ID: 906875355

View in Genome Browser
Species Human (GRCh38)
Location 1:49532178-49532200
Sequence TCATCTCTATGAAGGCAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 191}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906875351_906875355 24 Left 906875351 1:49532131-49532153 CCTTTCAGCTGAGCCAAGGGAAC 0: 1
1: 0
2: 1
3: 17
4: 148
Right 906875355 1:49532178-49532200 TCATCTCTATGAAGGCAGGCAGG 0: 1
1: 0
2: 0
3: 14
4: 191
906875352_906875355 11 Left 906875352 1:49532144-49532166 CCAAGGGAACTCTAGCTGAAAGC 0: 1
1: 0
2: 0
3: 11
4: 104
Right 906875355 1:49532178-49532200 TCATCTCTATGAAGGCAGGCAGG 0: 1
1: 0
2: 0
3: 14
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906875355 Original CRISPR TCATCTCTATGAAGGCAGGC AGG Intronic