ID: 906877110

View in Genome Browser
Species Human (GRCh38)
Location 1:49551680-49551702
Sequence GCTATCACCTCCACTGGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 17, 3: 88, 4: 269}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906877110_906877116 14 Left 906877110 1:49551680-49551702 CCTGTTCCAGTGGAGGTGATAGC 0: 1
1: 0
2: 17
3: 88
4: 269
Right 906877116 1:49551717-49551739 TCCATGAGAGTTCTTAGCTTTGG 0: 6
1: 31
2: 91
3: 158
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906877110 Original CRISPR GCTATCACCTCCACTGGAAC AGG (reversed) Intronic