ID: 906886151

View in Genome Browser
Species Human (GRCh38)
Location 1:49650996-49651018
Sequence CTCTGTGTACGGAGGGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 5, 3: 15, 4: 241}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906886151_906886156 30 Left 906886151 1:49650996-49651018 CCATCTGCCCTCCGTACACAGAG 0: 1
1: 0
2: 5
3: 15
4: 241
Right 906886156 1:49651049-49651071 AGCCACAGAATTGTCTGCTCTGG 0: 1
1: 1
2: 4
3: 18
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906886151 Original CRISPR CTCTGTGTACGGAGGGCAGA TGG (reversed) Intronic
901032874 1:6318483-6318505 CTTTGTGCACGGAGGTAAGAAGG - Exonic
902375370 1:16027800-16027822 CTCTGGGGAAGGAGGGCAGTGGG - Exonic
902380334 1:16049597-16049619 CTCTGGGGAAGGAGGGCAGTGGG - Exonic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
904030872 1:27532700-27532722 CTGTGTTTAGGGAGGGGAGAGGG - Intergenic
905408819 1:37754309-37754331 CTCTGGGCACGGTGAGCAGAGGG + Exonic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
906886151 1:49650996-49651018 CTCTGTGTACGGAGGGCAGATGG - Intronic
907461513 1:54608283-54608305 CTCTGGGTGCTGAAGGCAGAAGG + Intronic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
908457314 1:64316254-64316276 TTCTGTGTAGAAAGGGCAGAGGG + Intergenic
910500443 1:87883955-87883977 CTCTGTGTAAAGGGGTCAGAGGG + Intergenic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
913186486 1:116373956-116373978 CTCAGGGCACGGAGGGCGGAGGG - Exonic
915715172 1:157938738-157938760 CTTTGTGTACTGATGTCAGAGGG + Intergenic
918193371 1:182198134-182198156 CTCCTTGTCCTGAGGGCAGAGGG + Intergenic
918234781 1:182570188-182570210 CTCTGTGAACAGAAAGCAGAGGG - Intergenic
919787699 1:201270276-201270298 CTCTGAAAACGAAGGGCAGAGGG + Intergenic
919944874 1:202311831-202311853 CACAGTGTATGGAGGGCAAATGG + Intronic
920256742 1:204660532-204660554 GTCTGTGTAAGGCGGGGAGAAGG - Intronic
922063400 1:222113057-222113079 ATCTGTCTACGAAGAGCAGAGGG - Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923400434 1:233611359-233611381 CTCTTTGTTCTTAGGGCAGATGG + Intergenic
923986756 1:239390546-239390568 CTCCGTGGAGGGTGGGCAGAGGG - Intronic
1062934282 10:1374612-1374634 CGCTGCATACGGCGGGCAGAGGG - Intronic
1064103739 10:12484338-12484360 CTCTGTGTTTGGAGGGAGGAGGG + Intronic
1064782396 10:18856819-18856841 CTCTTTGTTCTTAGGGCAGATGG + Intergenic
1065117674 10:22498236-22498258 CTCTATGTATGCAGGTCAGAGGG + Intergenic
1067544601 10:47183939-47183961 CTCTGTGGTTGGAGGGCAGAGGG + Intergenic
1067934051 10:50593062-50593084 CTCTGTTTTCGGAGGGAAGCTGG + Intronic
1069560872 10:69428416-69428438 CTCAGTGGAGGGAGGGCAGTTGG - Intergenic
1070782672 10:79146669-79146691 CTCTGGGTGGGGAGGGCGGAAGG + Intronic
1071293470 10:84203223-84203245 CTCTGTGTGAGGAGGGCAACCGG - Intronic
1071307049 10:84308848-84308870 CTCTGAGGAGGGTGGGCAGAGGG - Intergenic
1072189570 10:93068919-93068941 CTCTGGGCGCGGAGCGCAGAAGG - Intergenic
1073200101 10:101728304-101728326 CTGTGTTTATGGAGGACAGAGGG - Intergenic
1074707452 10:116147617-116147639 CTCTGTGTGAGGATGGCAGGTGG - Intronic
1076912501 10:133398678-133398700 CTCCCTGTACTGAGGGCACAAGG + Intronic
1077581275 11:3418802-3418824 CACTTGGAACGGAGGGCAGAGGG + Intergenic
1078067999 11:8090364-8090386 AGCTGAGTAGGGAGGGCAGAGGG + Intronic
1078095050 11:8291689-8291711 CCCTGTTTCCGGAGGGCAGGTGG + Intergenic
1078657954 11:13259965-13259987 CTGTGTGGGCGGGGGGCAGAGGG + Intergenic
1079354639 11:19720025-19720047 CTCATTGTTCTGAGGGCAGAAGG + Intronic
1080776974 11:35395101-35395123 CCCTGAGTAGGGAGGGCAGTGGG + Intronic
1086436998 11:86791361-86791383 ATCTGTGTGCGGAGGGCAGAAGG + Intronic
1089647997 11:119892706-119892728 TTCAGTGGACGGAGCGCAGACGG - Intergenic
1090141651 11:124271097-124271119 CTCTTTGTTCTTAGGGCAGATGG - Intergenic
1091963641 12:4720180-4720202 CTCTTTGTTCTTAGGGCAGATGG + Intronic
1094210442 12:27884820-27884842 CTCTGGGGATGGAGGGCACAAGG + Intergenic
1096480301 12:51935861-51935883 CTCTGTGTGCATAGGGAAGAAGG - Intergenic
1097931247 12:65189369-65189391 CTCTGTGTCCGGAGGGCAGTTGG + Intronic
1098219371 12:68252448-68252470 CTCTGTGGAAGGAGGGAAGGAGG + Intronic
1099200583 12:79672164-79672186 CTCTGTGTACGGGAAGGAGAGGG - Intronic
1102760859 12:115383703-115383725 ATCTCTTTACTGAGGGCAGATGG + Intergenic
1102797349 12:115700344-115700366 ATCTGTGTGGGAAGGGCAGAAGG - Intergenic
1103251774 12:119506139-119506161 CTCTGGGTAAGAAGGGCAGAAGG - Intronic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1104920899 12:132290238-132290260 CTGTGTGTGGTGAGGGCAGACGG - Intronic
1105213656 13:18272365-18272387 CTGTGTGTGGGGAGGGCACAGGG - Intergenic
1105767321 13:23574734-23574756 CTCTGTGATGGGAGGGCAGAGGG + Intronic
1107247947 13:38319894-38319916 CTCTTTGTTCTTAGGGCAGATGG + Intergenic
1109658822 13:65431421-65431443 GTGTGTGTACTGGGGGCAGAGGG + Intergenic
1111195345 13:84869545-84869567 CTCTTTGTTCTTAGGGCAGATGG - Intergenic
1111196238 13:84877126-84877148 CTCTTTGTTCTTAGGGCAGATGG - Intergenic
1112645401 13:101325820-101325842 CTCTGTGAAATGAGGCCAGAAGG - Intronic
1113882309 13:113634136-113634158 CTCTGTGTCCGGCTGGCAGACGG + Intronic
1114445324 14:22783820-22783842 CTCTCTGTACTGAGCACAGAAGG + Intronic
1115238257 14:31229077-31229099 CACTGTGTACAGAGGGGACATGG + Intergenic
1115889531 14:38011425-38011447 CTCTTTGTTCTTAGGGCAGATGG - Intronic
1116683767 14:48011587-48011609 CTCTTTGTTCTTAGGGCAGATGG - Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117442369 14:55772014-55772036 CTCTTTGTACTCAGGGCAGAGGG + Intergenic
1118845373 14:69544058-69544080 CTCTGAGTAGGGAGGTCAGTAGG + Intergenic
1119414258 14:74459123-74459145 CTCTGTCTCTGGAGGGGAGAGGG + Intergenic
1120176708 14:81302019-81302041 CACTGTGCACTGAGGGCAGTTGG + Intronic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1121234187 14:92380234-92380256 CTCTGTTTAATGAGGACAGAGGG - Intronic
1122419998 14:101569929-101569951 CTCTGTGTACACAGGGGAGTGGG - Intergenic
1202889638 14_KI270722v1_random:143911-143933 ATTTGTGTCAGGAGGGCAGAGGG - Intergenic
1124598368 15:31110514-31110536 CTCTTTGTCTGGAAGGCAGAGGG + Intronic
1125374173 15:39011425-39011447 CTCTTTGTTCTTAGGGCAGATGG - Intergenic
1125766770 15:42141575-42141597 CTCAGTGTAAGGAGGACAGCTGG + Exonic
1126119967 15:45242660-45242682 CTCTTTGTTCTTAGGGCAGATGG + Intergenic
1126359142 15:47827944-47827966 CTCTATGAACGGAGGGAAGTGGG - Intergenic
1127008311 15:54594968-54594990 CTCTTTGTTCTTAGGGCAGATGG + Intronic
1127646901 15:60967902-60967924 CTCTGTGGAGGCAGGGGAGATGG - Intronic
1129118864 15:73382782-73382804 CTCTGTATACCCAGGGCTGATGG + Intergenic
1129269520 15:74412011-74412033 GTCTGTGTATGGTGGACAGAGGG + Exonic
1129359072 15:75013046-75013068 CTCTGTGAAAGGAGGGTGGAGGG - Intronic
1129759337 15:78120474-78120496 CTCTGTGTACCAAGGGGACAAGG + Intronic
1131403639 15:92145966-92145988 CTCTGTGTTCTGTGGGGAGAGGG + Intronic
1131786229 15:95914003-95914025 CACTGTGTAGGGAGGGGGGATGG + Intergenic
1132944200 16:2523618-2523640 CTCTGTGTGGGGAGGGCTGTGGG - Intronic
1132968828 16:2674908-2674930 CTGTGTCTCCAGAGGGCAGAGGG - Intergenic
1135075959 16:19393755-19393777 CTCTTTGTTCTTAGGGCAGATGG + Intergenic
1135076911 16:19401739-19401761 CTCTTTGTTCTTAGGGCAGATGG + Intergenic
1135838520 16:25851409-25851431 CTCTATGGACAGAGGGCAAATGG - Intronic
1136188915 16:28604009-28604031 CTCTGTGTTCAGAGGACCGAGGG - Intergenic
1137660898 16:50205197-50205219 TTCTGTGTGGGGCGGGCAGAGGG + Intronic
1141769101 16:86078124-86078146 CTCTGGGAAGGGAAGGCAGAGGG - Intergenic
1142621300 17:1167213-1167235 CTGGGTGTTAGGAGGGCAGAAGG - Intronic
1142809577 17:2389046-2389068 CTGTGTGTGATGAGGGCAGACGG - Intronic
1149105697 17:52961876-52961898 CTCTTTGTTCTTAGGGCAGATGG - Intergenic
1151470734 17:74316162-74316184 CTTTGAGTACGGGGGGCAGCTGG - Intergenic
1151700580 17:75740613-75740635 ATCTGTTTCCAGAGGGCAGAAGG + Intronic
1151905291 17:77044147-77044169 CTGTGTGCACTGTGGGCAGAGGG + Intergenic
1152080392 17:78183820-78183842 CTCTGTTTAGGGAGGGAAGAGGG - Intronic
1152248834 17:79200906-79200928 CTCTGTGTGCGGCGGGCAGCTGG + Intronic
1152363265 17:79842076-79842098 CTTTGTGGATGGTGGGCAGATGG + Intergenic
1153307887 18:3649533-3649555 CACAGTGTACGGAAGGCAGTAGG - Intronic
1154437854 18:14360691-14360713 CTCTGGGGGCGGAGAGCAGAGGG - Intergenic
1157434899 18:47660000-47660022 CTCTGTGTAGTGGGGGCAGGTGG + Intergenic
1158932399 18:62334465-62334487 CTCTGTGTAGGGTGGGAGGAGGG + Intronic
1160178852 18:76617485-76617507 CACTGTGTCCTGAGGGCAGAGGG + Intergenic
1160600915 18:80011987-80012009 CTCTTTGTTCTTAGGGCAGATGG - Intronic
1161267447 19:3370885-3370907 CGCTGTGTGCTCAGGGCAGATGG - Intronic
1163104848 19:15117280-15117302 CTCTCTGTCCTGAGGGCAGTGGG + Intronic
1164414697 19:28037278-28037300 TTCTGTGTCCTGAGGGGAGAGGG - Intergenic
1165412059 19:35668140-35668162 CACTGTCAAGGGAGGGCAGATGG + Intronic
1165752394 19:38268194-38268216 CTCTGAGTAGTGAGGGCAGGTGG + Intronic
1166161736 19:40959113-40959135 CTCTTTGTTCTTAGGGCAGATGG - Intergenic
1166366422 19:42280673-42280695 CTTTGTGCAGGGAGGGCGGACGG - Intronic
1166423520 19:42656079-42656101 CTCAGAGTACAGAGGACAGAGGG + Intronic
1166656498 19:44615789-44615811 CTCTCAGGGCGGAGGGCAGAGGG + Intronic
1166674538 19:44731998-44732020 CTATGTCTCCGGAGGGCAGGTGG + Intergenic
1166991511 19:46695607-46695629 GCTTGTGTGCGGAGGGCAGATGG + Intronic
1202665039 1_KI270708v1_random:110678-110700 ATTTGTGTCAGGAGGGCAGAGGG - Intergenic
925975129 2:9137099-9137121 CCCTGTGAACGGAGGGCTGGAGG + Intergenic
926698212 2:15785238-15785260 CCCTGTGTGCCGAGGGCAGCGGG + Intergenic
927072605 2:19546371-19546393 CTCTGTGCAAGGAGGACACAAGG - Intergenic
927135954 2:20096689-20096711 CTATGAGAATGGAGGGCAGAGGG - Intergenic
927964223 2:27259122-27259144 CTCTGTGTATGGAAGGAAAAGGG - Intronic
933246734 2:79984646-79984668 GTCAGTGTGCTGAGGGCAGAGGG + Intronic
933362384 2:81304655-81304677 CTCTTTGTTCTTAGGGCAGATGG + Intergenic
933729254 2:85444910-85444932 GTCTGTGAATGGAGGGGAGAGGG + Intergenic
934300672 2:91774381-91774403 CTGTGTGTGGGGAGGGCACAGGG + Intergenic
934965369 2:98716987-98717009 CTGTGTATACAGAGGGCCGACGG + Intronic
935354791 2:102187933-102187955 CTCTGGGAACGGAGGACACACGG - Intronic
937715181 2:125024381-125024403 CTCTTTGTTCTTAGGGCAGATGG + Intergenic
939185944 2:138861108-138861130 CTCTTTGTTCTTAGGGCAGATGG + Intergenic
939377274 2:141384897-141384919 CTCTTTGTTCTTAGGGCAGATGG - Intronic
939378960 2:141409489-141409511 CTCTGTGGAAGGAGAGGAGAAGG - Intronic
940594603 2:155773962-155773984 CTCTGTGTACAGGGGTCATATGG - Intergenic
942830965 2:180237242-180237264 CTCTTTGTTCTTAGGGCAGATGG - Intergenic
946760927 2:222992454-222992476 CTCTGTGTACAAAGTTCAGAAGG + Intergenic
1169083057 20:2809226-2809248 CTCTTTGTTCTTAGGGCAGATGG + Intergenic
1172387930 20:34547093-34547115 CTCTGTGGAGTGAGGGCAGCAGG + Intronic
1174354351 20:49988270-49988292 TTCTGTGGAGGGAGGGCAGCTGG + Exonic
1176457823 21:6928780-6928802 CTCTGGGGACGGAGAGCAGAGGG + Intergenic
1176835995 21:13793864-13793886 CTCTGGGGACGGAGAGCAGAGGG + Intergenic
1176870610 21:14080641-14080663 CTCTTTGTTCTTAGGGCAGATGG + Intergenic
1178116864 21:29426843-29426865 CTCTTTGTCTGGAGGGGAGAAGG - Intronic
1179343894 21:40538186-40538208 CTCTGAGTGGAGAGGGCAGAAGG - Intronic
1179996695 21:44977510-44977532 CTCTGGGGGCGGAGAGCAGAGGG + Intergenic
1180200747 21:46222685-46222707 CTCTGTATCCGGCTGGCAGAGGG + Exonic
1180331765 22:11487598-11487620 ATTTGTGTCAGGAGGGCAGAGGG - Intergenic
1180841429 22:18960635-18960657 CCCTGTGTGCAGATGGCAGATGG - Intergenic
1180934418 22:19615335-19615357 CTCTGTGTACCGAGGGAGGTGGG + Intergenic
1181060067 22:20278159-20278181 CCCTGTGTGCAGATGGCAGATGG + Intronic
1181388817 22:22564388-22564410 CTGGGTGTACAGAGGGCAGGAGG + Exonic
1181688168 22:24543428-24543450 CCCTGTGCCCGGAGGGCAGTAGG + Intronic
1181699027 22:24609517-24609539 CTGTGTGTGGGGAGGGCACAGGG + Intronic
1182683982 22:32106526-32106548 GCCTGTGAACTGAGGGCAGATGG + Intronic
1184162350 22:42704541-42704563 CTGTTTGTAAGAAGGGCAGAAGG + Intronic
1184371745 22:44086815-44086837 CTCTGAGTACGGATGGAAGTTGG + Intronic
1184718851 22:46297299-46297321 CTCTGTGAGCCGAGGGCTGAAGG + Intronic
949584933 3:5428162-5428184 CTCTGTGTCTGCGGGGCAGAAGG - Intergenic
953090971 3:39725880-39725902 CTCTGTGTCCGGGGGAAAGAGGG - Intergenic
953262601 3:41354238-41354260 CACTGTGGACTGAGGGGAGAAGG - Intronic
953621259 3:44534879-44534901 CTCTTTGTTCTTAGGGCAGATGG - Intergenic
955066999 3:55542377-55542399 CTCTGTGAAAAGAGTGCAGAAGG + Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
957522023 3:81330076-81330098 CTCTTTGTTCTTAGGGCAGATGG + Intergenic
957694577 3:83618583-83618605 CTCTTTGTTCTTAGGGCAGATGG + Intergenic
961445954 3:126981917-126981939 CTCTGTGTGGTGAGGGCACAGGG - Intergenic
963908179 3:150791503-150791525 CTCTGTGTGTGGAGGGCACATGG - Intergenic
963990326 3:151645961-151645983 CTCTGTGAACAGAGGGAATAGGG - Intergenic
964269883 3:154944513-154944535 CTCTTTGTTCTTAGGGCAGATGG + Intergenic
965024511 3:163283363-163283385 CTCTTTGTTCTTAGGGCAGATGG + Intergenic
969592788 4:8131511-8131533 TTCTGCATGCGGAGGGCAGATGG + Intronic
969699936 4:8762416-8762438 GTCTGTGGCTGGAGGGCAGAGGG - Intergenic
970766574 4:19556489-19556511 CTCTTTGTTCTTAGGGCAGATGG - Intergenic
971451755 4:26807313-26807335 CTCTGTCCAAGGAGGGAAGAAGG + Intergenic
975835055 4:78413876-78413898 CTCTGTCTGGGGAGGGGAGAGGG + Intronic
977456178 4:97262878-97262900 CTCTGTGTATGAAGGGCCCATGG - Intronic
977945915 4:102913919-102913941 CTCTGTCTAAGCAGGGCACAAGG - Intronic
979126580 4:116980613-116980635 CTCTTTGTTCTTAGGGCAGATGG - Intergenic
981129952 4:141147546-141147568 CTCTATGTACACAAGGCAGAGGG + Intronic
981466091 4:145074306-145074328 CTCTTTTTGAGGAGGGCAGAGGG + Intronic
985525513 5:399487-399509 CTCTGTGACTGGAGGGCAAATGG - Intronic
985880222 5:2633653-2633675 ATCTGTGTTCAGAGGGCAGAGGG + Intergenic
988530572 5:32023722-32023744 CTCTGGGTACAGATGGCAGTGGG + Intronic
988731950 5:33981187-33981209 CTCTGTGTAAGGAAGGCAGAGGG - Intronic
990149261 5:52798726-52798748 ATTTGTGTCAGGAGGGCAGAGGG + Intronic
990715536 5:58632493-58632515 GTCTGTTCACGGAGGGCTGAAGG + Intronic
994182519 5:96783090-96783112 CCGTGCGTACAGAGGGCAGAAGG - Exonic
994276509 5:97844671-97844693 TTTTGTGGACTGAGGGCAGAAGG + Intergenic
994917482 5:105999136-105999158 CTCTTTGTTCTTAGGGCAGATGG + Intergenic
996347788 5:122506073-122506095 CCCTGTTTATGGAGGGAAGATGG - Intergenic
997857376 5:137384177-137384199 CTCTGTATACAGGAGGCAGATGG + Intronic
998729923 5:145062923-145062945 CTGTGTGTGGGGAGGGCAGTGGG + Intergenic
998983991 5:147734896-147734918 CTCTGTGTAAAGTGGACAGATGG + Intronic
999302499 5:150499910-150499932 CTCTGTGTGCTGAGGCCAGCAGG + Intronic
1000724248 5:164749317-164749339 CTCTGAGTAAGGAGGAGAGAAGG - Intergenic
1000988690 5:167889305-167889327 CACTGTGGACGGAGGGCTGTGGG + Intronic
1002793679 6:453230-453252 CTCTGTGTGCAAAGGGCAGCTGG - Intergenic
1003911919 6:10750863-10750885 TTCTGTCTAAGGAGGGAAGATGG + Intronic
1005729322 6:28681845-28681867 CTATGTGTAGGGTGGGGAGATGG - Intergenic
1006736612 6:36278037-36278059 CTCTCTGAAAGGGGGGCAGAGGG - Intronic
1012827024 6:104159248-104159270 CTTTGGGTAGGGAGGGTAGAGGG + Intergenic
1013731432 6:113172801-113172823 TTCTGTGTTGGGAGGGGAGAGGG + Intergenic
1015847167 6:137532653-137532675 CTTTGTGGAGGGAAGGCAGAGGG - Intergenic
1019038693 6:169084615-169084637 CTCTTTGTTCTTAGGGCAGATGG - Intergenic
1020321236 7:6940126-6940148 CACTTGGAACGGAGGGCAGAGGG + Intergenic
1021528487 7:21616830-21616852 CTCTGTCTTCAGAGGGCATACGG - Intronic
1022259446 7:28690294-28690316 CTCTGTGTCTGGTGGGCAGAGGG - Intronic
1022899939 7:34797412-34797434 CTCTGTGTATGGGGGACAGGGGG + Intronic
1023385704 7:39655400-39655422 ATCAGTGTATGGAGGGGAGATGG + Intronic
1024300650 7:47885088-47885110 CTCTGGGAAAGGAGGGCTGAGGG - Intronic
1024330172 7:48147427-48147449 CTCTTTGTTCTTAGGGCAGATGG + Intergenic
1024335329 7:48201090-48201112 CTCTTTGTTCTTAGGGCAGATGG + Intronic
1025262934 7:57432905-57432927 TTTTGTTTATGGAGGGCAGAAGG - Intergenic
1025641126 7:63370736-63370758 TTTTCTTTACGGAGGGCAGAAGG - Intergenic
1033320041 7:140331174-140331196 GTCTGTGTGGGGAGGGGAGAAGG + Intronic
1033492348 7:141855716-141855738 CTCTGTGTGGGGAAGGCATACGG - Intergenic
1034940670 7:155228309-155228331 CCCTGAGTCCGGAGGGAAGAAGG + Intergenic
1035374103 7:158395939-158395961 CTCTGTGACCAGGGGGCAGAGGG - Intronic
1035692098 8:1566979-1567001 CTCTGTGGAGGGAGAGGAGATGG - Intronic
1035739601 8:1916194-1916216 CTCTGTGTCCTAAGTGCAGACGG + Intronic
1036849268 8:12190409-12190431 CACTTGGAACGGAGGGCAGAGGG + Intronic
1036870628 8:12432683-12432705 CACTTGGAACGGAGGGCAGAGGG + Intronic
1037896253 8:22658285-22658307 CTGTGTGTACGGAGGGCAAAGGG + Intronic
1043077022 8:75715440-75715462 CTCTGCCAGCGGAGGGCAGAGGG - Intergenic
1043130594 8:76456080-76456102 GACTGTGTGCGGAGGGCAGGGGG - Intergenic
1043295310 8:78654481-78654503 CTCTTTGTTCTTAGGGCAGAGGG - Intergenic
1044488527 8:92783381-92783403 CTGTGTGTAAGGAGAGCTGACGG + Intergenic
1047429280 8:124776570-124776592 CTCTGTCTTCAGAGTGCAGAAGG - Intergenic
1048330235 8:133466089-133466111 CTCTGTGGGCGGAGGACAGAAGG + Exonic
1049416645 8:142498456-142498478 CTCTGTGTCCTGAGGGCTGGGGG + Intronic
1049707012 8:144047683-144047705 CACAGTGCACTGAGGGCAGATGG + Intergenic
1049905439 9:212454-212476 CTCTCTGGACAGAGGGCTGATGG + Intergenic
1050296119 9:4207184-4207206 CTCTGTGTCGGGAGGGGAGGTGG - Intronic
1052235646 9:26210930-26210952 CTCTCTGTAAGGAGGGAAGGGGG - Intergenic
1058779047 9:108315206-108315228 CTCTGTGTACAGAGAGCACCTGG + Intergenic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1061152044 9:128834315-128834337 CCCTGGGTATAGAGGGCAGAGGG + Intronic
1061892848 9:133631854-133631876 CCCTGTGTATGGAGGAGAGATGG + Intergenic
1062169267 9:135125686-135125708 CTCTGTGTCCAGAAGGCAAAAGG + Intergenic
1062321416 9:135992339-135992361 CTCTGGGTAGGGTGGCCAGAGGG - Intergenic
1186600709 X:11034136-11034158 CTCTTTGTTCTTAGGGCAGATGG - Intergenic
1186654917 X:11601992-11602014 CTGTGTGTATGGAGGTGAGAGGG + Intronic
1194387411 X:93273356-93273378 CTCTTTGTTCTTAGGGCAGATGG + Intergenic
1196910568 X:120480708-120480730 TTCATTGTACAGAGGGCAGAAGG - Intergenic
1198734990 X:139775696-139775718 CCCTAGGTAAGGAGGGCAGAGGG - Intronic
1198852084 X:140975435-140975457 CACTGTGTTGGGAGGGCAGGTGG + Intergenic
1198882310 X:141294879-141294901 CTCTGTGTATGGGGGTCAGCTGG - Intergenic
1200872846 Y:8121997-8122019 CTCTTTGTTCTTAGGGCAGATGG + Intergenic
1201765868 Y:17573155-17573177 CTCTTTGTTCTTAGGGCAGATGG + Intergenic
1201835684 Y:18332834-18332856 CTCTTTGTTCTTAGGGCAGATGG - Intergenic
1202113254 Y:21446428-21446450 CTCTTTGTTCTTAGGGCAGATGG + Intergenic