ID: 906875352

View in Genome Browser
Species Human (GRCh38)
Location 1:49532144-49532166
Sequence GCTTTCAGCTAGAGTTCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 104}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906875352_906875353 3 Left 906875352 1:49532144-49532166 CCAAGGGAACTCTAGCTGAAAGC 0: 1
1: 0
2: 0
3: 11
4: 104
Right 906875353 1:49532170-49532192 CTAGACTGTCATCTCTATGAAGG 0: 1
1: 0
2: 20
3: 196
4: 894
906875352_906875354 7 Left 906875352 1:49532144-49532166 CCAAGGGAACTCTAGCTGAAAGC 0: 1
1: 0
2: 0
3: 11
4: 104
Right 906875354 1:49532174-49532196 ACTGTCATCTCTATGAAGGCAGG 0: 1
1: 3
2: 10
3: 94
4: 580
906875352_906875355 11 Left 906875352 1:49532144-49532166 CCAAGGGAACTCTAGCTGAAAGC 0: 1
1: 0
2: 0
3: 11
4: 104
Right 906875355 1:49532178-49532200 TCATCTCTATGAAGGCAGGCAGG 0: 1
1: 0
2: 0
3: 14
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906875352 Original CRISPR GCTTTCAGCTAGAGTTCCCT TGG (reversed) Intronic