ID: 906877110 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:49551680-49551702 |
| Sequence | GCTATCACCTCCACTGGAAC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 375 | |||
| Summary | {0: 1, 1: 0, 2: 17, 3: 88, 4: 269} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 906877110_906877116 | 14 | Left | 906877110 | 1:49551680-49551702 | CCTGTTCCAGTGGAGGTGATAGC | 0: 1 1: 0 2: 17 3: 88 4: 269 |
||
| Right | 906877116 | 1:49551717-49551739 | TCCATGAGAGTTCTTAGCTTTGG | 0: 6 1: 31 2: 91 3: 158 4: 291 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 906877110 | Original CRISPR | GCTATCACCTCCACTGGAAC AGG (reversed) | Intronic | ||