ID: 906891758

View in Genome Browser
Species Human (GRCh38)
Location 1:49724018-49724040
Sequence GGGTAGAATAGGAATGATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 175}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906891753_906891758 6 Left 906891753 1:49723989-49724011 CCAATAGTTTATGTCAGTCAGTA 0: 1
1: 0
2: 0
3: 15
4: 143
Right 906891758 1:49724018-49724040 GGGTAGAATAGGAATGATTAGGG 0: 1
1: 0
2: 0
3: 9
4: 175
906891752_906891758 16 Left 906891752 1:49723979-49724001 CCAGAGAAGTCCAATAGTTTATG 0: 1
1: 0
2: 0
3: 8
4: 119
Right 906891758 1:49724018-49724040 GGGTAGAATAGGAATGATTAGGG 0: 1
1: 0
2: 0
3: 9
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906891758 Original CRISPR GGGTAGAATAGGAATGATTA GGG Intronic
900037272 1:425652-425674 GTATTGAATAGGAATGATGAAGG + Intergenic
900058901 1:661393-661415 GTATTGAATAGGAATGATGAAGG + Intergenic
905101201 1:35523595-35523617 TGGTAGATGAGTAATGATTACGG + Intronic
906891758 1:49724018-49724040 GGGTAGAATAGGAATGATTAGGG + Intronic
907616204 1:55929603-55929625 GGGTATAATAGGAATGCTGGAGG + Intergenic
908751156 1:67424581-67424603 AGCTAGAATAGGAACTATTAAGG + Intronic
909127347 1:71690096-71690118 GGAGAGAAGTGGAATGATTAGGG - Intronic
909724564 1:78818825-78818847 GGGAAGAATGGAAATCATTATGG - Intergenic
912739200 1:112177913-112177935 GGGTAGAATGAGAATAATCAAGG - Intergenic
914395824 1:147267318-147267340 GGATATAATTGAAATGATTAAGG + Intronic
914947003 1:152076648-152076670 GGATAGAATTTAAATGATTAAGG + Intergenic
916118638 1:161509314-161509336 GGGTGGATGAGGGATGATTAAGG + Intronic
919279839 1:195475554-195475576 GAGTAGAGTAGGATTTATTAAGG + Intergenic
920261829 1:204693584-204693606 GGGTAAAATAGGAAGGAATGTGG - Intergenic
922968169 1:229710072-229710094 GGCTAGAAGAGGAATCATTATGG - Intergenic
923049796 1:230382867-230382889 GGGGAGAAGAGGAATGTTCAAGG + Intronic
923449141 1:234100181-234100203 GGGTGGAATAGTGATGATAATGG - Intronic
924095824 1:240549836-240549858 GGCAAGATAAGGAATGATTAAGG + Intronic
1063440114 10:6066180-6066202 GGGGTGAATACTAATGATTATGG + Intergenic
1064594767 10:16932524-16932546 GGGTAGAATAGGTAGAGTTAAGG - Intronic
1065710604 10:28513540-28513562 GAGTAGATAAGTAATGATTAGGG + Intergenic
1068384037 10:56299870-56299892 GGGTAAAATAGGTAGGGTTAAGG + Intergenic
1068496156 10:57787420-57787442 GGGTAAAATAGGAGTGTTGAGGG - Intergenic
1074524869 10:114254473-114254495 GGGTGGAAGAGGAAGGAATATGG - Intronic
1075166114 10:120069768-120069790 TGGTAAAATAGGAATAATCATGG + Intergenic
1078878734 11:15426010-15426032 GGAAAGAATAAGAATGACTATGG - Intergenic
1082894334 11:58174032-58174054 GGGTAGAATAAGAGTATTTATGG + Intronic
1085399272 11:76225797-76225819 GGGTGTTATAGGAATGATGAAGG - Intergenic
1087441300 11:98186523-98186545 GGGTAGAGAAGGAAAGACTACGG - Intergenic
1093204229 12:16227825-16227847 TGGTAGAATAGGAAAGATATTGG + Intronic
1097732601 12:63146547-63146569 GAGTAGAAAAGGATTGCTTAAGG - Exonic
1099499332 12:83392526-83392548 GGAAAGATTAGGAAAGATTAAGG + Intergenic
1100384630 12:94094331-94094353 GGGTAGGATAAGGATGATGATGG - Intergenic
1102446550 12:113007403-113007425 GGGAAGATTAGGAATGATGTGGG + Intronic
1105882710 13:24617869-24617891 GGGAAGAATAGGAAGGATCAGGG - Intergenic
1111764320 13:92508383-92508405 GGGTACAATAATAATGATTATGG + Intronic
1111927333 13:94477716-94477738 GGGTTGAATAGGTATTACTAAGG - Intronic
1112231251 13:97591101-97591123 GAGTTGAATAGGAATGTTTTGGG + Intergenic
1112888485 13:104203797-104203819 AGGTAGAATAAAAATTATTAAGG - Intergenic
1114513045 14:23278218-23278240 GGTTTGAATAGGAAAGATAAAGG - Intronic
1114993772 14:28320448-28320470 AGGTAGAATAGGAATTATGCAGG - Intergenic
1115381683 14:32746593-32746615 AGGTACAAGGGGAATGATTAGGG + Intronic
1116334292 14:43637938-43637960 GTGAAGAATTGGAAGGATTAGGG - Intergenic
1116381441 14:44273996-44274018 GGAGAGGAGAGGAATGATTAGGG + Intergenic
1118725723 14:68627721-68627743 GGGTAGACTAGGAGTGAGTTGGG - Intronic
1120120132 14:80668940-80668962 TGGTAGAACAGGAAGGATGAAGG - Intronic
1122022762 14:98852818-98852840 GGGTAGAAAAGGGCTGATTTGGG + Intergenic
1124820362 15:33039242-33039264 GGGTAGAATTCGAAAGATAAAGG + Intronic
1125031107 15:35077017-35077039 GGGAAAAAAAGGAATGATAAAGG + Intergenic
1126928954 15:53625668-53625690 GGGTAGTAGAGGAATAATTTTGG - Intronic
1127960110 15:63884585-63884607 GAGTAGGATGGGAATGATTCAGG - Intergenic
1128329767 15:66747859-66747881 GGTGAGAATGGGAAGGATTAAGG - Intronic
1128873386 15:71181791-71181813 TGATGGAAGAGGAATGATTATGG - Intronic
1129271934 15:74423562-74423584 GGGTAGAGTAGGGATGATTCAGG - Intronic
1131681790 15:94731251-94731273 GAGAAGAATAGGAGTTATTAAGG - Intergenic
1132444554 15:101901606-101901628 GTATTGAATAGGAATGATGAAGG - Intergenic
1133675522 16:8067561-8067583 GAGGAGAATAGGATTGTTTATGG - Intergenic
1133867424 16:9657318-9657340 GGGGACAATAGGGATGATGATGG + Intergenic
1133870322 16:9679927-9679949 TGGTAGAAAAGAAATGATTTGGG - Intergenic
1137702080 16:50504475-50504497 GGGAAAAAAAGGAATGATGAAGG + Intergenic
1137854277 16:51778145-51778167 GGGGAGTAGAGGAAAGATTAGGG + Intergenic
1139831196 16:69799630-69799652 GGCTAGAAAAGCAATGATTTAGG - Intronic
1141039110 16:80656271-80656293 GAGTAGGAGAGGCATGATTAGGG - Intronic
1147849080 17:43427324-43427346 CTGTAGAATGGGGATGATTAAGG - Intergenic
1149360500 17:55890025-55890047 GAGCAGAATGGGAATTATTATGG + Intergenic
1149566595 17:57644818-57644840 GGCTTGAATAGGTGTGATTAAGG - Intronic
1150361806 17:64541758-64541780 GGATAGAAAAGGAATGAATATGG - Intronic
1151620328 17:75241073-75241095 GAGCAGAACAGGAATAATTAGGG + Intronic
1154150480 18:11902675-11902697 GTGTAGAAGAGGAATTATCAAGG - Intronic
1158754044 18:60300698-60300720 AGGTAGAAGATGAATGATTGAGG + Intergenic
1159492812 18:69160731-69160753 GGCTTTAATAGGAAAGATTATGG + Intergenic
1159915697 18:74185649-74185671 TGGTAGAAAAGAAATGATTTGGG + Intergenic
1162233861 19:9289490-9289512 GGGTGGAACAGGTATGATAAGGG + Intergenic
1164975067 19:32566749-32566771 GGGTAGAATAGGATGGTATATGG - Intergenic
928746750 2:34424904-34424926 AGGTAGAATAGGAAAGAGAAAGG + Intergenic
929774864 2:44923231-44923253 GGGTAGATTAGGAGTGGGTAGGG - Intergenic
931711778 2:64993995-64994017 GGGAAGAAGAGGAATGTTTAGGG + Intronic
937632729 2:124121703-124121725 GGATAGTTTAGGAATGATTGGGG - Intronic
938713469 2:133996513-133996535 GGGCATAATTGGAATGATGATGG + Intergenic
939185244 2:138852953-138852975 TGGAAGAATAGGAATCATCAGGG + Intergenic
939944859 2:148397169-148397191 AGATAGAAAAGGACTGATTAAGG + Intronic
941774170 2:169374038-169374060 CTGTAAAATAGGAATAATTACGG - Intergenic
943062585 2:183053778-183053800 CTGTTTAATAGGAATGATTATGG - Intergenic
943490758 2:188553215-188553237 GTGTTGAATAGGAGTGATGAAGG + Intronic
943842166 2:192597505-192597527 TGGTAGAACAGTACTGATTAAGG - Intergenic
946749301 2:222877225-222877247 TGGTGGAATAGGACTGGTTATGG + Intronic
948744466 2:240077033-240077055 GACTAGGATAGTAATGATTAGGG + Intergenic
1169148639 20:3271529-3271551 TGTTAAAATAGGAATGAATATGG - Intronic
1172024174 20:31936766-31936788 AGCTGGCATAGGAATGATTATGG - Intronic
1173946234 20:46952952-46952974 GGGTGAAATAGGAATGTTTCAGG - Intronic
1175438881 20:58976660-58976682 GGGTTGAATAGGAATCATGGGGG + Intergenic
1177147722 21:17424819-17424841 GGGTAGAAAAGAAATGAAGATGG - Intergenic
1182073026 22:27476733-27476755 GGGTGGGAGGGGAATGATTATGG - Intergenic
1185387015 22:50538171-50538193 GGGTAGAAATGGATTTATTATGG + Intergenic
949950859 3:9227704-9227726 GGCTACGATAGGAATGACTAAGG + Intronic
952873883 3:37925517-37925539 GGGTAGAATAGGAACAAGCAGGG + Intronic
953161375 3:40423227-40423249 GGGTATAATAGAAAGGTTTATGG - Intronic
955812351 3:62804398-62804420 GGGTAGAATAGGGCTGAGTTGGG + Intronic
957573102 3:81973860-81973882 AGGTTGAACAGGAATGATTTGGG - Intergenic
966042774 3:175511742-175511764 AGGTAGAATTGGCATGTTTATGG - Intronic
970663668 4:18313212-18313234 GGGGAGATTAGCAATGAATAAGG - Intergenic
973017280 4:45156799-45156821 GGGTGTAATGGGAATGGTTATGG + Intergenic
974137751 4:57840080-57840102 GGGTAGAAAAAGAATGGTGAAGG - Intergenic
975627272 4:76362593-76362615 AGATAGAATAGGAATAATGAAGG - Intronic
975800698 4:78057176-78057198 GGGTAGAGGTGCAATGATTACGG - Intergenic
977839191 4:101681033-101681055 GGGAAGACTAGGCATGCTTAGGG + Intronic
978633485 4:110776019-110776041 GGGAAGAATAGGAATTATTTTGG + Intergenic
978974511 4:114853174-114853196 AGAAAAAATAGGAATGATTAGGG - Intronic
979012685 4:115391362-115391384 ATGTTGAATAGGAATGATGAGGG - Intergenic
979277245 4:118827994-118828016 GGGTAGAATTGTAATGACCATGG + Intronic
981210916 4:142104042-142104064 TGCTAGCATAGGAATCATTATGG + Intronic
981454758 4:144940567-144940589 CGGTAGAATAGGAATGAGGATGG - Intergenic
981477602 4:145203319-145203341 GGGTAGGAGTGGTATGATTACGG - Intergenic
984112957 4:175643089-175643111 GGGAAGAATCGGTCTGATTATGG - Intronic
986630609 5:9768471-9768493 GGATAGAATAGGAGTGGTCATGG - Intergenic
987079624 5:14414913-14414935 GGGCATAATAGCATTGATTAGGG + Intronic
987637479 5:20564209-20564231 GGGAAGATTAAGAACGATTATGG - Intronic
987701951 5:21411542-21411564 GGGTAGAATATGTTTGATTGTGG + Intergenic
988588591 5:32529489-32529511 CTGTAGAATAGGAATCATTTGGG + Intergenic
990532864 5:56691026-56691048 GGGAAGAATAGGGATGAAAAAGG + Intergenic
992663893 5:78986845-78986867 AAGGAGAATAGGAAGGATTACGG - Intergenic
992834028 5:80622504-80622526 GGCTAGAAAAGCAATGACTAAGG - Intergenic
992931105 5:81646444-81646466 GGGTAGACTAGGGAGGATTTAGG + Intronic
994184598 5:96804245-96804267 AGGCAGAAAAGGAATCATTAGGG + Intronic
994678635 5:102857700-102857722 CAGTAAAATAGGAATGATAATGG + Intronic
996460603 5:123736576-123736598 CTGTAAAATGGGAATGATTATGG - Intergenic
997796523 5:136816458-136816480 GGGTAGAAAGGGCAGGATTAAGG + Intergenic
998151445 5:139759720-139759742 CGGAAGAATTGGAGTGATTAGGG - Intergenic
1000017552 5:157291227-157291249 GGGTTGAACACGAATGATTCAGG + Intronic
1000216465 5:159161978-159162000 TTGTAGAACAGGAATGACTATGG - Intronic
1000257508 5:159554242-159554264 GGATAGAAAAGGAATGAAAAAGG - Intergenic
1002347445 5:178557755-178557777 GGGAAGAATAGGAATGAGTTAGG + Intronic
1002736549 5:181393214-181393236 GTATTGAATAGGAATGATGAAGG - Intergenic
1004408227 6:15355115-15355137 GGGCAGAATGGGAATGTGTAAGG - Intronic
1006276494 6:33008621-33008643 GGGATGAGGAGGAATGATTAAGG + Intronic
1007066546 6:38996635-38996657 GCCTAGAATAGGGATGATCATGG + Intronic
1008086460 6:47250339-47250361 GGGAAGAATAGCTATGATTCTGG + Intronic
1008367036 6:50693329-50693351 GAGTAGAATAGTGGTGATTAAGG - Intergenic
1008441576 6:51538050-51538072 GGGAAATATAGCAATGATTATGG - Intergenic
1011560871 6:88613772-88613794 GGGTACAATATGAATGCTTTGGG - Intronic
1014371139 6:120609014-120609036 GGGTAGAACTGGAATGAGGAAGG - Intergenic
1015990883 6:138941672-138941694 TGGTAGTATATGAATGCTTATGG + Intronic
1016129240 6:140445172-140445194 GTGTAGCATAGGAAAGATTTTGG - Intergenic
1018078704 6:160239949-160239971 GGGAAGAAAAGGAATGAGCAGGG + Intronic
1019241647 6:170668743-170668765 GTATTGAATAGGAATGATGAAGG - Intergenic
1019824206 7:3270064-3270086 GGGTAGAAAAGGGAAGATGAAGG - Intergenic
1021837325 7:24692353-24692375 AAGTAGAATAGTAATGATAAAGG - Exonic
1022041312 7:26584104-26584126 AGGTAGAATAGAAATTACTAGGG + Intergenic
1022043248 7:26601238-26601260 GGGGAGAAGAGGAAAGATAAGGG + Intergenic
1022163395 7:27733891-27733913 GTGTAGAAAAGGAAAGATTCAGG + Intergenic
1023757612 7:43434324-43434346 GGATAGAATAGGAATGGAGAGGG + Intronic
1025967179 7:66284893-66284915 TGGAAGAAAAGAAATGATTAAGG - Intronic
1026881938 7:73912205-73912227 GGCTAAAATGGAAATGATTAGGG - Intergenic
1028154068 7:87409495-87409517 GGGGAGAAAGGGGATGATTAAGG - Intronic
1028180078 7:87709538-87709560 GGGAAGAAAATGAATGATAAGGG - Intronic
1028262848 7:88686067-88686089 GGCTAGAATAGAACTGATTGTGG + Intergenic
1032621899 7:133542626-133542648 GGGGAGAATAGGACTGAGGAGGG + Intronic
1032815923 7:135473882-135473904 GAGTAGAATAGTACTGTTTATGG + Intronic
1035506469 8:139353-139375 GTATTGAATAGGAATGATGAAGG + Intergenic
1037184317 8:16042981-16043003 GGATAGAAGTGGAATGATCAAGG + Intergenic
1037239889 8:16765403-16765425 GGGAAGAATAGGATTGTTTTGGG - Intergenic
1039250606 8:35660181-35660203 TGATAGAAATGGAATGATTAAGG + Intronic
1041619006 8:59943355-59943377 GAGTAGAAAATGATTGATTAAGG - Intergenic
1043149305 8:76693792-76693814 GTGCAGATTAGGAATCATTATGG + Intronic
1043211591 8:77526109-77526131 GGGTAGAAAAGGTACAATTATGG - Intergenic
1044043421 8:87399323-87399345 GTGCACAATAGGAATGATTTAGG + Intronic
1045160389 8:99535727-99535749 GGCTAGAATGAGAATGAGTAAGG - Intronic
1045913631 8:107440121-107440143 GGGTAGAATATGAAAGGTCAGGG + Intronic
1047357850 8:124140306-124140328 CTGTAAAATAGGAATAATTAGGG - Intergenic
1048311749 8:133328102-133328124 GGGTAGACTAGAAATGTCTAGGG + Intergenic
1049091911 8:140521856-140521878 GGCTAGAAAAGCAATGATGAGGG + Intergenic
1052218367 9:25992822-25992844 TGGTAGTATAGGAAGGATCAGGG - Intergenic
1055404447 9:75959829-75959851 GGGAGAAATAGGAATGAGTAAGG + Intronic
1057298783 9:93864709-93864731 GGGTAGAAAAGGAAGGAGGAGGG - Intergenic
1057343337 9:94223649-94223671 GAGTAGAAAAGCAATTATTAAGG - Intergenic
1203345280 Un_KI270442v1:29778-29800 GGGTTGAATAGGATTGAATGGGG + Intergenic
1203601839 Un_KI270748v1:17977-17999 GTATTGAATAGGAATGATGAAGG - Intergenic
1188181237 X:27058270-27058292 TGTTAGAAAAGGAATGATTTTGG + Intergenic
1188564869 X:31515113-31515135 GGGAAGAATAGGAAAAGTTATGG + Intronic
1194939464 X:99992409-99992431 GGGTAGAAGTGAAATGATTGAGG - Intergenic
1194981166 X:100441732-100441754 GATTAAAATAGGAATGATTGAGG - Intergenic
1197924611 X:131633488-131633510 GGGTATAAAAGGAGTCATTAAGG - Intergenic
1198033959 X:132782816-132782838 GGTTAGATAAGGACTGATTAGGG + Intronic
1198287191 X:135202866-135202888 GGGAAGACTATGAATGGTTATGG - Intergenic
1201744585 Y:17357797-17357819 GGGAAAACAAGGAATGATTAGGG - Intergenic