ID: 906877116

View in Genome Browser
Species Human (GRCh38)
Location 1:49551717-49551739
Sequence TCCATGAGAGTTCTTAGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 577
Summary {0: 6, 1: 31, 2: 91, 3: 158, 4: 291}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906877109_906877116 20 Left 906877109 1:49551674-49551696 CCATCACCTGTTCCAGTGGAGGT 0: 1
1: 45
2: 157
3: 279
4: 505
Right 906877116 1:49551717-49551739 TCCATGAGAGTTCTTAGCTTTGG 0: 6
1: 31
2: 91
3: 158
4: 291
906877114_906877116 8 Left 906877114 1:49551686-49551708 CCAGTGGAGGTGATAGCGGGGTG 0: 1
1: 0
2: 1
3: 37
4: 193
Right 906877116 1:49551717-49551739 TCCATGAGAGTTCTTAGCTTTGG 0: 6
1: 31
2: 91
3: 158
4: 291
906877106_906877116 29 Left 906877106 1:49551665-49551687 CCATGGACACCATCACCTGTTCC 0: 1
1: 1
2: 44
3: 172
4: 477
Right 906877116 1:49551717-49551739 TCCATGAGAGTTCTTAGCTTTGG 0: 6
1: 31
2: 91
3: 158
4: 291
906877110_906877116 14 Left 906877110 1:49551680-49551702 CCTGTTCCAGTGGAGGTGATAGC 0: 1
1: 0
2: 17
3: 88
4: 269
Right 906877116 1:49551717-49551739 TCCATGAGAGTTCTTAGCTTTGG 0: 6
1: 31
2: 91
3: 158
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906877116 Original CRISPR TCCATGAGAGTTCTTAGCTT TGG Intronic