ID: 906874601

View in Genome Browser
Species Human (GRCh38)
Location 1:49523500-49523522
Sequence TTCACTTGATTCCAAAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906874600_906874601 6 Left 906874600 1:49523471-49523493 CCTTAAATATTGGTGCAATTATA 0: 1
1: 0
2: 4
3: 28
4: 294
Right 906874601 1:49523500-49523522 TTCACTTGATTCCAAAAAACTGG 0: 1
1: 0
2: 0
3: 25
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906874601 Original CRISPR TTCACTTGATTCCAAAAAAC TGG Intronic
902996163 1:20226969-20226991 ATCAATTGAATCCAAAACACAGG + Intergenic
903406606 1:23102650-23102672 TAAACTTGATTTAAAAAAACAGG + Intronic
906874601 1:49523500-49523522 TTCACTTGATTCCAAAAAACTGG + Intronic
907999157 1:59663692-59663714 TTCACTTGACTCCACAAAAAAGG - Intronic
910059433 1:83070734-83070756 TTAACTTGCTGCCAAAGAACTGG - Intergenic
910243786 1:85117238-85117260 TTCACTTTTTTTTAAAAAACTGG - Intronic
912349783 1:109000805-109000827 TTCACTTGATTCAACAATATTGG - Intronic
912426215 1:109593941-109593963 TTCACTAGTTTACAAAAAAAAGG + Exonic
912814111 1:112815314-112815336 TTCACTTGCGTCCACCAAACAGG - Intergenic
915475864 1:156152510-156152532 TTCTCTTGATTCTAAGAAACTGG + Intronic
917485157 1:175448866-175448888 TTCCCTCCATGCCAAAAAACAGG + Intronic
920323842 1:205145834-205145856 TCCATTAGATTCCGAAAAACAGG - Exonic
921779115 1:219140554-219140576 TTCACTTATTACCAAAAAAATGG - Intergenic
922357813 1:224793351-224793373 TTCTCTTCAATCCACAAAACTGG - Intergenic
1064778448 10:18806419-18806441 TTTTCTTGCTTCCACAAAACTGG + Intergenic
1065101052 10:22334168-22334190 TCCACTGCTTTCCAAAAAACAGG + Intergenic
1065268891 10:24006459-24006481 TTTACTTGATGCCAGAAAACTGG - Intronic
1066928371 10:41726153-41726175 TTCTTTTGATTCAAAAAAATTGG + Intergenic
1067730778 10:48809892-48809914 TTCACTTGTTCCCAAAAGTCTGG + Intronic
1067985917 10:51144819-51144841 TTCACTTAATTCCAGAAAATTGG - Intronic
1069677566 10:70259606-70259628 TTCACTGAGTTACAAAAAACTGG + Intronic
1069888396 10:71638074-71638096 TTCACATGCTTACAAAACACGGG + Intronic
1074304714 10:112266126-112266148 TTCATTTTATTGCATAAAACTGG + Intergenic
1080146622 11:28993242-28993264 ATGACATGATTCCAAAAAAAGGG + Intergenic
1080847724 11:36040779-36040801 TTCACATGTTGCCAACAAACTGG - Intronic
1085189777 11:74609176-74609198 TTCAAGTGATTCTAAAATACAGG - Intronic
1088223685 11:107594928-107594950 TGCAGTTAATTCCAAAAAACTGG + Intronic
1088621316 11:111687189-111687211 TTCACTGGAGTCCAAATAAATGG - Intronic
1092370996 12:7916426-7916448 AACACTTGATTCCAAAAAAAAGG + Intergenic
1093684745 12:22043473-22043495 TTCACTGCATTCCAAAAGCCAGG - Intergenic
1094247289 12:28313418-28313440 TTCACCTGATTTCAGAATACTGG + Intronic
1095392482 12:41725686-41725708 TTCACTTGAGTCCAAAAATTTGG + Intergenic
1097155791 12:57011381-57011403 TTCACTAGCTTCCAAAGAATTGG - Intronic
1099316505 12:81089448-81089470 TGCACTGGATTCCTAAAAAATGG - Intronic
1099967646 12:89467215-89467237 TTCACTTTATTCAATAAATCTGG + Intronic
1101422547 12:104561520-104561542 TTCACTTGTTCCCCAAAACCTGG - Intronic
1102521197 12:113478326-113478348 TTCTCTTGATACCGAAAAAAAGG - Intergenic
1106853684 13:33823273-33823295 TTCCCTTCAATCCAGAAAACTGG + Intronic
1107341468 13:39411457-39411479 TGAACTTGATTCCAAAATAGTGG + Intronic
1108983419 13:56549517-56549539 ATCAATTCATTCCAAAAAAATGG - Intergenic
1109465524 13:62727027-62727049 TTCATTTGGAACCAAAAAACAGG - Intergenic
1111996233 13:95168504-95168526 TTCACATTATTGCAACAAACGGG - Intronic
1112151569 13:96770442-96770464 ATCACTTGGTTCCAAAAAGCAGG - Intronic
1112165221 13:96911045-96911067 TTCTTTTGCATCCAAAAAACAGG + Intergenic
1114808084 14:25861219-25861241 TTCACTTGAGCCTAAAAATCAGG - Intergenic
1114992712 14:28307806-28307828 TTCAATTAATTACAAAACACAGG - Intergenic
1115238414 14:31230873-31230895 TTCACTTTATTCCAACAAATAGG + Intergenic
1115305125 14:31925691-31925713 ATCAGTGGATTACAAAAAACAGG + Intergenic
1115475115 14:33805977-33805999 TTCAGTTGAGCACAAAAAACTGG + Intergenic
1116645245 14:47519817-47519839 ATCTCTTAATTCCAAAAAAGAGG - Intronic
1117200787 14:53387966-53387988 TTCATTCAATTCCAAAAAATTGG - Intergenic
1119998040 14:79274433-79274455 TTTATTTGATTCCCTAAAACCGG + Intronic
1120138890 14:80904661-80904683 TTTACTTGGTTCCAAAAAAAGGG + Intronic
1120174689 14:81280498-81280520 TCCCTTTGATTCCAAACAACTGG - Intronic
1120434417 14:84462807-84462829 TTCAGTAGATTCTAAAATACTGG - Intergenic
1121383082 14:93491400-93491422 TTAACTAGATTCCAAATAAATGG - Intronic
1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG + Intronic
1125129529 15:36266530-36266552 TACAGTTGATTCCATAATACAGG - Intergenic
1125224109 15:37375396-37375418 TGCACCTGATTCCGAAAATCTGG - Intergenic
1125781766 15:42275075-42275097 TACACTTGATTAAAATAAACTGG + Intronic
1125880339 15:43188525-43188547 TACACTTCATTTCCAAAAACAGG + Intronic
1125890351 15:43260943-43260965 TTAACTTGAGTCCAAGAAAGCGG - Intronic
1126234855 15:46371823-46371845 TTTACTTTCTTCCAGAAAACTGG - Intergenic
1126283972 15:46989650-46989672 TTCACTTTACTACAGAAAACTGG + Intergenic
1127410799 15:58704577-58704599 ATCACTGCATTCCAAAAAGCTGG + Intronic
1127488497 15:59440415-59440437 TTCACTTGATGCCCCAAAAAAGG + Intronic
1127799128 15:62462613-62462635 CTCACTTGTCTCCTAAAAACAGG - Intronic
1128889429 15:71317678-71317700 TTCACATGATTCCAAGGAAGAGG + Intronic
1131841069 15:96438284-96438306 TTCACTTGGTTCCACAATCCAGG - Intergenic
1135318450 16:21472247-21472269 TTCACTTAACTCCAAAAAAGTGG + Intergenic
1135371343 16:21904042-21904064 TTCACTTAACTCCAAAAAAGTGG + Intergenic
1135440444 16:22466673-22466695 TTCACTTAACTCCAAAAAAGTGG - Intergenic
1135792125 16:25406724-25406746 TTCATTTGAAACCAAAAGACTGG + Intergenic
1136328650 16:29553676-29553698 TTCACTTAAATCCAAAAAAATGG + Intergenic
1136443337 16:30293689-30293711 TTCACTTAAATCCAAAAAAATGG + Intergenic
1138324262 16:56149697-56149719 TTCACTTGAATGCAAAATGCTGG - Intergenic
1138746271 16:59366763-59366785 TTCACTTGATGACAAAATACTGG - Intergenic
1139890063 16:70246112-70246134 TTCACTTAACTCCAAAAAAATGG + Intergenic
1140610411 16:76592107-76592129 TTCACCTGGTTCCAAAAGCCTGG - Intronic
1144054615 17:11528633-11528655 TTCACTTAATAACAAAGAACTGG + Intronic
1144098458 17:11922989-11923011 TTCACTTAATTCCCAAAGAGGGG - Intronic
1149765356 17:59272043-59272065 TTTACTTGAGTACAAAAAAAAGG - Intronic
1150487272 17:65552462-65552484 ATCACTGGATTCCTAACAACAGG - Intronic
1151060868 17:71092228-71092250 TTCATTTGTTTCCATAAAATAGG - Intergenic
1151851472 17:76692892-76692914 TTCACCAGGTTCCAAAGAACTGG + Intronic
1151915616 17:77115698-77115720 TTCTCTTGCTTTCAAAACACAGG + Intronic
1153192842 18:2561505-2561527 TTAACTTGATGCCATAAAAATGG + Intronic
1153389090 18:4534239-4534261 TTTACTTTCTTCCAAAAAAATGG + Intergenic
1153694677 18:7627891-7627913 TTCCATTGATTCCAAATAAGAGG + Intronic
1156285690 18:35693327-35693349 TTCACTCTATTCCAGACAACTGG - Intronic
1157112099 18:44830839-44830861 TTGAATTGATTCCAAAAGTCTGG + Intronic
1159242585 18:65761268-65761290 TTCACATGACTAGAAAAAACAGG - Intronic
1159433993 18:68392131-68392153 CTCACTTGTTTCCAATAAACTGG + Intergenic
1159682907 18:71377254-71377276 TTCAGTTTATTGGAAAAAACTGG - Intergenic
1160467736 18:79095840-79095862 TCCTCTTGATTTCAAGAAACAGG - Intronic
1161387579 19:4004524-4004546 TACACTTCATTCCATAAAATAGG + Intergenic
1164649195 19:29879849-29879871 TGCACCTGATTCCAAAAAGTAGG - Intergenic
1164724180 19:30454064-30454086 CTCACTTGCTTCCAAAGGACAGG + Intronic
925486162 2:4334157-4334179 TTCACTTGTATCCAAAGCACAGG - Intergenic
925992216 2:9262915-9262937 TTCACTTTAGTCAAATAAACAGG - Intronic
927887767 2:26728981-26729003 TTCCCTTGGTTCCAAAAGCCAGG + Exonic
928252163 2:29690526-29690548 TTGACTATATTCCAAAACACCGG + Intronic
928929819 2:36612477-36612499 CTTACTTTATTCCACAAAACTGG - Intronic
929652373 2:43693416-43693438 ATTACTTGATTCCAATAAAGTGG - Intronic
931215650 2:60241628-60241650 TTCAATTAATTCAAAAAAAGTGG - Intergenic
931233473 2:60393894-60393916 TTCACTTAATTCATAAAGACAGG + Intergenic
932115797 2:69045818-69045840 TGCATTTCATTCAAAAAAACAGG + Intronic
932208311 2:69904379-69904401 TTAACTTGCATTCAAAAAACAGG + Exonic
932208900 2:69910461-69910483 TTAACTTGCATTCAAAAAACAGG + Intronic
932799103 2:74723704-74723726 TCCACGTGAGTCCAATAAACTGG - Intergenic
935616434 2:105087829-105087851 TTCCTTTGATTCCTCAAAACAGG + Intronic
935688646 2:105710489-105710511 TGCACTTAATGCCATAAAACTGG - Intergenic
935940966 2:108238965-108238987 GTCACATGATTCCTAAAACCAGG + Intergenic
936827569 2:116600906-116600928 TCAACTTGATTTCAAATAACTGG + Intergenic
937754514 2:125519867-125519889 TGCTCTTGATACCAAAAATCTGG + Intergenic
939431284 2:142111827-142111849 TTTAATTGAGTGCAAAAAACAGG + Intronic
940306167 2:152229354-152229376 TTAATTTGATTCAAAAAATCAGG - Intergenic
940392345 2:153146971-153146993 TTCACTTTATTCCAGAAGCCAGG + Intergenic
940419462 2:153462648-153462670 TTCCTTTGATTCTAAACAACAGG - Intergenic
940601393 2:155866066-155866088 TTCATTTTATTACAAAACACTGG + Intergenic
940736718 2:157462126-157462148 TTTATTTGATTTCAAAGAACAGG - Intronic
941078567 2:161033984-161034006 TTCATCAGTTTCCAAAAAACAGG + Intergenic
941432037 2:165424734-165424756 TCTACTCTATTCCAAAAAACAGG - Intergenic
941733267 2:168943984-168944006 TTCACTTTAATCCAAACACCTGG + Intronic
942094521 2:172524605-172524627 TTCATGTGACTCAAAAAAACAGG + Intergenic
944822786 2:203447857-203447879 TCAACTTGATTCTTAAAAACCGG - Intronic
945475130 2:210272822-210272844 CTCACATGATTTCAAAATACAGG - Intergenic
1170199462 20:13727035-13727057 ATGTGTTGATTCCAAAAAACTGG + Intronic
1173064247 20:39694939-39694961 CTCAAATGATTCCAAGAAACTGG - Intergenic
1173462810 20:43257556-43257578 TGCACTTGACTGCAAATAACAGG - Intergenic
1174985207 20:55443845-55443867 TTCCCTTGATTCCTAAAACCTGG + Intergenic
1175349456 20:58308644-58308666 TTAACATGATTCCAAAAAAGAGG + Intergenic
1175667688 20:60874141-60874163 TTTCCTGGATTCCAAAACACAGG + Intergenic
1177630543 21:23721833-23721855 TTCCGTTGTTTCCAGAAAACTGG + Intergenic
1179932316 21:44578938-44578960 TGCACATGATTCCCCAAAACTGG - Intronic
1180238440 21:46480646-46480668 TTCCCTTGCTGCCAAAGAACGGG - Intronic
1180822799 22:18843223-18843245 TTCTCTTGCTTACAAAACACTGG - Intergenic
1181190164 22:21132802-21132824 TTCTCTTGCTTACAAAACACTGG + Intergenic
1181209038 22:21277722-21277744 TTCTCTTGCTTACAAAACACTGG - Intergenic
1181653667 22:24276851-24276873 TTCTCTTGCTTACAAAACACTGG + Intronic
1203217901 22_KI270731v1_random:17726-17748 TTCTCTTGCTTACAAAACACTGG + Intergenic
1203272936 22_KI270734v1_random:69131-69153 TTCTCTTGCTTACAAAACACTGG - Intergenic
955516313 3:59729781-59729803 TTCATTTGGTTCAAAAAGACGGG - Intergenic
956878536 3:73488145-73488167 TTCATTTGTTTCCTTAAAACGGG - Intronic
957309090 3:78496491-78496513 TTCACTGGATTCCTAGAATCTGG + Intergenic
957407319 3:79788483-79788505 TTCAATTGATTATAAAATACTGG + Intergenic
957452880 3:80402278-80402300 TACACGTGATAACAAAAAACGGG - Intergenic
958889495 3:99767685-99767707 TTCAGTTGATTACCAAAAAGTGG + Intronic
959807815 3:110578502-110578524 TTCAATTAATTCCAAATGACTGG - Intergenic
959941364 3:112085273-112085295 TTGACTTGAGTCCAAAAGTCTGG - Intergenic
963263612 3:143217304-143217326 TTCACCTATTTCCAAAAATCTGG - Intergenic
964182296 3:153903433-153903455 TTCAGTTGATTGCAAATAAGAGG + Intergenic
965923454 3:173948008-173948030 TTCACTTGAAGCCAAATATCAGG - Intronic
966235380 3:177695770-177695792 TTCACTTCATCCCAAGAAATTGG + Intergenic
966742483 3:183247010-183247032 TTCACTTGCTTGCAAGACACTGG - Intronic
966963904 3:184969832-184969854 TTCACTGGAATTCAAAACACTGG - Intronic
967017117 3:185492549-185492571 TCCACTGGATTCCAAAAGTCTGG + Intronic
970781938 4:19748033-19748055 ATCAGTTGATTCCAAAGAAAGGG + Intergenic
971447420 4:26765780-26765802 TTCACTAGATTAGAAAAAATAGG - Intergenic
972898401 4:43653069-43653091 TTCATTTGATTTCTAAAAAATGG - Intergenic
974266135 4:59588066-59588088 TTCACTGGATGCCAAAAAAGGGG - Intergenic
974741372 4:66012674-66012696 TTCCCTTGTTTCCTAAAAATTGG - Intergenic
979375574 4:119942501-119942523 TTGATTTGGTTTCAAAAAACTGG + Intergenic
979485408 4:121264658-121264680 TTCACTTGACTCCATAATATAGG + Intergenic
980469189 4:133228686-133228708 TTCTCTTGAATCCAAAGTACTGG + Intergenic
980483880 4:133427139-133427161 ATCACTGGATACCAACAAACTGG + Intergenic
980919831 4:139072877-139072899 TTGACTTGATACAAAAATACTGG - Intronic
981158892 4:141473394-141473416 TTGACTTCATTCCATAAAAGTGG + Intergenic
982043919 4:151422715-151422737 TTCACTAGATCCTGAAAAACTGG + Intronic
984169923 4:176346885-176346907 CTGCCATGATTCCAAAAAACTGG + Intergenic
984890214 4:184485303-184485325 TTCACTTCATTTCAAATAATTGG + Intergenic
986610290 5:9560319-9560341 TTCACTTTATTTAGAAAAACAGG + Intergenic
987256311 5:16155713-16155735 CTGACTTGATTCCCAAAAATCGG - Intronic
988551860 5:32207462-32207484 GTCACTTGCTTCCAACAAACAGG - Intergenic
989730742 5:44645156-44645178 TTCAGTTGTTTCCCAAAAGCGGG + Intergenic
990323522 5:54652274-54652296 TTCACTTTATTCCATAAAGGAGG + Intergenic
993315761 5:86403998-86404020 CTCACTTATTTCAAAAAAACTGG + Intergenic
994136250 5:96290582-96290604 TTCACTGGTTTCCCAAAGACAGG - Intergenic
997040341 5:130245416-130245438 TGTATTTGATTCCATAAAACTGG - Intergenic
997322180 5:132987568-132987590 TTAACTTGCATTCAAAAAACAGG - Intergenic
1000804527 5:165772957-165772979 CTCACTTTTTTCCAAAGAACTGG - Intergenic
1001193168 5:169649082-169649104 TTCACTTGAATCCACCAAAGTGG + Intronic
1003577078 6:7307052-7307074 TTCACTTGACTCCAGGACACTGG + Intronic
1003842774 6:10139402-10139424 TTTACTTCATTCTGAAAAACTGG - Intronic
1010415567 6:75607546-75607568 TTCACTTGGTTAAAAAAAAAAGG - Intronic
1013594978 6:111652214-111652236 TTCAGGTGATTTCAAACAACAGG + Intergenic
1013885850 6:114965632-114965654 TTAACTTAATTCCAAAAATCTGG - Intergenic
1014550422 6:122783991-122784013 TTCACTTGTTTATAAAAAAAAGG - Exonic
1016129247 6:140445283-140445305 TTCACTAGATTCAAAAATAGAGG - Intergenic
1017024150 6:150166902-150166924 TTCACTCGGTTCCAAATGACTGG - Intronic
1017606174 6:156135718-156135740 TTCATATGATGCCAAAAATCTGG - Intergenic
1018369293 6:163152975-163152997 TTCACTAGACTGCAAAACACTGG - Intronic
1020134368 7:5578559-5578581 TTCACTGAATTTCAAAGAACTGG + Intergenic
1022174970 7:27863907-27863929 TTCACTTCTTTGCCAAAAACTGG - Intronic
1022564082 7:31379492-31379514 TTCCCTTGATTAAAAAAAATGGG - Intergenic
1022784184 7:33620614-33620636 TTCTCCTGATTCAAAAAGACAGG - Intergenic
1023385809 7:39656792-39656814 TTCACTTTATCCCAAAATCCAGG - Intronic
1024621864 7:51166551-51166573 TTCAAACTATTCCAAAAAACAGG + Intronic
1027348197 7:77283735-77283757 TTCACATGATTAAAAAAAAGGGG - Intronic
1027546641 7:79535246-79535268 TTCACTTGATATTAAAAAAGAGG + Intergenic
1028495209 7:91453578-91453600 GTCAGTTGATTCTAAAAAATAGG - Intergenic
1030003840 7:105095773-105095795 CTCACTAGATTCCAAAAACCAGG + Intronic
1030852306 7:114504767-114504789 TCCACATGATTCCAAACATCTGG - Intronic
1032374553 7:131398323-131398345 TTAACTGGAATCCAAAAAGCAGG - Intronic
1032734303 7:134676830-134676852 GTCACCTGACTCCAAACAACAGG + Intronic
1032903055 7:136333053-136333075 TTCATTTGATGCCAAAGAAATGG - Intergenic
1033908999 7:146242698-146242720 TTCACTTTACTCCAAAAATAAGG - Intronic
1035131593 7:156659731-156659753 TTCACTTGTTTCCAGCAACCTGG - Intronic
1035450680 7:158974895-158974917 TTAACATGATTCCAAACAAAAGG - Intergenic
1035611716 8:970531-970553 TTTACATTAGTCCAAAAAACAGG - Intergenic
1038899749 8:31829071-31829093 TTTTCTTGATTCCCAAAAGCAGG - Intronic
1040381680 8:46879002-46879024 TTCTCCTAATTCCAAAAAATTGG + Intergenic
1041970194 8:63732185-63732207 TTAACTTGAGTTCAAAAATCAGG + Intergenic
1042227064 8:66522350-66522372 GTCATTTGAATTCAAAAAACTGG - Intergenic
1046633136 8:116641673-116641695 TTCATTTGACTCCAAATTACTGG - Intergenic
1047852331 8:128870455-128870477 TTCACTTGATTTTAAAAGAAAGG - Intergenic
1047861139 8:128968300-128968322 TTCACTTGCTCACAAATAACAGG + Intergenic
1049049961 8:140186872-140186894 TTTGCTTGATTCAAAAAAAAGGG - Intronic
1054902556 9:70384683-70384705 TTCATTTGATTTACAAAAACGGG + Exonic
1055194036 9:73564655-73564677 TTTAATTTATTCCAAAAAATGGG - Intergenic
1059662637 9:116417189-116417211 TTCTCTTGACTCCAACAAAGGGG + Intergenic
1059960099 9:119556392-119556414 TTGACCTGCTTCCAAAAAGCCGG + Intergenic
1060167193 9:121427937-121427959 TTCATTTGAATCCAAAAGAAAGG + Intergenic
1185720807 X:2379965-2379987 TTCTGTTGATTCCAAAATCCTGG + Intronic
1185762219 X:2697291-2697313 TTCAGGTGATTCTCAAAAACAGG - Intronic
1186300235 X:8192844-8192866 TTCACTTCATGCCTATAAACAGG + Intergenic
1187054427 X:15728846-15728868 TTCACATGGAACCAAAAAACGGG - Intronic
1187106529 X:16248880-16248902 TTCACTTCCTTCCACAAAAAAGG + Intergenic
1188087778 X:25922277-25922299 TTCATTTGATTCCTAAATAAAGG + Intergenic
1189084539 X:38007726-38007748 TTCACTAGAGTCCAAACAAATGG - Intronic
1189753238 X:44244599-44244621 TTGACTAGATTCCAACAAATTGG + Intronic
1194947146 X:100082770-100082792 CTCACTCCATTCCAAAGAACTGG + Intergenic
1195342766 X:103921005-103921027 TTCACTTGCTTCCAAGCATCAGG - Intronic
1195771079 X:108352082-108352104 TTCACCTGACTCCAAAGAAAAGG - Intronic
1201062128 Y:10055741-10055763 TTTACTTGAATCCTAATAACTGG + Intergenic