ID: 906896525

View in Genome Browser
Species Human (GRCh38)
Location 1:49779254-49779276
Sequence TGTGATCCTAAATGTCAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 291}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906896525 Original CRISPR TGTGATCCTAAATGTCAAAA TGG Intronic
902170447 1:14606129-14606151 AGTGATCCTGGATGTCAAAGTGG - Intronic
902934830 1:19757510-19757532 TGTTACCCTACATGGCAAAAGGG - Intronic
904507099 1:30966191-30966213 TGTGTTCCTAAAGGGCGAAATGG + Exonic
905177075 1:36143548-36143570 TGGGATCATAAAGGTCATAAAGG + Intronic
905675844 1:39824505-39824527 TGTCATTTTAAATGACAAAAGGG + Intergenic
906565516 1:46798402-46798424 TATGTTCCTAAGTGTCAAAATGG + Intronic
906896525 1:49779254-49779276 TGTGATCCTAAATGTCAAAATGG + Intronic
907620773 1:55976617-55976639 TGTGCTCATAAACATCAAAATGG + Intergenic
908268094 1:62397810-62397832 TGTTATCCCACATGGCAAAAGGG + Intergenic
909809216 1:79909801-79909823 TGTGTTTATAAATGTCATAATGG - Intergenic
910053121 1:82999530-82999552 TGTCACCCTACATGGCAAAAGGG - Intergenic
911716832 1:101142806-101142828 TGTCATCTTACATGGCAAAAGGG - Intergenic
912434542 1:109651653-109651675 TGTGAACCCAAAGGTCCAAAAGG + Intergenic
914207329 1:145544257-145544279 TGTTATCTTACATGGCAAAAGGG + Intergenic
914431035 1:147620312-147620334 TGTCAATCTAAATGTCAACATGG + Exonic
915536465 1:156539097-156539119 TGAGAGCCAAAATCTCAAAAAGG - Intronic
915912001 1:159921221-159921243 TGTTATCTTATATGACAAAAAGG + Intronic
916034801 1:160912354-160912376 TGTTATCTTAGATGGCAAAAGGG - Intergenic
916278985 1:163027770-163027792 AGTGTTCCTAAATATCAGAATGG - Intergenic
916455019 1:164962171-164962193 TGTTATATTACATGTCAAAAGGG + Intergenic
917001496 1:170366288-170366310 TGTTGTCCCAAATGTCACAAAGG + Intergenic
917038162 1:170772532-170772554 TTTGATGCAAAATGTCAATAAGG - Intergenic
917608738 1:176664560-176664582 TGTCATCTTACATGGCAAAAAGG - Intronic
918084177 1:181231205-181231227 TGTGACCTTACATGTCAAAAAGG - Intergenic
922120790 1:222665416-222665438 AGTGAACCTAAAGGTCTAAATGG - Exonic
922390032 1:225131618-225131640 TGTCACCTTAAATGGCAAAAAGG - Intronic
923699161 1:236283241-236283263 TGTTATCCTATATGGCAAAAGGG - Intergenic
923900101 1:238316758-238316780 TGTGATCTCAAATCTCAAATCGG + Intergenic
1062808882 10:447319-447341 TGTGATCCTGAATATCGACAGGG - Intronic
1062808948 10:447667-447689 TGTGATCCTGAATATCAATGGGG - Intronic
1062809002 10:447967-447989 TGTGATCCTGAATATCAACGGGG - Intronic
1062809064 10:448316-448338 TGTGATCCTGAATATCAATGGGG - Intronic
1062809131 10:448668-448690 TGTGATCCTGAATATCGACAGGG - Intronic
1064599460 10:16978380-16978402 TGTCATCCAAAATTTCAAAATGG + Intronic
1064977093 10:21128348-21128370 AGTTAACCTAAATGTAAAAAAGG + Intronic
1065403532 10:25334763-25334785 TGTGATACTAGATGTGAAAAGGG + Intronic
1065974629 10:30831329-30831351 TGTATTCCTAAACGTCAGAAGGG - Intronic
1066162722 10:32751381-32751403 TGGGATCCCAAATGCCAAGATGG + Intronic
1067930158 10:50552729-50552751 TGTTATCTTACATGGCAAAAAGG + Intronic
1068043191 10:51853302-51853324 TGTGTGCCTAAACCTCAAAATGG + Intronic
1070525942 10:77296086-77296108 TGTGACCTTACATGGCAAAAGGG + Intronic
1070633278 10:78103822-78103844 TGTTACCCTACATGGCAAAAGGG + Intergenic
1070868564 10:79726634-79726656 TGTGTACCTAAATGTAGAAAAGG - Intergenic
1070975348 10:80602090-80602112 TGTGCTTCTAAATCTCAAATGGG - Intronic
1071635478 10:87248848-87248870 TGTGTACCTAAATGTAGAAAAGG - Intergenic
1071659762 10:87489126-87489148 TGTGTACCTAAATGTAGAAAAGG + Intergenic
1071944244 10:90623678-90623700 TGTTATCTTATATATCAAAATGG - Intergenic
1073848844 10:107591138-107591160 TATGATGCTAACTCTCAAAATGG - Intergenic
1076145945 10:128121999-128122021 TGATATCCTAAAAGCCAAAACGG + Intronic
1078360164 11:10661806-10661828 TGTTACCTTAAATGGCAAAAGGG - Intronic
1078578605 11:12521606-12521628 TGTTATCTTACATGGCAAAAGGG + Intronic
1078866266 11:15300823-15300845 TGTGGTCCAAAATGTTAAAGAGG + Intergenic
1080299452 11:30768090-30768112 TGTTAACCTAGATGGCAAAAGGG - Intergenic
1082143532 11:48638005-48638027 TCTGAACCTAAATGTCAACCTGG - Intergenic
1082305766 11:50572497-50572519 TGTGCTCCCAAATGTCCAACTGG + Intergenic
1083529025 11:63399919-63399941 TATGCTCCTAAATGACAAATGGG + Intronic
1084787425 11:71451231-71451253 AGTGATTCAAAATGTGAAAACGG + Intronic
1086594459 11:88554375-88554397 TGTTATCTTACATGGCAAAAGGG - Intronic
1087321631 11:96667597-96667619 TGTGATCCTAAATTGCAATTTGG - Intergenic
1087353385 11:97061579-97061601 TGTTGTCCTAACTGTCACAAAGG - Intergenic
1090080308 11:123608070-123608092 TGTAATCCTAAGTTTAAAAAGGG + Intronic
1091180624 11:133601145-133601167 TGTGAACCTAAATGAGTAAAAGG - Intergenic
1092495578 12:8990827-8990849 TGTTATGCTAAATTTTAAAAAGG - Intronic
1093175126 12:15904948-15904970 TGTCATCCTATATGGCAAAAGGG - Intergenic
1093274344 12:17105617-17105639 TCTGATCCTAGATTTCAAATAGG - Intergenic
1094354279 12:29561219-29561241 TGTGTTCTTAAATGTTAAGAAGG + Intronic
1094721165 12:33065038-33065060 TGTTGTCCCAAATGTCACAAAGG - Intergenic
1095321997 12:40839264-40839286 TGTTGTCTCAAATGTCAAAATGG - Intronic
1096204728 12:49711540-49711562 TGTTATCTTACATGGCAAAAGGG + Intronic
1096508264 12:52110948-52110970 TGTGATTTTTAATGTCACAAAGG - Intergenic
1096961562 12:55583516-55583538 TCTGATCCTATATATGAAAAGGG + Intergenic
1097483774 12:60167128-60167150 GGTCATCTTAAATGACAAAAGGG + Intergenic
1098813847 12:75131454-75131476 TGTTATGTTACATGTCAAAAGGG + Intronic
1099075851 12:78107230-78107252 TGTTATCCCAAATGTCAGGAAGG - Intronic
1100598891 12:96095338-96095360 TGGAATCCTACATGTCAAACAGG - Intergenic
1101258869 12:103008802-103008824 TGTTAGCATACATGTCAAAAGGG - Intergenic
1101920793 12:108931341-108931363 TGTTATCTTAAAAGTCAGAATGG + Intronic
1102369458 12:112369975-112369997 TGTGACCTTAGATGGCAAAAGGG + Intronic
1102886083 12:116522979-116523001 TGCAATCATAAATGTCAAACAGG - Intergenic
1104111643 12:125710192-125710214 TGTGACCTTACATGGCAAAAGGG + Intergenic
1106473333 13:30077155-30077177 TGTCATCCTTCATGGCAAAAGGG - Intergenic
1108120693 13:47182773-47182795 TGTGATCTTATATGGCTAAATGG + Intergenic
1109099694 13:58165974-58165996 TCTGAATCTAAATGTCAAACTGG - Intergenic
1109481319 13:62958399-62958421 TGTGATCTTATATGGCAAGAAGG + Intergenic
1109620832 13:64902633-64902655 GGTGATACTACATGTGAAAAGGG - Intergenic
1110090184 13:71435161-71435183 TGTGATTCTCAATGTAGAAAGGG - Intergenic
1110464265 13:75782919-75782941 TGTTACCCTACATGGCAAAAAGG - Intronic
1110614553 13:77526933-77526955 TGTTATCTTACATGTTAAAAGGG + Intergenic
1110993626 13:82075273-82075295 AATGATCCTAAATGTTAAATAGG - Intergenic
1110997201 13:82126218-82126240 TGTTATCTTACATGACAAAAGGG + Intergenic
1111132242 13:83992275-83992297 TGTGTTCCTAAATTTAAAATTGG + Intergenic
1111144782 13:84166217-84166239 TGTGATCCCAAGTGTTAAAGGGG - Intergenic
1112622763 13:101068462-101068484 TATGATCATTAATTTCAAAAGGG - Intronic
1112819684 13:103317076-103317098 TGTTTTCCTAATTGCCAAAATGG + Intergenic
1113030643 13:105990399-105990421 TCTGACCCAAAATGTCAATAGGG - Intergenic
1114310087 14:21458547-21458569 TGTGCTCCAAAATATCAAAATGG + Intergenic
1115956181 14:38782480-38782502 TGTGACCCCAAAAGTGAAAATGG + Intergenic
1116106202 14:40510826-40510848 TGTCATTCAAAATGTTAAAATGG + Intergenic
1116179183 14:41514159-41514181 TGTTATCTTACATGGCAAAAGGG + Intergenic
1116470992 14:45285505-45285527 TGTAATGCCAAATGTCAAGAGGG - Intergenic
1116954166 14:50906921-50906943 TGTCATCCTAAATGTCCCACTGG - Intronic
1119505671 14:75171031-75171053 TGTTATCTTACATGGCAAAAGGG + Intronic
1120213998 14:81662410-81662432 TGTAAGCTTCAATGTCAAAAAGG + Intergenic
1120758401 14:88265214-88265236 TGTTATCTTACATGGCAAAAGGG + Intronic
1121760714 14:96442563-96442585 TTTGATCCTAAATCTCATCAGGG + Intronic
1123103172 14:105819280-105819302 TGAGATCTTACATGGCAAAAGGG - Intergenic
1127802030 15:62485239-62485261 TGTTATCTTACATGGCAAAATGG - Intronic
1128484264 15:68069358-68069380 TGTGATACCAAAGGTCAAACGGG - Intronic
1133449361 16:5890786-5890808 AGTCATCCTAAATGGCAATATGG - Intergenic
1138377848 16:56578532-56578554 TACTATCCTAAATGTCAACAGGG + Intergenic
1139559830 16:67734946-67734968 TGTAGTCCTCAATGTCAAACAGG + Exonic
1143812482 17:9483459-9483481 TGTTACCTTAAATGGCAAAAGGG - Intronic
1146670508 17:34734263-34734285 TGTGAGCCGAGATGTCAAGAAGG + Intergenic
1147480402 17:40755916-40755938 TGTGCTCCTAATTACCAAAATGG - Intergenic
1153166809 18:2270957-2270979 TGTGTTCTCAAATGGCAAAAGGG - Intergenic
1155575267 18:27238828-27238850 TGTTATCGTACATGACAAAAGGG - Intergenic
1156074405 18:33255897-33255919 TGGCATCCTGAATCTCAAAAAGG + Intronic
1158250327 18:55480556-55480578 AGTGATACTAAATTTCAAAGGGG + Intronic
1159567725 18:70072714-70072736 TGTTAGCCTATTTGTCAAAAGGG - Intronic
1160370242 18:78365973-78365995 TGTAGTCTTACATGTCAAAAGGG + Intergenic
1161360954 19:3849424-3849446 TGTTGTCCCAAATGTCAGAAGGG - Intronic
1163751935 19:19083354-19083376 TGTGATCTTACATGACAAAAGGG - Intronic
1166350084 19:42193294-42193316 TGTTACCTTAAATGGCAAAAAGG + Intronic
1167090378 19:47340074-47340096 TGTGATCCTAGCTGCCGAAAAGG - Intronic
925123935 2:1440270-1440292 TGAAATTCTAAATGTCGAAATGG + Intronic
926509793 2:13760906-13760928 TATGATACTACATGACAAAAGGG - Intergenic
927730515 2:25467182-25467204 TGTTATTCTAAATTTCAAAGGGG + Intronic
927922785 2:26986318-26986340 TGTCATCTTAAATGGCAAAAGGG - Intronic
928047765 2:27954489-27954511 TTTGCTCCCAAATGCCAAAATGG - Intronic
929408196 2:41666935-41666957 TGTTATGCTACATGGCAAAAGGG - Intergenic
930322996 2:49878931-49878953 TGTGAGCCCAAATGTCCGAAAGG + Intergenic
930596359 2:53393058-53393080 TGTGCTCCTAAATATCTGAAAGG + Intergenic
931049443 2:58394200-58394222 TGTTACCTTAAATGACAAAAGGG + Intergenic
931214173 2:60226051-60226073 TGGGATCCTGGATGTCAGAAAGG + Intergenic
933340138 2:81014380-81014402 TGTAAACTTAAATGTCAAAATGG - Intergenic
934061487 2:88298222-88298244 TGTTATCATAAATGGCAAAAAGG - Intergenic
934786261 2:97009627-97009649 TGTGTTCCTAAAAGTTAGAAAGG + Intronic
936974474 2:118205434-118205456 TGTGACCTTATATGGCAAAAAGG - Intergenic
939500041 2:142973289-142973311 TTTGCTCCTAAATGTCAAGAAGG + Intronic
940235016 2:151501636-151501658 TGTGTGACTAAATGTCCAAAGGG - Intronic
940442581 2:153735692-153735714 TGGGATCTTAAATGTCAATGAGG - Intergenic
940444906 2:153765652-153765674 TGTGTTTTTAAATGTGAAAAGGG + Intergenic
940935124 2:159484203-159484225 TCTGATCTAAAATATCAAAAAGG + Intronic
941550910 2:166914007-166914029 TGTTATCCAACATGTCAAAAGGG + Intronic
942143871 2:173006099-173006121 TTTTCTCCTAAATGTTAAAAAGG - Intronic
942213498 2:173695129-173695151 TGTGGTCCTAAATGATAAAATGG - Intergenic
942352917 2:175072382-175072404 TGACATCCTGAAAGTCAAAATGG + Exonic
943603196 2:189944978-189945000 TATGCTCCTAAATGACCAAATGG + Intronic
943761416 2:191613535-191613557 TGTGATGATAAATTTCTAAAAGG + Intergenic
944150282 2:196550737-196550759 TGTCATTTTAAATGGCAAAATGG + Intronic
944977738 2:205076362-205076384 TGTGATGCTAAATGTGGAAAGGG - Intronic
945493235 2:210480100-210480122 TGTGATCCTGAATGGCCACATGG - Intronic
947204626 2:227649077-227649099 TGAGAACCAAAAGGTCAAAAAGG + Intergenic
947233406 2:227913489-227913511 TGGCATCATAAATGTCACAAAGG - Intronic
1169792129 20:9422340-9422362 CGTAAACTTAAATGTCAAAATGG - Intronic
1170639139 20:18136783-18136805 TGTGAGCGTAAATGGCATAAGGG - Intergenic
1173322438 20:42000216-42000238 TGTTGTCCCAAATGTCATAAAGG + Intergenic
1174423176 20:50413926-50413948 TGTGCTCCAAAATGTCAAAGTGG + Intergenic
1175040736 20:56048206-56048228 TTTTTTCCTAAATGGCAAAAGGG - Intergenic
1175505612 20:59482324-59482346 TGTGACCTTACATGGCAAAAGGG - Intergenic
1179417609 21:41210746-41210768 TTAGGCCCTAAATGTCAAAAAGG - Intronic
1181990438 22:26832864-26832886 TGTTATCTTACATGGCAAAAGGG - Intergenic
1182025369 22:27114173-27114195 TGTGATTCTCATTGTCATAAAGG - Intergenic
1182397646 22:30047794-30047816 TGTTATCTTAAATTGCAAAAGGG + Intergenic
1183051036 22:35261484-35261506 TGTCATCTTCAAAGTCAAAATGG + Intronic
1183208269 22:36433916-36433938 TGTTAACCTACATGGCAAAAGGG - Intergenic
951881130 3:27482961-27482983 TATAATCCTAAAAGTTAAAAGGG + Intronic
952570478 3:34710125-34710147 TGTGATCCTGAGTGGCAAAAAGG - Intergenic
952908093 3:38157009-38157031 TGATATCCAAAATGTAAAAAAGG + Intergenic
953532260 3:43749303-43749325 TATCATCCTAAATGCCACAAGGG + Intergenic
953629734 3:44603374-44603396 TCTGGTCCAAAATGTCAATAAGG - Intronic
953852307 3:46473806-46473828 TGTTAGCTTAAATGGCAAAAGGG - Intronic
953940936 3:47096282-47096304 TGTGTTCTTAACTGTAAAAAAGG + Intronic
955980267 3:64518301-64518323 AATAATCCTAAATGTCAAATAGG + Intronic
956151054 3:66242857-66242879 TGTGATCCAAAATATCATTATGG - Intronic
956267244 3:67410569-67410591 TGCCATTCTAAATGTCCAAATGG - Intronic
956333422 3:68136655-68136677 TGAGTTCCTAAATGGAAAAAGGG + Intronic
956874549 3:73449146-73449168 TGTAATCCAACTTGTCAAAAAGG + Intronic
956895976 3:73660233-73660255 TGTGAATCTAAATGTAGAAAAGG + Intergenic
958003907 3:87788202-87788224 TCTGGTCATAAATGTCACAAAGG - Intergenic
959251615 3:103955265-103955287 TGTGACTGTAAATGTCAAAATGG + Intergenic
959293518 3:104504885-104504907 TATGCTCCTGAATGACAAAAGGG + Intergenic
960310686 3:116112844-116112866 TGAGATTCAAAATGTAAAAAGGG - Intronic
961930227 3:130525369-130525391 TGTGAACATAAAACTCAAAATGG + Intergenic
963077427 3:141360155-141360177 TGAGATCCCAAGTGTCAAAGAGG + Intronic
963190739 3:142469930-142469952 TAAGATACTAAATGTTAAAAAGG - Intronic
963463552 3:145648480-145648502 TGTTACCCTGAATGTTAAAAGGG + Intergenic
964194130 3:154042581-154042603 AGTGATCCAAAAAGTCAAAACGG - Intergenic
965396626 3:168166904-168166926 GGTGACCCTAAATGTAGAAATGG + Intergenic
966460119 3:180166987-180167009 TATGCTCCTGAATGACAAAAGGG - Intergenic
966562171 3:181335115-181335137 TGTCATTCTAAATGTAATAAAGG - Intergenic
967221984 3:187255055-187255077 TGTTATGTTAAATGGCAAAAGGG + Intronic
968888521 4:3352453-3352475 TGTCATCCTAAATAACAAATAGG + Intronic
969084973 4:4649606-4649628 TGTGATCCTAAGTGGTACAATGG + Intergenic
970493398 4:16599499-16599521 TGTGACCTTACATGGCAAAAGGG - Intronic
970893805 4:21078378-21078400 TGAGATCATAAATGTCAGCATGG + Intronic
971303579 4:25461803-25461825 TGGGATCCCAAATATCAACAAGG + Intergenic
973069617 4:45841419-45841441 TGTTACCTTAAATGGCAAAAAGG + Intergenic
974482584 4:62465494-62465516 TGTTATCTTACATGGCAAAAGGG - Intergenic
975382711 4:73720670-73720692 AAAGATTCTAAATGTCAAAAAGG - Intergenic
975404498 4:73974593-73974615 TGTTGTCCCAAATGTCACAAAGG + Intergenic
975799036 4:78039465-78039487 TGTTATCTTATATGGCAAAAGGG + Intergenic
976147504 4:82056603-82056625 TGTCACCTTACATGTCAAAAGGG - Intergenic
977878956 4:102182514-102182536 TGTTACCTTAAATGACAAAAGGG + Intergenic
979268795 4:118735095-118735117 TGTGATCCTAAATACCACAAAGG + Intronic
981570526 4:146146239-146146261 TCTGGTTCAAAATGTCAAAAGGG - Intergenic
983463549 4:168057211-168057233 TGTGACCCTGAATGTACAAAAGG + Intergenic
986910519 5:12549936-12549958 TGGCATCCTAATTGTCAAAGGGG + Intergenic
987518345 5:18945217-18945239 TGTGGCCCAAAATGTCAATAGGG - Intergenic
988226457 5:28418256-28418278 TGTCAACCTAAATAACAAAAAGG + Intergenic
988325851 5:29766553-29766575 TGCAATCAGAAATGTCAAAAAGG - Intergenic
989099364 5:37809919-37809941 TGCGACCCAAAGTGTCAAAAGGG - Intergenic
993186788 5:84632057-84632079 TGTGATGCTAAATCCAAAAATGG - Intergenic
993738838 5:91511073-91511095 TGTGATGCCACCTGTCAAAATGG - Intergenic
993969129 5:94395663-94395685 TGTGTACCTGATTGTCAAAAAGG - Intronic
994770518 5:103975270-103975292 TGTTGTTCTAAATGTCAGAAAGG - Intergenic
994977017 5:106820789-106820811 TGTTATCTTACATGGCAAAAGGG - Intergenic
995118343 5:108507333-108507355 TGTTATCTTAAGTGACAAAAGGG - Intergenic
995760878 5:115560556-115560578 TGTTATGTTATATGTCAAAAGGG + Intergenic
996123539 5:119699065-119699087 TGTTGTCCCAAATGTCAAGAAGG + Intergenic
996340332 5:122430819-122430841 CTTGATCCTAAAGGTCAAGAGGG + Intronic
996624105 5:125549075-125549097 ACTGATCCAAAATTTCAAAAGGG - Intergenic
1000428694 5:161124243-161124265 TGTGAACTTACATGGCAAAAGGG + Intergenic
1000449279 5:161364463-161364485 CTTGATGCTAAATTTCAAAATGG + Intronic
1001658183 5:173370141-173370163 TGTGACCTTATATGGCAAAAGGG - Intergenic
1001698130 5:173687817-173687839 TGTAATCTTACATGGCAAAAGGG - Intergenic
1001784259 5:174398337-174398359 TGTTACCTTAAATGGCAAAAGGG + Intergenic
1003219475 6:4145810-4145832 TGTGATCCTCAGTGTTAAAGGGG - Intergenic
1005369150 6:25112315-25112337 TGTGACCCTACATGACAAAATGG - Intergenic
1005700142 6:28392797-28392819 TCTGATCATTAAAGTCAAAAAGG - Intronic
1006202761 6:32311394-32311416 TGTGATCCTACTTGTCAATTTGG - Intronic
1007827445 6:44611308-44611330 TGTTATGCTACATGGCAAAAGGG - Intergenic
1009059802 6:58385309-58385331 TGTTATCTTACATTTCAAAAGGG - Intergenic
1009231109 6:61062087-61062109 TGTTATCTTACATTTCAAAAGGG + Intergenic
1009608170 6:65900845-65900867 TGTTAACCTAAATAACAAAAGGG - Intergenic
1011274127 6:85612529-85612551 TGGGATCCTTAATTTAAAAAAGG + Intronic
1011877959 6:91985383-91985405 TGTGTTCCCACATGGCAAAAGGG - Intergenic
1012428297 6:99138544-99138566 TGTGAGGTTAAATGACAAAAAGG - Intergenic
1012812927 6:103983867-103983889 TGTTATCCTAAATGTAAACTAGG + Intergenic
1016879937 6:148901082-148901104 TGTTACCCTACATGGCAAAAAGG - Intronic
1018402258 6:163435478-163435500 TGTTCTCCTCAATGTCAAAATGG - Intronic
1019077974 6:169406039-169406061 TGTGATCCCAAATCCCAAATAGG + Intergenic
1020457575 7:8391443-8391465 TGTTATCCTGCATGGCAAAAGGG + Intergenic
1020775500 7:12449647-12449669 TGTGATTCTCAATGTAAGAATGG + Intergenic
1022892022 7:34711055-34711077 TGTGAGCCCAAAGGTCCAAAAGG + Intronic
1024779344 7:52828807-52828829 TGAGATCATAAATATTAAAATGG - Intergenic
1024957490 7:54939290-54939312 TGTTATCCTAAAACCCAAAATGG + Intergenic
1025247800 7:57330432-57330454 TGTGCTCCAAAATGTCAAAGGGG - Intergenic
1025576374 7:62647783-62647805 TTTGACCCTTAAGGTCAAAAAGG - Intergenic
1025707500 7:63881020-63881042 TGTGTTGCTTAAAGTCAAAAAGG - Intergenic
1027444995 7:78263560-78263582 TGTATTCCTAGAGGTCAAAATGG - Intronic
1027583719 7:80030607-80030629 TGTGAGCCTAAATAGCAAGAAGG + Intergenic
1028527675 7:91803410-91803432 TGTTATCCTACATGGCAAAAGGG - Intronic
1030224429 7:107133368-107133390 TCTGACTCTAAATGTCAAATGGG - Intronic
1031331045 7:120465001-120465023 TGTTATCTTACATGGCAAAAGGG - Intronic
1031846302 7:126809274-126809296 TGTCATCCTATATGTCAAGGGGG - Intronic
1031981240 7:128126902-128126924 TGTGATCCTGAAAGTCGACATGG - Intergenic
1032017354 7:128388595-128388617 TGTGATCCTAAAAGGGAAAGAGG - Intergenic
1033053179 7:138025225-138025247 TGTGTTCATAAATGTCAAGCAGG + Intronic
1033063611 7:138130803-138130825 TGTAATCCCCAATGTTAAAAGGG - Intergenic
1033571393 7:142632314-142632336 AGTGATGCTAAATGTCCCAAAGG - Intergenic
1033813104 7:145040620-145040642 TGTGAGCCCAAAGGTCCAAAAGG - Intergenic
1034278575 7:149835983-149836005 TGTGATCATAAACTTCAAATTGG + Intergenic
1034325553 7:150228409-150228431 TGTTATCTTATATGACAAAAGGG + Intergenic
1035989123 8:4468613-4468635 TTTGAACCTAATTGTTAAAATGG + Intronic
1036134584 8:6148532-6148554 TGTTCTCCTAAATGTTTAAATGG - Intergenic
1037393862 8:18421670-18421692 TCTGACCTGAAATGTCAAAATGG + Intergenic
1038345588 8:26729373-26729395 TGTGAGCATAAAAGTAAAAATGG + Intergenic
1038412069 8:27366708-27366730 TGTGCTCAGAAATTTCAAAAGGG - Intronic
1039151109 8:34506659-34506681 TGAGATGCTATATGACAAAATGG - Intergenic
1040991441 8:53354431-53354453 TGTGACCTTACATGGCAAAAGGG - Intergenic
1041416339 8:57613117-57613139 TGTTCTCCTAAATGACAAATGGG + Intergenic
1042203548 8:66305171-66305193 TGAGATTCTAAATATAAAAAAGG - Intergenic
1044964335 8:97560595-97560617 GGTGTTCCTAAATGACAAATAGG - Intergenic
1046629823 8:116612355-116612377 TGTGGTCATAAATGACAGAATGG - Intergenic
1047349088 8:124056137-124056159 TGTTACCTTAAATGGCAAAAAGG - Intronic
1048509927 8:135053071-135053093 TATGATCTTACATGGCAAAAGGG + Intergenic
1050027589 9:1351801-1351823 TGTGGTCTTGAATGTTAAAAGGG - Intergenic
1050514259 9:6426393-6426415 TGTGCTCCTAAATGGGGAAAGGG - Intronic
1052883776 9:33623763-33623785 AGTGATGCTAAATGTCCCAAAGG - Intergenic
1053035630 9:34824878-34824900 TGTGATCCAAAATGTTTACATGG - Intergenic
1053294972 9:36906203-36906225 TGTGACCTTACATGGCAAAAGGG + Intronic
1054724468 9:68636563-68636585 TGTGATCATTTATGTCAACAGGG + Intergenic
1055563099 9:77541695-77541717 TGTTGTCCCAAATGTCACAAAGG + Intronic
1055827910 9:80348930-80348952 TGTTATCTTACATGTCAAAATGG + Intergenic
1055923469 9:81486458-81486480 TGCTATCATAATTGTCAAAATGG + Intergenic
1056541914 9:87578988-87579010 TGTCATCCTAAATGCCACACTGG - Intronic
1057255515 9:93543969-93543991 TGTGTATCTAAATGTGAAAAAGG + Intronic
1058091632 9:100812555-100812577 TGTGATTTTATATGGCAAAAGGG + Intergenic
1058727967 9:107821614-107821636 TGTTATCGTCAAGGTCAAAACGG + Intergenic
1059666397 9:116450413-116450435 TCTGATCCTAACTGTAAAATAGG - Intronic
1059680766 9:116583406-116583428 TTTAATCCTAAATTTCAAGAAGG + Intronic
1060210585 9:121707734-121707756 TCTGATTATGAATGTCAAAAAGG - Intronic
1061626974 9:131846413-131846435 TTTGATCCTACTTGTCACAAGGG - Intergenic
1186365778 X:8891881-8891903 TGTGACCTTACATGGCAAAAGGG + Intergenic
1186435010 X:9535193-9535215 TGAAATCCTAATTGTCAAGAAGG + Intronic
1186552347 X:10519859-10519881 TGTGATCAGAAATGTAAAACTGG - Intronic
1186850282 X:13573158-13573180 TGTTATCTTATATATCAAAAGGG - Intronic
1188059915 X:25589117-25589139 TATGGTCCCAAATGTCACAAAGG + Intergenic
1190858864 X:54324293-54324315 TGTCATCTTACATTTCAAAAAGG - Intronic
1191615379 X:63164339-63164361 TGTTTTCCTAAATGTCACCAAGG - Intergenic
1191620919 X:63214584-63214606 TGTTTTCCTAAATGTCACCAAGG + Intergenic
1193629695 X:83867817-83867839 TGTTATCTTATATGACAAAAGGG - Intronic
1194193358 X:90864191-90864213 TGTCATCCTCAATATTAAAATGG - Intergenic
1194368248 X:93035924-93035946 TGTGACCCTAAATGTGGATAAGG + Intergenic
1195970886 X:110472071-110472093 TGTTATGTTAAATGTCAAATGGG + Intergenic
1196067035 X:111475037-111475059 TGTGTTCCTAATTTCCAAAATGG - Intergenic
1196771931 X:119302977-119302999 TGTGATCATGGATTTCAAAAAGG - Intergenic
1197116215 X:122836768-122836790 TGTTACCCTACATGGCAAAAGGG + Intergenic
1199766441 X:150945049-150945071 TGTGATCTTATATGACAAAAAGG - Intergenic
1200539969 Y:4446574-4446596 TGTCATCCTCAATATTAAAATGG - Intergenic
1200676458 Y:6152189-6152211 TGTGACCCTAAATGTGGATAAGG + Intergenic
1201554622 Y:15255442-15255464 TATGATGAAAAATGTCAAAAAGG + Intergenic
1202056708 Y:20842058-20842080 TGTTGTCCTAAATGTCATGAAGG + Intergenic
1202166030 Y:21989077-21989099 TCTGCTACTAACTGTCAAAAAGG - Intergenic
1202225328 Y:22597296-22597318 TCTGCTACTAACTGTCAAAAAGG + Intergenic
1202317785 Y:23598365-23598387 TCTGCTACTAACTGTCAAAAAGG - Intergenic
1202552981 Y:26071693-26071715 TCTGCTACTAACTGTCAAAAAGG + Intergenic