176672360 TGTCCTCTGCAGGACCTGCAGGG - Intergenic
1002967748 6:1984058-1984080 TGTCCTTTGTGGGACATGGATGG + Intronic
1004761946 6:18677098-18677120 TTTCCTTTGCATAAAATGGTGGG + Intergenic
1005724727 6:28637561-28637583 TTTCCCTTCCATGACATGGAAGG + Intergenic
1005919240 6:30384100-30384122 TGTCCTTTGCGGAACATGGATGG - Intergenic
1007372096 6:41432591-41432613 TTTTCTTTGGATGACAAGGAGGG - Intergenic
1007552117 6:42738118-42738140 TGTCATTTGCAACAAATGGATGG + Intergenic
1008208558 6:48692786-48692808 TGTCCTTTGCAGGACATAGATGG + Intergenic
1009564239 6:65291597-65291619 TGTTCTTTCCATGACATGAATGG + Intronic
1010516439 6:76777563-76777585 TGTCACTTGCATGCCAGGGAAGG - Intergenic
1010802081 6:80188165-80188187 TGTCCTTTGCAGGACATATCTGG + Intronic
1011096544 6:83672302-83672324 TGTCCTTTGCCTTACTTGCATGG - Intronic
1013563064 6:111326072-111326094 CGTCATTTGCAAAACATGGATGG - Intronic
1013896723 6:115097553-115097575 TGTCCTCTGCAGGACGTGAACGG - Intergenic
1014012775 6:116495317-116495339 TGTCATTTGCAAAACATGGATGG - Intronic
1014375300 6:120664774-120664796 TGTCCTTTGCAGGGCATGGATGG - Intergenic
1018140301 6:160826956-160826978 TGTTCTTTCCACGACATGAAAGG + Intergenic
1019025116 6:168954861-168954883 TGTCATTTGCACAACATGGCTGG + Intergenic
1019098427 6:169607465-169607487 TGTCTTTTGCAGCACATGGATGG + Intronic
1019325292 7:435267-435289 TGTCTTCTGTGTGACATGGAGGG - Intergenic
1021199500 7:17712350-17712372 TGCCCTTTGCGGGACATAGATGG + Intergenic
1021364247 7:19756750-19756772 GGTCTTTTGCAGGACATGGATGG - Intronic
1023528423 7:41129360-41129382 AGTTCTTGGCATGACATGTAAGG + Intergenic
1023685556 7:42731252-42731274 GGTCCCTTGCATGACATGTGGGG - Intergenic
1028170354 7:87588484-87588506 CGTCCTTTGCAGGGCATGGCTGG - Intronic
1028531525 7:91843687-91843709 TTTCCTGTGCCTGACATGTAAGG + Intronic
1029160710 7:98549438-98549460 TGTCCATTGCAGGAGATGCAGGG - Intergenic
1032081547 7:128861002-128861024 TGGCCTGTGCAGCACATGGATGG - Intergenic
1032648559 7:133853167-133853189 ATTCTTTAGCATGACATGGAGGG + Intronic
1033737207 7:144234309-144234331 TATCCTTTGATGGACATGGATGG + Intergenic
1033745850 7:144316637-144316659 TGTCCTTTGATGGACATGGATGG - Intergenic
1033813721 7:145047766-145047788 TGTCATGTGCAAAACATGGATGG - Intergenic
1034937880 7:155211437-155211459 TGGCCTTTGCAGGTCATGGTGGG - Intergenic
1035414200 7:158669072-158669094 TGTTCTTTGCAGGGAATGGATGG - Intronic
1037087016 8:14865143-14865165 TGTCCTTAGCATCACATTCAAGG + Intronic
1037936128 8:22916156-22916178 TGTGCATTGCATTACAGGGAGGG - Intronic
1039300930 8:36207762-36207784 TGGCCTTTGTATGACATTGCTGG + Intergenic
1040655045 8:49498297-49498319 GGTCCTTCCCATGACATGTAGGG - Intergenic
1041572043 8:59348747-59348769 TGTCCTTTGCAGAACATGGATGG + Intergenic
1042630301 8:70808648-70808670 TATCCTGTGCATGACTTGGAGGG + Intergenic
1043001536 8:74766019-74766041 TGTCCTTTGCAGGAACAGGATGG + Intronic
1043325044 8:79039759-79039781 TGTCATTTGCAGGACATGATTGG + Intergenic
1044822120 8:96161471-96161493 TGGCCTTTGCCTGACCTCGAGGG - Intergenic
1045567734 8:103338605-103338627 TGTCCCTCCCATGACATGTAGGG + Intergenic
1047508818 8:125500511-125500533 TGTCCTTGCCATGAGATAGAAGG - Intergenic
1048109350 8:131450838-131450860 TGTCTTTTGCAGGACATGGATGG - Intergenic
1048231310 8:132644684-132644706 TATCCCATGCATGACTTGGAGGG + Intronic
1050804030 9:9651545-9651567 TGTCCTTTGCAGGACATGGATGG - Intronic
1051612053 9:18970761-18970783 TATGCTTTTTATGACATGGATGG + Intronic
1052618782 9:30878104-30878126 TGTCCTTTGCAGAACATGGATGG - Intergenic
1053049232 9:34945062-34945084 TGTCATTTGGAAGACATGGGGGG - Intergenic
1054928345 9:70610927-70610949 TACCCTTTGCCTGAGATGGAAGG + Intronic
1055696866 9:78894401-78894423 TTACCTGTGCAAGACATGGAAGG - Intergenic
1056485337 9:87051301-87051323 TGTCTTTTGCAGAGCATGGATGG + Intergenic
1056567871 9:87790773-87790795 TGTCATTTGCGTGAAATGGATGG + Intergenic
1056844702 9:90027133-90027155 TGTGATTTGCAGGACATAGAAGG - Intergenic
1058234177 9:102468524-102468546 TGTCCTTTGAGGGACGTGGACGG + Intergenic
1058406463 9:104681056-104681078 TGTCATTTGCACAACATGGATGG + Intergenic
1058549369 9:106097549-106097571 TGTCCTTTGCAGGACATGGATGG + Intergenic
1059831700 9:118103394-118103416 TGTCCTTTGCAGGGCATGGGTGG + Intergenic
1203573184 Un_KI270744v1:151806-151828 TATCCTGTGCATGGCTTGGAGGG + Intergenic
1186051300 X:5598504-5598526 CGTCTTTTGCAGAACATGGATGG - Intergenic
1186927158 X:14346785-14346807 TGTCATTTGTAAAACATGGATGG - Intergenic
1187640241 X:21279763-21279785 TGTCTTTTGCAGGACATGAATGG - Intergenic
1187640561 X:21284263-21284285 TGTCCTTGGCAGGACGTGGATGG + Intergenic
1187724560 X:22189082-22189104 TGTCATTTGCAACACATGGATGG - Intronic
1188090620 X:25960196-25960218 TTTCTTTTGCAGGGCATGGATGG - Intergenic
1188288604 X:28360799-28360821 TCTCATATGCATAACATGGAAGG + Intergenic
1188419141 X:29975183-29975205 TGTCATTTGAACAACATGGATGG - Intergenic
1189926742 X:45962709-45962731 TGTACTTTGCAGCACATGCATGG + Intergenic
1190373915 X:49769975-49769997 TGTCCTTTGTGGGATATGGATGG - Intergenic
1190629077 X:52367702-52367724 GGTCCTTTCCATGACATGTGGGG + Intergenic
1191026762 X:55922302-55922324 TGTCCTTTGTAGGACATGGATGG + Intergenic
1193560630 X:83012488-83012510 TTCCCATTGCATGACATTGATGG - Intergenic
1193877172 X:86874399-86874421 TGTCCTGTGCAGGACACAGATGG + Intergenic
1194172585 X:90605807-90605829 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1195207668 X:102619246-102619268 TGTCCTTTGCAGCAAATTGATGG - Intergenic
1195213602 X:102674448-102674470 TGTCCTTTCAGGGACATGGATGG - Intergenic
1195437327 X:104860379-104860401 TGTCCTTTGCATGTCATAGGAGG + Intronic
1196072499 X:111542004-111542026 TTTCCTTTGCATGACTTTGGTGG + Intergenic
1196486568 X:116217303-116217325 TGTCTTTTGCAGAACATGGATGG + Intergenic
1196555678 X:117082350-117082372 TGTCCTTTGCATGTCAGAAAAGG + Intergenic
1197989384 X:132300841-132300863 TGTCCTTTTCAAGATGTGGAAGG - Intergenic
1198998341 X:142602866-142602888 TGTCCTTTGCAGAACATGGATGG - Intergenic
1200518812 Y:4183544-4183566 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1200765472 Y:7077306-7077328 TGGCCTATGCATGGCAGGGAGGG + Intronic
1201537193 Y:15063406-15063428 TGTAGCTTGCAGGACATGGATGG - Intergenic
1202275668 Y:23117094-23117116 TGTCTTTTGCAGGAAGTGGATGG + Intergenic
1202290360 Y:23303597-23303619 TGTCTTTTGCAGGAAGTGGATGG - Intergenic
1202428660 Y:24750813-24750835 TGTCTTTTGCAGGAAGTGGATGG + Intergenic
1202442131 Y:24919276-24919298 TGTCTTTTGCAGGAAGTGGATGG - Intergenic