ID: 906896173

View in Genome Browser
Species Human (GRCh38)
Location 1:49774476-49774498
Sequence CTTTATATGGGGCAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 237}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906896164_906896173 15 Left 906896164 1:49774438-49774460 CCTGTTGAAATATAGTTGTTTAT 0: 2
1: 3
2: 7
3: 24
4: 320
Right 906896173 1:49774476-49774498 CTTTATATGGGGCAGGTGGAGGG 0: 1
1: 0
2: 1
3: 12
4: 237
906896162_906896173 19 Left 906896162 1:49774434-49774456 CCACCCTGTTGAAATATAGTTGT 0: 1
1: 0
2: 1
3: 9
4: 152
Right 906896173 1:49774476-49774498 CTTTATATGGGGCAGGTGGAGGG 0: 1
1: 0
2: 1
3: 12
4: 237
906896163_906896173 16 Left 906896163 1:49774437-49774459 CCCTGTTGAAATATAGTTGTTTA 0: 1
1: 0
2: 2
3: 42
4: 360
Right 906896173 1:49774476-49774498 CTTTATATGGGGCAGGTGGAGGG 0: 1
1: 0
2: 1
3: 12
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906896173 Original CRISPR CTTTATATGGGGCAGGTGGA GGG Intronic
902163605 1:14552220-14552242 ATTAATAGGGGGCAGGAGGATGG - Intergenic
905272227 1:36794592-36794614 CTTTCCATGTGGCAGGTGGTAGG - Intergenic
905847697 1:41246499-41246521 CTTTATAAGGAGCAGCTGAAAGG + Intergenic
906896173 1:49774476-49774498 CTTTATATGGGGCAGGTGGAGGG + Intronic
907365893 1:53959482-53959504 CTTTTTATGGGGCAGTAGGTAGG - Intronic
907953332 1:59205013-59205035 CTTTATATGGGAGAGGCAGAAGG - Intergenic
908146397 1:61249443-61249465 TATTAGATGGGGGAGGTGGAAGG + Intronic
909347454 1:74608385-74608407 ATTTATAGTGGGCAGGTGAAAGG + Intronic
910664179 1:89706777-89706799 CTTTCTATGGGGGAGGGGAAGGG - Intronic
910875972 1:91878550-91878572 CATCAAATGGGCCAGGTGGAGGG - Intronic
912586656 1:110772599-110772621 CTTTATAAGGGGCATTGGGAAGG - Intergenic
912672589 1:111644774-111644796 CTTTTTTTGGGGAAGGGGGAGGG + Intronic
915103626 1:153518251-153518273 CTTCAAAAGGGCCAGGTGGATGG + Intergenic
915790774 1:158668401-158668423 CTCTATATGGGTCAAATGGATGG - Intronic
919841597 1:201613305-201613327 ATTTATATGGGGTTGGTGGCGGG - Intergenic
920225431 1:204435072-204435094 TTTTATTTGGGGCAGGAAGAAGG - Intronic
922352993 1:224750114-224750136 CTTTGTATGTGGTAGGTGGTAGG + Intergenic
922664507 1:227456991-227457013 CTTTATATGGGGCTGGGTGCTGG - Intergenic
922786200 1:228283486-228283508 CTTTTTCTGGGGCAGGGAGATGG - Exonic
1067232500 10:44421920-44421942 GTTTACATGTGGCAGGTGGGTGG - Intergenic
1069280227 10:66646450-66646472 CCTTTTTTGGGGCAAGTGGAAGG + Intronic
1069827301 10:71262127-71262149 CTTTTTATGGGGCTGGTTAAAGG - Intronic
1070037219 10:72738184-72738206 ATTTATTTGGGGAAGGTGAAGGG + Intronic
1070685399 10:78476808-78476830 CTTGATCTGGGGCAGGGGCAGGG - Intergenic
1070705401 10:78634107-78634129 TTTTATATGGTACAGGTGAATGG - Intergenic
1070885383 10:79892121-79892143 CTTTAGATTGGGAAGGTGGGGGG - Intergenic
1072093446 10:92152495-92152517 GTTTAAAAGGGGAAGGTGGAAGG - Intronic
1076303718 10:129448067-129448089 TTTTTTGTGGGGCAGGGGGATGG - Intergenic
1077236112 11:1482732-1482754 ATTCCCATGGGGCAGGTGGACGG + Intronic
1079385037 11:19971381-19971403 CTTTTTAGGGGGCAAGGGGATGG + Intronic
1079475328 11:20823835-20823857 CTTTCTTCGGGGCAGGTGCAGGG - Intronic
1080701867 11:34650740-34650762 CTCCATTTGGGGTAGGTGGAGGG + Intronic
1080785311 11:35470022-35470044 TTTTATAGGTGGCAAGTGGAGGG + Intronic
1082066383 11:47904100-47904122 CTTCACATGGTGGAGGTGGAGGG - Intergenic
1085420182 11:76351134-76351156 CTTGATGTCAGGCAGGTGGAGGG + Exonic
1087172540 11:95065192-95065214 CTTGATATTCTGCAGGTGGATGG + Intergenic
1087573132 11:99956022-99956044 ATTTAAATGGTGCAGGTAGAAGG + Intronic
1088965289 11:114714638-114714660 CTTTACATGTGGCAGCTGAAAGG + Intergenic
1089023547 11:115243448-115243470 AATTATATGGGTCAGCTGGACGG + Intronic
1089733135 11:120532024-120532046 CTGGATGTGGGGCAGGTGGAAGG + Intronic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1090964117 11:131583300-131583322 CAGTATATTGGGGAGGTGGATGG - Intronic
1091223457 11:133944423-133944445 CTTTAGCTGGGGCAGGGGGCGGG - Intronic
1091398647 12:169759-169781 CTTTATTTGGGGCTGGTGGAGGG - Intronic
1091804443 12:3345969-3345991 CTTGAAATTGGGCAGCTGGAAGG + Intergenic
1092160238 12:6311777-6311799 CTTTATATGGGGAAGGGGATGGG + Intronic
1094488495 12:30943707-30943729 CTTGGAATGGGGCAGCTGGAAGG - Intronic
1095076655 12:37936977-37936999 CTTTATTTGTGGCATGTGCATGG - Intergenic
1098663001 12:73122526-73122548 CTTTTTATGGGACAGGAAGATGG + Intergenic
1098981715 12:76963218-76963240 CTCTCTCTGGGGCTGGTGGAAGG + Intergenic
1103545409 12:121697729-121697751 ATTTATTTGGGGCAGGAGGGAGG + Intergenic
1104994963 12:132648576-132648598 CTTTAAATGGGTGAGTTGGATGG + Intronic
1110179254 13:72595566-72595588 TTTTGTATGTGGCAGCTGGAAGG - Intergenic
1111509455 13:89242049-89242071 CCTGCTATGGGGCAGGTGAAAGG + Intergenic
1112135616 13:96574870-96574892 CTTGATCTGGGGCAGCTGCAGGG - Intronic
1112798967 13:103089453-103089475 CTTTTTTTGGGGGAGGGGGAGGG - Intergenic
1112834493 13:103497633-103497655 CTTTATAAGAGGGAGGTGGAAGG - Intergenic
1113661565 13:112109718-112109740 CTTTCAATGGGGCAGGTTGGGGG + Intergenic
1116956897 14:50933252-50933274 CTTTCTATGGGGCTGCAGGAAGG - Intronic
1119331558 14:73798638-73798660 CTTTATATGGGTGAGTTGGATGG + Intergenic
1119573947 14:75701538-75701560 CTTTATTTTGGCAAGGTGGAAGG - Intronic
1120194047 14:81463876-81463898 CCTTATATGGGAAAGGTGGAGGG - Intergenic
1120453797 14:84705260-84705282 GATTATATGAGGAAGGTGGAAGG + Intergenic
1121325432 14:93016920-93016942 CTGGAGATGGGGCAGGAGGAGGG + Intronic
1122352386 14:101103601-101103623 CTGTGTGTGGGGCATGTGGAAGG + Intergenic
1122537333 14:102474840-102474862 CTTTGTGTGGGGCAGGGGGAAGG - Intronic
1123539052 15:21269235-21269257 CTTTGTAAGGCCCAGGTGGATGG + Intergenic
1125792644 15:42380714-42380736 ATATATATGGGGAAGGTGGGGGG - Intronic
1127371228 15:58343714-58343736 TGTGATATGGGGTAGGTGGAAGG + Intronic
1130232875 15:82109866-82109888 CTTAGTAAGGGTCAGGTGGAGGG + Intergenic
1130546865 15:84863164-84863186 TTATGTATGGGGCAGGGGGAAGG - Intronic
1130581103 15:85137370-85137392 CTTCATGTGGTGCAGGTGAAAGG + Intronic
1131305211 15:91236765-91236787 CATTACCTGGGGCAGCTGGAAGG + Intronic
1132073462 15:98799798-98799820 CTTGAAGGGGGGCAGGTGGAGGG - Intronic
1133255365 16:4513103-4513125 CTTTGTCTGGTGCAGGTGGCAGG - Intronic
1134572825 16:15306254-15306276 CCTCATATGTGGAAGGTGGAAGG - Intergenic
1134819269 16:17233051-17233073 CTTTGTATGTGGCAGGTGAAGGG - Intronic
1134937875 16:18262124-18262146 CCTCATATGTGGAAGGTGGAAGG - Intergenic
1135058322 16:19249643-19249665 CTTTTCATGTGGAAGGTGGAAGG + Intronic
1135804401 16:25529030-25529052 CCTCATATGGTGCAGGGGGAAGG + Intergenic
1139015122 16:62680497-62680519 CTTTATATGGAGCAGGAAGAGGG + Intergenic
1139327610 16:66164320-66164342 CCTCAAATGGGGCAGGGGGAAGG + Intergenic
1140657988 16:77159789-77159811 CTTGACATAGGGCAGATGGAAGG + Intergenic
1140775744 16:78247615-78247637 TTTTATAAGGGGCAGGGGGCAGG - Intronic
1141072774 16:80973236-80973258 CTTAATATGAGGCAGAAGGAAGG - Exonic
1143206121 17:5140226-5140248 CATTATTAGGGGCAGCTGGATGG - Intronic
1144393040 17:14813849-14813871 CTTTTCAAGGGGCAGGTCGAGGG - Intergenic
1145238796 17:21227446-21227468 CTTTATACGAGGGAGGCGGAGGG - Intergenic
1145812437 17:27772542-27772564 TTTAATGTGGGGCAGGTTGAGGG + Intronic
1146092585 17:29894826-29894848 CTTAATTGGGGGAAGGTGGAAGG - Intronic
1146472550 17:33135965-33135987 CTATAAATGGGGCAGATAGACGG + Intronic
1146842491 17:36165602-36165624 CATTATTAGGGGCAGCTGGATGG + Intronic
1146854801 17:36253561-36253583 CATTATTAGGGGCAGCTGGATGG + Intronic
1146865819 17:36334815-36334837 CATTATTAGGGGCAGCTGGATGG - Intronic
1146870701 17:36377453-36377475 CATTATTAGGGGCAGCTGGATGG + Intronic
1146878059 17:36428534-36428556 CATTATTAGGGGCAGCTGGATGG + Intronic
1146882000 17:36449638-36449660 CATTATTAGGGGCAGCTGGATGG + Intergenic
1147068689 17:37935427-37935449 CATTATTAGGGGCAGCTGGATGG - Intergenic
1147073584 17:37978077-37978099 CATTATTAGGGGCAGCTGGATGG + Intergenic
1147080212 17:38014964-38014986 CATTATTAGGGGCAGCTGGATGG - Intronic
1147085106 17:38057615-38057637 CATTATTAGGGGCAGCTGGATGG + Intronic
1147096160 17:38138924-38138946 CATTATTAGGGGCAGCTGGATGG - Intergenic
1147101052 17:38181581-38181603 CATTATTAGGGGCAGCTGGATGG + Intergenic
1147537467 17:41329996-41330018 CATTATTAGGGGCAGCTGGACGG - Intergenic
1149845643 17:60008044-60008066 CATTATTAGGGGCAGCTGGATGG + Intergenic
1150083992 17:62264627-62264649 CATTATTAGGGGCAGCTGGATGG + Intergenic
1150473110 17:65454178-65454200 CCTCATGTGGGGAAGGTGGAGGG - Intergenic
1154201057 18:12301207-12301229 CTTTAAATGGGTCAGTTGTATGG - Intergenic
1155410840 18:25542787-25542809 CCCTATATGGGGCAGGGGTAGGG + Intergenic
1157556602 18:48616829-48616851 CTCTAGATTTGGCAGGTGGAGGG + Intronic
1159960548 18:74552302-74552324 CTTTAAATGGGCCAGTTGTAAGG - Intronic
1160837814 19:1132796-1132818 CTTGATCTGGGGCTGGCGGAGGG + Intronic
1161848757 19:6727780-6727802 CTTTATAAGAGGGAGGTGGGAGG - Intronic
1163751064 19:19078136-19078158 CTGTATATGGGGAGGCTGGAGGG + Intronic
1166332619 19:42087811-42087833 CTTTATGTGGGGGATGGGGAGGG - Intronic
1167825012 19:51964522-51964544 CTTCATAAGGGGCAGTTGGTGGG - Exonic
926839248 2:17060256-17060278 CTTTCTATTGAGAAGGTGGATGG + Intergenic
933240029 2:79909993-79910015 TTTAATATGGAACAGGTGGATGG + Intronic
934249666 2:90339437-90339459 CTTTATATGATGCAGATTGAAGG + Intergenic
934259909 2:91464009-91464031 CTTTATATGATGCAGATTGAAGG - Intergenic
935360698 2:102244192-102244214 CTTGATTGGGGGCAGGTGGGTGG + Intergenic
935669157 2:105540563-105540585 ATCTATATTGGGCAGGAGGATGG - Intergenic
935800693 2:106692305-106692327 CTGCAGAAGGGGCAGGTGGAGGG + Intergenic
937703156 2:124887188-124887210 CTTTAGGAGGGGCAGGTTGAAGG - Intronic
937815631 2:126247703-126247725 CTTTTTCTGGGGCAGCTGGTGGG + Intergenic
938044619 2:128106791-128106813 CTTTGGAAGGGGCAGGTGGGTGG - Intronic
941396301 2:164977913-164977935 CTTTGTAAGGCCCAGGTGGATGG + Intergenic
945588115 2:211692676-211692698 CTTTATAAGAGGAAGGTAGAGGG - Intronic
946027328 2:216679690-216679712 CTTCATAAGCGGCAGGAGGAGGG + Intronic
946188386 2:217994522-217994544 CTGGATATGGGGCATGGGGAGGG - Intronic
946426857 2:219603466-219603488 CTTTATCTCTGACAGGTGGATGG - Intronic
946919691 2:224566065-224566087 CTGTAGATGGGGAAGGTGGGGGG - Intronic
948103012 2:235390362-235390384 CTTTATAAGAGGCAGGAGGTCGG - Intergenic
1172037423 20:32019522-32019544 CATTAGGTGGGGCAGGTGCAGGG - Intronic
1174376769 20:50131239-50131261 CCTTATATGGGGCAGAGAGAAGG - Intronic
1175947716 20:62566467-62566489 CTTTACAGGGGGCAGCCGGATGG + Intronic
1176182638 20:63758123-63758145 CTCTGGATGGGGCGGGTGGAGGG - Intronic
1178628973 21:34243050-34243072 CATCCTCTGGGGCAGGTGGAAGG + Intergenic
1178717732 21:34981922-34981944 CTTTATATGGGGCTGATGCTTGG + Intronic
1181044279 22:20207215-20207237 GGTGTTATGGGGCAGGTGGAGGG + Intergenic
1182013588 22:27020830-27020852 CTCCATTTGGGGCAGGTGGGTGG - Intergenic
1182098362 22:27640936-27640958 GTTAATAGGGGGCAGGGGGAGGG - Intergenic
1183063264 22:35348080-35348102 CTGTAGATGGTGCAGGCGGAAGG + Intergenic
1184839442 22:47043928-47043950 TTTTATCTGGGGCAGGTGCTGGG + Intronic
950677941 3:14565780-14565802 TTTTCTATGGGCCAGGTGGGAGG - Intergenic
952284434 3:31954578-31954600 CTATATTGGGGGCAGGGGGAAGG + Intronic
955960834 3:64339913-64339935 CTTTATATGGGTGAGCTGTATGG + Intronic
956689248 3:71860898-71860920 GTTTATATGGGGAATGTGGCAGG - Intergenic
957094727 3:75768174-75768196 CTTTAGATGGGGTTGGTGGAAGG - Intronic
957679248 3:83410401-83410423 TCTTATATGGGTCAGGTTGATGG + Intergenic
957851391 3:85812125-85812147 CTATATATGGGTGTGGTGGAAGG + Intronic
957865269 3:86014830-86014852 CTTGATGTCAGGCAGGTGGAGGG - Intronic
959182647 3:103001655-103001677 CTGTATATAAGGCAGGCGGAGGG + Intergenic
959716689 3:109441451-109441473 TTTTATATGGGGGAGGTGTGAGG - Intergenic
961092648 3:124128102-124128124 TTTTATTTGTGGCAGGTGTATGG + Intronic
962373627 3:134841398-134841420 CTGTATGTGGGACAGGTGGGAGG + Intronic
963500733 3:146122206-146122228 CTTCCTATGTGGCAGGTTGAGGG + Intronic
963868290 3:150386067-150386089 CCTTATATGGGGCTGGGGGGAGG + Intergenic
965811885 3:172599898-172599920 CCTTATAAGGAGCAGGTGGAGGG - Intergenic
966286346 3:178300468-178300490 CTTCATATTGGGGAGGTGGAAGG - Intergenic
967950134 3:194834306-194834328 CTTTACAAGGGACAGGTGGGAGG + Intergenic
968516578 4:1018069-1018091 CTTCAGATGGGGCAGGTGTTCGG + Intronic
969430586 4:7151543-7151565 GGTTATGAGGGGCAGGTGGAGGG + Intergenic
969497375 4:7533820-7533842 CTGTAAAGCGGGCAGGTGGAAGG + Intronic
969546205 4:7830138-7830160 CTTTCTATGGGGCGGGGCGAGGG + Intronic
970929872 4:21496987-21497009 CTCTCTAAGGGGCATGTGGAGGG + Intronic
974873933 4:67679164-67679186 CTTTATATGAGAAAGGTGGGAGG + Intronic
977292961 4:95182937-95182959 CTCTGTGTGCGGCAGGTGGAAGG - Exonic
978311528 4:107389121-107389143 CTTTCTATGGGGCAGGAGTTGGG - Intergenic
978806212 4:112803371-112803393 CTTTATAGGAGGCAGGCAGAAGG + Intergenic
979414955 4:120425644-120425666 GGTTATATGTTGCAGGTGGATGG + Intergenic
980482544 4:133405555-133405577 CTCTATTTGGGGCTGGGGGAGGG - Intergenic
981252133 4:142616012-142616034 CTTTATATGGGAGAGATGTATGG + Intronic
982436372 4:155385848-155385870 CATTATTAGGGGCAGCTGGATGG - Intergenic
983066714 4:163218736-163218758 CTTTTTTTGGGGCGGGGGGAGGG + Intergenic
983302118 4:165939284-165939306 CTTGATATGGGGCAGGAAAAGGG + Intronic
983953465 4:173670052-173670074 TTTTAAATGGGTCAGGTGGTAGG - Intergenic
986667189 5:10114148-10114170 CTGTACATGGGGCAGGCAGAAGG + Intergenic
987826730 5:23039602-23039624 CTTTATATCAGGAAAGTGGAAGG + Intergenic
988395313 5:30690623-30690645 CTTTCACTGGGGCTGGTGGAGGG - Intergenic
989134443 5:38139035-38139057 CTTTATTTGGGTCAGTTGGCTGG + Intergenic
989736221 5:44710134-44710156 TTTTGTGTGGGGAAGGTGGAAGG - Intergenic
993330547 5:86594696-86594718 CATTATATAGGGAAGGTGGGCGG - Intergenic
997257346 5:132439189-132439211 CTTTATGCTGGGGAGGTGGATGG + Intronic
997981849 5:138472591-138472613 CTGAATAGGGGGAAGGTGGAAGG - Intergenic
999432332 5:151535306-151535328 CTTGCTTTGGGGCAGGTGAAAGG - Intronic
1002198526 5:177513979-177514001 CTATACATAGGGCAGGTGGTGGG - Intronic
1002521304 5:179794490-179794512 CTTTTTAGGGGGCTGGAGGAAGG - Intronic
1002910968 6:1490800-1490822 CTGTAGATGGGGTGGGTGGAGGG - Intergenic
1003378284 6:5599212-5599234 TTTTAAATGAGGCAGATGGAAGG + Intronic
1006376316 6:33673499-33673521 CTTTATGGGGGGCAGGGGGCAGG - Intronic
1006954510 6:37855673-37855695 CTTTTTGGGGGGCAGGTGGTGGG + Intronic
1006984055 6:38166213-38166235 CTGTACGTGGGGGAGGTGGAGGG - Intergenic
1006984143 6:38166490-38166512 CTGTACGTGGGGGAGGTGGAGGG - Intergenic
1011947129 6:92919705-92919727 CTTTACAAAGGGCAAGTGGATGG + Intergenic
1012431296 6:99166117-99166139 CTTTAAATGGGCCAGGTGAGGGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1014861633 6:126474987-126475009 CATTACATGTGGCATGTGGAAGG + Intergenic
1014920840 6:127213347-127213369 CTTTTTTTTGGGCAGGGGGAGGG + Intergenic
1019064864 6:169288291-169288313 CTTTATGAGAGGCAGGTGGAAGG - Intergenic
1019465756 7:1187755-1187777 CTTTTTTTGGTGCAGGGGGATGG - Intergenic
1021453900 7:20808386-20808408 CTGTATATGGGGCAGGAGAGGGG - Intergenic
1022499273 7:30872378-30872400 CTTTTTCTGGGGCAAGAGGAGGG - Intronic
1022675614 7:32495956-32495978 CTTCATGTGGGGCGGGTGGGAGG - Intronic
1022864906 7:34407191-34407213 CTTGAGATGGGGCTGTTGGAGGG + Intergenic
1024912934 7:54466773-54466795 CTTCATATGGAAAAGGTGGAAGG + Intergenic
1026376786 7:69759775-69759797 CTTTATATGGGGGGGGGGGGGGG - Intronic
1029472123 7:100761214-100761236 CTTTATAGAGGCCAGGTGCAGGG + Intronic
1029568760 7:101357534-101357556 CATTATGCGGGGAAGGTGGAAGG + Intergenic
1030112759 7:106040681-106040703 TTATAGATGGTGCAGGTGGAGGG - Intergenic
1031429013 7:121643086-121643108 ATTTATTTGGGGTAGGTGGGTGG + Intergenic
1031550525 7:123106276-123106298 TTTTATCTGGGGCAGGCTGAAGG + Intergenic
1032694323 7:134320849-134320871 CTCTATATTGTGCAGGAGGAAGG + Intergenic
1033286752 7:140048044-140048066 CTCTCTGTGTGGCAGGTGGACGG + Intronic
1034855594 7:154543442-154543464 TCTTACATGGGACAGGTGGATGG + Intronic
1035905769 8:3508350-3508372 CCTGTTATGGGGCAGGGGGAGGG + Intronic
1036588437 8:10146655-10146677 CTTTAAATGGGTCAGTTGTATGG + Intronic
1037186032 8:16064711-16064733 GTCTGTATGGGGCAGGTGCAGGG + Intergenic
1037887445 8:22602324-22602346 GTATATGTGGGGCAGGTGGTGGG + Intronic
1039630371 8:39106159-39106181 CTCCATCTGGGGCAGGTGGAGGG - Intergenic
1040618459 8:49063334-49063356 TATGACATGGGGCAGGTGGAAGG - Intronic
1043503916 8:80884367-80884389 GTTTATATGGAGGAGGTGGTGGG - Intergenic
1043550807 8:81370381-81370403 GTTTATCTGAGGCAGTTGGAGGG - Intergenic
1046807403 8:118494876-118494898 CATTATTTGGGGTAGATGGAAGG - Intronic
1048491537 8:134898179-134898201 CTTGAAATGTGGAAGGTGGAAGG - Intergenic
1048623032 8:136155545-136155567 TTTTCTCTTGGGCAGGTGGAAGG + Intergenic
1049046667 8:140157406-140157428 CTTTCTGTGGACCAGGTGGAGGG + Intronic
1049854947 8:144855659-144855681 CTTTCTGGGGGGCAGGTGCAGGG + Intergenic
1050443619 9:5694036-5694058 AATTATATGGGGAGGGTGGAGGG - Intronic
1052472923 9:28922933-28922955 CTTTATAAAAGGGAGGTGGAAGG + Intergenic
1052572889 9:30251044-30251066 CTTTCTTTGGTGCATGTGGATGG - Intergenic
1055308812 9:74956994-74957016 ATTTAGATAGGGCAGGGGGAGGG - Intergenic
1055960814 9:81818454-81818476 GGTTGTAGGGGGCAGGTGGATGG + Intergenic
1057440414 9:95078925-95078947 CTTTCTGTTGGGGAGGTGGAGGG + Intronic
1059295164 9:113263936-113263958 CCTTATAAGGAGCAGGCGGAGGG + Exonic
1059585384 9:115600624-115600646 CTAAATATGGTGCAGATGGATGG - Intergenic
1188513854 X:30964392-30964414 TATCATATGGTGCAGGTGGAGGG - Intronic
1189022079 X:37350897-37350919 CCAAATTTGGGGCAGGTGGAGGG + Intronic
1191595658 X:62941192-62941214 CTTGTCATGGGGCAAGTGGAGGG + Intergenic
1191972387 X:66831633-66831655 GTGTATGTGGGGCGGGTGGAGGG - Intergenic
1191976284 X:66875287-66875309 CTTTATGTTAGGCATGTGGAGGG - Intergenic
1192792529 X:74397139-74397161 CTTGATGTCAGGCAGGTGGAGGG + Intergenic
1193437615 X:81496486-81496508 CTTTGTTGGGGGCAGGGGGAGGG + Intergenic
1193667319 X:84337920-84337942 TTTTTTAAGGGGCTGGTGGAGGG - Intronic
1194996376 X:100595577-100595599 CTTTATTTGGGGGCGGTGGGTGG + Intronic
1195030663 X:100924471-100924493 ATTTGTATGGGGGAGGTGGGAGG - Intronic
1196492612 X:116286219-116286241 CTTTATATGGGAGAGATGTATGG + Intergenic
1196502497 X:116401923-116401945 CGTTATTTGGGACATGTGGAAGG - Intergenic
1197479482 X:126964799-126964821 CTTTACATGGGGATGGGGGAGGG + Intergenic
1197863923 X:130998111-130998133 CTAAATATTGGTCAGGTGGAAGG + Intergenic
1199675739 X:150187803-150187825 CTTTATAAGGGGGAGGCAGAAGG - Intergenic