ID: 906889367

View in Genome Browser
Species Human (GRCh38)
Location 1:49691381-49691403
Sequence TGTCCTTGAAACAGAGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 210}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906889362_906889367 1 Left 906889362 1:49691357-49691379 CCATGATGATGTTGCTGACCTGG 0: 1
1: 1
2: 2
3: 12
4: 176
Right 906889367 1:49691381-49691403 TGTCCTTGAAACAGAGGGACAGG 0: 1
1: 0
2: 1
3: 17
4: 210
906889360_906889367 24 Left 906889360 1:49691334-49691356 CCTCAAGGGCTAGCACTTGTCCA 0: 1
1: 0
2: 1
3: 13
4: 87
Right 906889367 1:49691381-49691403 TGTCCTTGAAACAGAGGGACAGG 0: 1
1: 0
2: 1
3: 17
4: 210
906889361_906889367 4 Left 906889361 1:49691354-49691376 CCACCATGATGATGTTGCTGACC 0: 1
1: 0
2: 1
3: 11
4: 165
Right 906889367 1:49691381-49691403 TGTCCTTGAAACAGAGGGACAGG 0: 1
1: 0
2: 1
3: 17
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906889367 Original CRISPR TGTCCTTGAAACAGAGGGAC AGG Intronic
902204272 1:14855898-14855920 TCCCCTTTAAACAGAGGGAGCGG + Intronic
903337933 1:22637252-22637274 TGTCCGTGCAAGTGAGGGACAGG + Intronic
905447435 1:38036187-38036209 TGTTCTGAGAACAGAGGGACTGG + Intergenic
906077115 1:43059991-43060013 TGTGCATGCAACAGAGGGGCGGG + Intergenic
906889367 1:49691381-49691403 TGTCCTTGAAACAGAGGGACAGG + Intronic
907314130 1:53557623-53557645 AGGCCTTGAAACAGACGCACAGG + Intronic
908284633 1:62582063-62582085 TCCCCTTGAAACAGAAGGAAAGG + Intronic
908792428 1:67796302-67796324 TGTCCTTGAAAAGGAAAGACTGG - Intronic
910271465 1:85399772-85399794 TTTCCTTGAAAGGCAGGGACAGG - Intronic
910404840 1:86876645-86876667 TGTAATTGAAACTGAGGGAGTGG + Intronic
910999730 1:93150352-93150374 TGTCCTTCAAAAAGAGTGAATGG - Exonic
913251758 1:116917631-116917653 TGTCCTAAAAAGAGAGAGACAGG - Intronic
915622780 1:157096053-157096075 TGGCCCTGGAACAGAGAGACTGG - Intronic
915661426 1:157408855-157408877 TGTCCTTGAGGGAGAGGTACAGG - Intergenic
918739751 1:188114085-188114107 TGCCCTTTAAAAAGATGGACTGG - Intergenic
919133033 1:193474618-193474640 TGTCCTAGAAGCAGAGAGAGGGG - Intergenic
919171244 1:193957053-193957075 TGACCCTGAAACAGAGGAGCCGG + Intergenic
920133781 1:203753393-203753415 TGTGCTTGAAAGAGAGAGGCTGG + Intergenic
920851612 1:209631900-209631922 TGTCCTAGTGACAGGGGGACAGG - Intronic
921537060 1:216364568-216364590 TGTCCTTATAACAGAGGTAAAGG + Intronic
922346949 1:224704240-224704262 TCTCCTAGAAGCAGAGGCACGGG + Intronic
923220104 1:231885040-231885062 TTTTCATGAAACAGAGGGAAAGG + Intronic
923336488 1:232975539-232975561 TTTCCTTGAAACTGTGGGAAGGG + Intronic
923785385 1:237062773-237062795 TTTCCCTGAAACTGAGGGAAAGG - Intronic
924302061 1:242649867-242649889 TGTCCGTGTAACAGAGAGCCAGG + Intergenic
1063444775 10:6104799-6104821 TGTCTTTAAAACAGAGGAAGGGG + Intronic
1064617534 10:17177014-17177036 TTTCATTGAAACAGAGGAAGAGG + Intronic
1065619750 10:27568989-27569011 GGTCCTTGCAAGAGAGGGGCAGG - Intergenic
1068351556 10:55853195-55853217 TGTCATTGAAAGTGAGGGTCAGG + Intergenic
1070730699 10:78826209-78826231 TGACCTTGATAAACAGGGACTGG - Intergenic
1072752022 10:97987905-97987927 TGTCCCTGAAACACAGGGATGGG + Intronic
1073394069 10:103203779-103203801 TGTCCTTGCAAGAGAGAGAATGG + Intergenic
1074126730 10:110534602-110534624 TGTCCTTTAAACATAAGGAAGGG - Intergenic
1074603530 10:114938313-114938335 TGTCCTTGAAACTGCAGGAACGG + Exonic
1077382755 11:2252526-2252548 TGTACTTGACACAGCAGGACAGG + Intergenic
1079239213 11:18710628-18710650 GGTCCTTGGAACAGAGGCCCAGG - Intronic
1079517831 11:21289550-21289572 TGTGCTTGAAACCCAGGGCCTGG - Intronic
1087012877 11:93529999-93530021 TGGCCTTGAAAATGTGGGACAGG - Intronic
1089572663 11:119420581-119420603 TGTCCTTGAAACACATTGATAGG - Intronic
1090610879 11:128469327-128469349 TGGCCCTAAAACAGAGGAACAGG + Intronic
1090642776 11:128743614-128743636 TGTCCTTGAGACAGACAGACAGG + Intronic
1091279623 11:134374583-134374605 AGCCCTTGAAACAGAGGGGAAGG - Exonic
1096949311 12:55448773-55448795 TGTACTGGAAAAAGAGGGAGGGG + Intergenic
1097019558 12:56010268-56010290 TGTTCTGGAAACAGAGAGATAGG + Intronic
1098145275 12:67490773-67490795 TGTCCTTGAAACAGCCAGTCTGG + Intergenic
1098867888 12:75783421-75783443 TCTCCTTTTAACAGAGGGGCAGG - Intergenic
1099030785 12:77523820-77523842 TGTGCTTGAAACCCAGGGCCCGG - Intergenic
1099299391 12:80873227-80873249 TGACCTTAAAACAGAGGAACAGG + Intronic
1100111008 12:91242595-91242617 TGTACTTGAAACCCAGGGCCCGG - Intergenic
1100358502 12:93854637-93854659 TGTCCTTGAATCACAGTAACAGG + Intronic
1104202985 12:126609840-126609862 TGTCCTTGAAGCCTAGGGAGTGG + Intergenic
1104214360 12:126721689-126721711 TGACCTTGAAACTGAGAGAATGG + Intergenic
1105346042 13:19573637-19573659 AGTCCTTGAAAAAGGGGGAGGGG + Intergenic
1106391121 13:29336757-29336779 TCTCCTTGAAACAGAGCATCTGG - Intronic
1107478583 13:40765056-40765078 AGTCCTTGAAAAAGAGGGAGGGG + Intronic
1108236793 13:48416471-48416493 TGTGCTTGAAACCCAGGGCCTGG - Exonic
1111525665 13:89465473-89465495 TGCCCTTGAAACAGATGAGCTGG + Intergenic
1112597412 13:100821097-100821119 TGCCCTTGACCCAGAGGGCCAGG + Intergenic
1113480493 13:110616326-110616348 CGTCCTTGGACGAGAGGGACTGG + Intronic
1113603874 13:111590861-111590883 TGTCTTTGGAGCAGAGAGACAGG - Intronic
1114811607 14:25906914-25906936 TTTCATTGAAAAAGAGGGGCTGG + Intergenic
1115125593 14:29989226-29989248 TGTCCTTGAATCAGAGGGATGGG - Intronic
1115929663 14:38477252-38477274 TGACTTTGAAACAGAGTAACAGG + Intergenic
1116791623 14:49345788-49345810 TGTCCTTAGACAAGAGGGACAGG + Intergenic
1118117934 14:62802557-62802579 TGTCCTTGGGACAGATGGAGAGG + Exonic
1119252359 14:73167912-73167934 TGACCTTGATACAGAAGGGCTGG + Intronic
1119708567 14:76804115-76804137 TGTCCATGAAACAGGAGGAGGGG + Intronic
1119718489 14:76875177-76875199 TGTGGATGAAACAGAGTGACTGG + Intergenic
1120693446 14:87618706-87618728 TGCTCATGAAGCAGAGGGACAGG + Intergenic
1121357693 14:93229813-93229835 TGCCCTCAAAGCAGAGGGACTGG + Intergenic
1121450112 14:94001556-94001578 TGTCCTGGATGCAGAGGGACTGG + Intergenic
1121592999 14:95134358-95134380 TACCCTTCAAACAGAGGGTCAGG + Intronic
1122173338 14:99895964-99895986 CGTTCTTGAAACAGAGGTGCTGG + Intronic
1122598283 14:102908297-102908319 TGTCCTTGAACCTGAGTGATGGG + Exonic
1202862038 14_GL000225v1_random:89336-89358 TTTCCTAGAAACAGAGGCCCCGG - Intergenic
1123977589 15:25567869-25567891 TGTCCTTGAAATGTAGGGTCAGG + Intergenic
1124870462 15:33536511-33536533 TGTCCCTGAAGCAGTGGGATGGG - Intronic
1126528268 15:49682835-49682857 TGGAGTTGCAACAGAGGGACAGG - Intergenic
1127332728 15:57954768-57954790 TCTCCTTGGAAGAGAGGGAGGGG + Exonic
1133737534 16:8627352-8627374 TGTCCCTCAAACACAGGGAGGGG + Intronic
1134050635 16:11134937-11134959 TGTCCTTGAAACACTGGAAGTGG - Intronic
1140301241 16:73759342-73759364 TGTCCTTAAAGGAGAGGGACAGG - Intergenic
1141185007 16:81780397-81780419 TGCCCTTGAACCAGAGAGTCAGG - Intronic
1141723724 16:85772163-85772185 TGTCCTGCACACACAGGGACTGG + Intronic
1146104436 17:30019744-30019766 TATTCTAGAAACAGAGGGATGGG - Intronic
1146572424 17:33964448-33964470 GGTCCTTGACTCTGAGGGACTGG - Intronic
1146659981 17:34659160-34659182 TGCTCTGGAAACAGAGGGGCTGG - Intergenic
1149931435 17:60760134-60760156 TCTGCTTAAAAGAGAGGGACTGG - Intronic
1150231598 17:63555382-63555404 TGTACTTGAAACACTGGGATGGG + Intronic
1153301736 18:3597649-3597671 TGCCCTAGGAACAGAGGGCCTGG + Intronic
1156350191 18:36296866-36296888 TGCCCTGGTAACCGAGGGACTGG - Intergenic
1157972254 18:52284039-52284061 TGGCTCTGAAACAGAGAGACAGG - Intergenic
1158352225 18:56574412-56574434 TGTTCTTGAAACACAGAGAGAGG - Intergenic
1158827547 18:61240305-61240327 TGTCCGTGCACCAGAGGGTCAGG + Intergenic
1158994567 18:62904733-62904755 TGTCCAAGAAACACAGTGACAGG + Intronic
1161255905 19:3309406-3309428 TGTCCTTGGTACGGGGGGACAGG + Intergenic
1161512187 19:4677949-4677971 GGTCTTTGAAACAGAAGGAGAGG + Intronic
1162189854 19:8936347-8936369 TGTCGTTGAAACAGCTGAACTGG + Exonic
1164437577 19:28244848-28244870 AGTTCTAGAAACAGAGGGAAGGG + Intergenic
1165824839 19:38699805-38699827 TCTCCAGGAGACAGAGGGACGGG + Intronic
1168329770 19:55560859-55560881 AGTCCCTGAAACAGAGGACCTGG - Intergenic
925714932 2:6775337-6775359 TGTCCTGGAAACACCAGGACAGG + Intergenic
926047664 2:9721756-9721778 TGTCCTTGTAAGATGGGGACAGG - Intergenic
926157840 2:10467488-10467510 TCTCCTGGAAGCAGCGGGACGGG + Intergenic
926243525 2:11105448-11105470 TTTCCATGACACAGAGTGACGGG + Intergenic
926590128 2:14732000-14732022 TGTCCCTGCAAGAGAGGGAAGGG - Intergenic
929941879 2:46340325-46340347 TGTCCCTGGAGCAGAGGGCCTGG - Intronic
936985289 2:118306258-118306280 TCTCTTTTACACAGAGGGACCGG - Intergenic
937109727 2:119355296-119355318 TGTCTTAGAAGCAGAGGGGCTGG + Intronic
937302106 2:120848868-120848890 TGTCCTTGTCACACAGGGGCAGG - Intronic
938156134 2:128941833-128941855 TGCCCTTGAAACACAAGTACAGG - Intergenic
938560750 2:132470146-132470168 TGTCCCTGAATTTGAGGGACTGG + Intronic
939646025 2:144700175-144700197 TGTGCTTGGAACAGAGAGATGGG + Intergenic
942742357 2:179195116-179195138 TGTTCTTGATGCAGAAGGACAGG + Intronic
946252469 2:218421950-218421972 TGTCAAAGAAAAAGAGGGACGGG + Intronic
948680938 2:239634190-239634212 GGACCTTGAACCAGAGGGATGGG - Intergenic
1169058109 20:2640662-2640684 TGTCCCAGAACAAGAGGGACTGG + Intronic
1169704836 20:8491419-8491441 AGTCCTTGAAAGAGGGGGAGAGG - Intronic
1169823822 20:9743949-9743971 TATCCTTACAACAGAGAGACAGG + Intronic
1172749306 20:37238757-37238779 TGTCCTGGAAACAGAGAGAGAGG - Intronic
1175544590 20:59770178-59770200 TGTCCTTGCAACTGAGGGCAGGG - Intronic
1177801923 21:25836234-25836256 GATCCTTGGAACAGAGGGATTGG + Intergenic
1177941399 21:27416590-27416612 AGTCCTTGAAACAGCTGGCCTGG + Intergenic
1181450162 22:23014413-23014435 TCTCCTTGATACAGAAGGGCTGG - Intergenic
1181467316 22:23117193-23117215 TGCCCCACAAACAGAGGGACCGG + Intronic
1181577025 22:23801686-23801708 TGTCCTTCTAAGAGAGAGACAGG - Intronic
1183566955 22:38622380-38622402 TGGCCCTGCAACAGAGGGACTGG + Intronic
1185421573 22:50738006-50738028 TGGCCTTGGGACAGAGGGAGTGG + Intergenic
950357562 3:12424759-12424781 AGCCCTGGAATCAGAGGGACAGG + Intronic
950497377 3:13341879-13341901 GGGCCCTGAAACAGAGGGAAGGG + Exonic
950709084 3:14802424-14802446 TGTCCTTGAATCCTGGGGACGGG - Intergenic
952223264 3:31346682-31346704 TCTCCCTGAGACAGAGGCACTGG + Intergenic
954535757 3:51358206-51358228 TGTCCTCCCTACAGAGGGACAGG + Intronic
955028202 3:55190583-55190605 TGTCAGTGAGACAGAGAGACAGG - Intergenic
957249624 3:77756783-77756805 TGTGCTTGAAACCCAGGGCCTGG - Intergenic
961358655 3:126354349-126354371 GGTCCTGGAGACAGAGGGGCTGG - Intronic
962070429 3:132028216-132028238 TTTCCTTGAAATACAGGGAGAGG + Intronic
962317127 3:134365901-134365923 TTCCCTTGAAACAGAGAGATTGG - Exonic
963481477 3:145879797-145879819 TGTGCTTGAAACCCAGGGCCTGG + Intergenic
964703602 3:159595227-159595249 TGTCCTCAAAACAGAGGAACAGG + Intronic
965182011 3:165415946-165415968 TGTCCCTGAAAGAGAGGAAGAGG + Intergenic
966953114 3:184842729-184842751 TCTCTTTGAAACAGAGGCCCAGG + Intronic
967908938 3:194525226-194525248 TCTGCTGGACACAGAGGGACAGG + Intergenic
969952655 4:10854022-10854044 TGTCCCTGAGACAGAGTGCCTGG - Intergenic
971639434 4:29111842-29111864 TGTACATGAGAAAGAGGGACAGG + Intergenic
972568407 4:40289111-40289133 TGTCCTGGAAACAGAAAAACTGG + Intergenic
972814495 4:42629125-42629147 TTTCCTTGAACTAAAGGGACTGG + Intronic
973081896 4:46003352-46003374 TGTGCTTGAAACCCAGGGCCTGG + Intergenic
975460220 4:74643797-74643819 TGTCCTTATAAAAGAGAGACCGG + Intergenic
976179434 4:82385105-82385127 GGTCCTTGTAAGAGGGGGACAGG + Intergenic
979939083 4:126737398-126737420 TGTCCTTGTAACAAAGGGGGAGG + Intergenic
980286059 4:130779767-130779789 TGCCCTTAAAACAGAGGGGATGG - Intergenic
981488274 4:145311626-145311648 TGTACTTCCAACAGAGGGAAAGG - Intergenic
984425506 4:179580347-179580369 TGTACTTGTAACAGAGGTAAGGG - Intergenic
985806792 5:2051245-2051267 TGTACTTGAAACTGAAGGCCAGG - Intergenic
986805119 5:11301947-11301969 TGTCCTTGAGGAAGAGGGAGTGG + Intronic
987143690 5:14970512-14970534 TGTCCTTGTTAGAGTGGGACGGG + Intergenic
987505243 5:18761295-18761317 TGTCCCTGAAATAAAGGAACAGG - Intergenic
988490436 5:31700954-31700976 TGTCCTACGGACAGAGGGACTGG - Intronic
988832299 5:34999698-34999720 TGTCTATGAAATAGAGGGAGAGG - Intronic
989166996 5:38441841-38441863 TGTTCTAGAAACACAGGGAAGGG - Intronic
990371175 5:55119814-55119836 TGACCTGGACACAGTGGGACAGG + Exonic
992740666 5:79770405-79770427 TGTGCTTGAAACCCAGGGCCTGG + Intronic
993243726 5:85424965-85424987 TGTCTTTGAAAGAGAGGAATGGG + Intergenic
993641571 5:90412212-90412234 TGTCCTTTTAAGAGAGTGACAGG + Intergenic
993712134 5:91236046-91236068 TTTCCTTGTAAGACAGGGACAGG + Intergenic
997113627 5:131102202-131102224 TGAGCTTGAAACAGAGGGGTGGG - Intergenic
997191350 5:131939140-131939162 AGACATTGAAGCAGAGGGACTGG - Intronic
997209336 5:132068279-132068301 TGTCCATCAAAGAGAGGGAATGG - Intergenic
997252240 5:132398165-132398187 TGTGCTTGAAACCCAGGGTCTGG - Intergenic
998138210 5:139685438-139685460 TGGCCTCCAAACAGAGGGGCTGG - Intergenic
999144695 5:149384606-149384628 TGTCCTTGAAAGAGAGGTGGGGG + Intronic
1000100030 5:158007463-158007485 TGACCCTGATACAGAGGGGCTGG + Intergenic
1000105839 5:158058061-158058083 TGTCCTTTGAAGAGAGTGACTGG - Intergenic
1000834311 5:166135403-166135425 TGTCCCTGAAATGGAGGAACTGG + Intergenic
1001376998 5:171269486-171269508 TGGACTTGAAAAAGAGGGAGTGG + Intronic
1003917618 6:10802051-10802073 TATTCCTGAAACAGAGTGACTGG - Exonic
1004172027 6:13302623-13302645 TGCCCTTGACAGAGAGGGAAAGG - Intronic
1006683054 6:35811051-35811073 TGTCCTCGCATCAGAGGGAAGGG + Intronic
1009247653 6:61259289-61259311 TGTCTCTGAAAGAGAGGGAGAGG - Intergenic
1009570138 6:65374437-65374459 TGTGCTTGAAACCCAGGGCCCGG - Intronic
1010063807 6:71656437-71656459 TGACCTGGAATCAGAGTGACAGG + Intergenic
1013397793 6:109760193-109760215 TTTCCTTAAATCAGAGGAACAGG - Intronic
1015767227 6:136731489-136731511 TGTCCTTGTAAAAGAGGCAGAGG - Intronic
1018165861 6:161095459-161095481 TGTGCTTACAACAGAGGGAAAGG - Intronic
1018180662 6:161220679-161220701 TGTCCTTCAAACATAGAGAAAGG - Intronic
1018399138 6:163404909-163404931 TGCCCTAGAAACAGTGGGCCTGG - Intergenic
1019746278 7:2701973-2701995 TGTTGTTGAAACACAGGGGCCGG + Intronic
1019969530 7:4529063-4529085 GGTCCCTGACACAGAGGAACTGG + Intergenic
1022691615 7:32661944-32661966 TGTCCATGAAAGAGAGTGAAAGG + Intergenic
1023051800 7:36258946-36258968 TGTGCTTGAAACCCAGGGCCCGG + Intronic
1024530143 7:50384514-50384536 TTGCCTTGTTACAGAGGGACAGG + Intronic
1027853901 7:83484461-83484483 GGTCATTGAAACAGATGGACAGG - Intronic
1029555987 7:101269550-101269572 TGTCTTTAAAAAAGAGGGCCAGG - Intergenic
1031521818 7:122776511-122776533 TGACTTTGAAACTGAGGAACAGG + Intronic
1032659798 7:133970447-133970469 TGTGCTTGAAACCCAGGGCCTGG + Intronic
1034163180 7:149007174-149007196 AGACCTTGAGAAAGAGGGACAGG + Intronic
1039145149 8:34438626-34438648 TGTGCTTGAAACCCAGGGCCTGG - Intergenic
1040432704 8:47359939-47359961 TCTCATTGAAATAGAGGGACTGG + Intronic
1045642120 8:104262305-104262327 CTTCCATGAAAAAGAGGGACAGG - Intergenic
1049953951 9:674174-674196 TCTCTTGGAAACAGAGGCACTGG - Intronic
1050850200 9:10275634-10275656 TGACCTTGAAAGAGAGGGAATGG - Intronic
1052956072 9:34254171-34254193 TGTGCATGGAACTGAGGGACAGG + Exonic
1053535352 9:38920175-38920197 AGTCCTGGAAACAGAGGTCCTGG + Intergenic
1054207573 9:62144579-62144601 AGTCCTGGAAACAGAGGTCCTGG + Intergenic
1054630779 9:67443775-67443797 AGTCCTGGAAACAGAGGTCCTGG - Intergenic
1055339019 9:75262053-75262075 TGTACTTGAAACCCAGGGCCTGG + Intergenic
1056195892 9:84228247-84228269 TGTTATTGAAACAGAGTGACAGG + Intergenic
1057082315 9:92181994-92182016 TGTCCTTAAAAGAGGGGGAGAGG - Intergenic
1057132009 9:92660736-92660758 TTTCCTGGCAACAGAGGGGCAGG - Intronic
1057785130 9:98081590-98081612 TGACCTTCAGACAGAGGAACTGG + Intronic
1058155149 9:101506596-101506618 TGTCCTAGATACAGAGGAAGAGG + Intronic
1058671058 9:107360687-107360709 GGTCCTTGTAAGAGAGAGACAGG - Intergenic
1059314891 9:113415729-113415751 GGTACATGAAACAAAGGGACAGG + Intronic
1059429855 9:114243489-114243511 TGACCCTGCAACAGAGAGACAGG - Exonic
1060225479 9:121787427-121787449 GGTCCCTGAAACCCAGGGACGGG - Intergenic
1061266298 9:129507137-129507159 TGTCCTTGGAAAAGTGGGAGAGG - Intergenic
1061381461 9:130261074-130261096 TGTTCTTGAAACATGGGGATGGG + Intergenic
1061595794 9:131628390-131628412 TGTCCTGGAGAGAGAGGGATGGG + Intronic
1185466143 X:355461-355483 TGTCGTAGCAACGGAGGGACCGG + Intronic
1189117992 X:38363227-38363249 ATTCCTTGAAACAGAGGGAGTGG + Intronic
1189287979 X:39865746-39865768 TGTCCCTGAAGCAGGGGGACAGG - Intergenic
1190330450 X:49231995-49232017 CTTCCTTCAAACAGAGGGACAGG - Intronic
1191595075 X:62934889-62934911 TATCCATGAAACAGAGGGGCAGG + Intergenic
1193361737 X:80586980-80587002 TGTGCTTGAAACCCAGGGCCTGG + Intergenic
1194729270 X:97435034-97435056 TGTCCTAGAAACAAAGGAAGAGG + Intronic
1195302117 X:103540447-103540469 TGTCCTTGTAACAGAGAGGATGG - Intergenic
1199455391 X:148021958-148021980 TTTCCATGAAACAAGGGGACTGG - Intronic
1200471912 Y:3595413-3595435 TGTGCTTGAAACCCAGGGCCCGG + Intergenic