ID: 906901188

View in Genome Browser
Species Human (GRCh38)
Location 1:49837952-49837974
Sequence CACCATTTATAGTAACCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 98}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906901179_906901188 22 Left 906901179 1:49837907-49837929 CCCTGAGCTATTGGAAGCAGAAG 0: 1
1: 0
2: 1
3: 16
4: 200
Right 906901188 1:49837952-49837974 CACCATTTATAGTAACCCCAGGG 0: 1
1: 0
2: 0
3: 6
4: 98
906901180_906901188 21 Left 906901180 1:49837908-49837930 CCTGAGCTATTGGAAGCAGAAGG 0: 1
1: 0
2: 1
3: 11
4: 212
Right 906901188 1:49837952-49837974 CACCATTTATAGTAACCCCAGGG 0: 1
1: 0
2: 0
3: 6
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906901188 Original CRISPR CACCATTTATAGTAACCCCA GGG Intronic
904904066 1:33881271-33881293 CAACATTTGTGGGAACCCCAAGG - Intronic
906654582 1:47538335-47538357 CAACAGTGATAGTAATCCCAAGG - Intergenic
906901188 1:49837952-49837974 CACCATTTATAGTAACCCCAGGG + Intronic
907195559 1:52683824-52683846 CACTATTCATAGTAACCAAAGGG - Intergenic
912336055 1:108863947-108863969 CAGCATTTATTGTATCTCCAGGG + Intronic
915794499 1:158714659-158714681 CAACATTTATAGTGACCTTAGGG - Intergenic
918823281 1:189287311-189287333 CATTATTTATAGTAACCAAAAGG - Intergenic
923286764 1:232503566-232503588 CACCATTTATAAGTACACCAAGG + Intronic
1067433343 10:46260042-46260064 TTCCATTTATAGTAATTCCATGG - Intergenic
1075056093 10:119219576-119219598 TACCATCTATTGTGACCCCAAGG - Intronic
1075600677 10:123766574-123766596 CACCACATGTAGTAAACCCAAGG + Intronic
1088106858 11:106216651-106216673 GTCCATTTATAATAACCCTAGGG + Intergenic
1088819404 11:113444632-113444654 CACCATTTATAGATGGCCCATGG - Intronic
1089056720 11:115591679-115591701 CACCATTTGGAGAAACCCAATGG - Intergenic
1090419074 11:126561653-126561675 TCCCATTTGTAGGAACCCCATGG - Intronic
1094595747 12:31864815-31864837 CACCATTAAAAGTAACAGCAGGG - Intergenic
1095240960 12:39858361-39858383 CATTATTAATAGTAACCTCATGG + Intronic
1096842614 12:54388965-54388987 CACCATGCCTAATAACCCCAGGG + Intronic
1097523765 12:60703748-60703770 CACCATTGTTAGTGACCCTATGG + Intergenic
1100651786 12:96598048-96598070 CACCATTTAGATTAACCCAAAGG - Intronic
1105320113 13:19311449-19311471 AACCATCTATGGTAAACCCATGG - Intergenic
1106026961 13:25964672-25964694 CACCCTTTCTGGGAACCCCAAGG - Intronic
1109836720 13:67868268-67868290 CATCATTCATAGTAACCAAAAGG + Intergenic
1115829055 14:37314261-37314283 CAACATTGATAGAAAACCCATGG + Intronic
1116881246 14:50171361-50171383 CATTATTTATAGTAACCAAAAGG + Intronic
1120870412 14:89331676-89331698 CACCATTTATAGTAACAAATAGG + Intronic
1121518115 14:94567375-94567397 CATCATTTAAAGGAAGCCCATGG - Intronic
1124935324 15:34164756-34164778 CACCATCTACATTAACGCCAGGG - Intronic
1125313825 15:38409677-38409699 CAGCATTTGTACAAACCCCACGG - Intergenic
1125670243 15:41466894-41466916 AACCATTTACAGGAAACCCAAGG - Intronic
1128639250 15:69323939-69323961 TACCATTTTTAATAGCCCCACGG + Intronic
1131570899 15:93535122-93535144 AACCATTTACAGTAAAGCCAAGG - Intergenic
1149044796 17:52232228-52232250 CACTATATATTGTATCCCCATGG - Intergenic
1149950545 17:60980234-60980256 CACCATTTATATTTCCCCTATGG + Intronic
1150305055 17:64077676-64077698 CACCATTTATAATAAGCAGAGGG - Intronic
1153751648 18:8238237-8238259 CACCTTTTGTAGTTGCCCCATGG + Intronic
1157943158 18:51951207-51951229 CACAATGAATAGAAACCCCAAGG + Intergenic
1159954498 18:74509919-74509941 CACCATGTAAAGTAATCCCCCGG - Intronic
925957328 2:8979972-8979994 CACATTTTATACCAACCCCAAGG + Intronic
927335926 2:21924180-21924202 CACCATTCATAGCAACCAAAAGG - Intergenic
927530303 2:23791806-23791828 CATCATTCATAGTAACCAAAAGG - Intronic
930095264 2:47561684-47561706 CAGTCTTTAAAGTAACCCCATGG + Intronic
943701230 2:190990121-190990143 TCCCATCTATAGTCACCCCAGGG + Intronic
945769525 2:214023781-214023803 TACCATTTATAGTAACTGCAAGG - Intronic
1178302746 21:31466566-31466588 CATCAGTAATAGTAACTCCAGGG + Intronic
1181394143 22:22606593-22606615 CATCAGATATAGTAACCACAAGG + Intergenic
1181778328 22:25175802-25175824 CAGCATTTAGAGTCACTCCATGG - Intronic
950275045 3:11653558-11653580 CACTATTTATAATAACCCCCAGG - Intronic
950407695 3:12815002-12815024 CAGCATTTATAGATACCCTATGG - Intronic
954130975 3:48560841-48560863 CACTATTTATAGTTCCCCCTTGG + Intronic
955829185 3:62983150-62983172 CACCTTCTATAATCACCCCAGGG - Intergenic
956831084 3:73048959-73048981 CATCAGTTATAGTTACCCCTGGG + Intronic
958804305 3:98791341-98791363 CACCATTTAAACTAACTCTAGGG - Intronic
967801389 3:193665547-193665569 CATAATTTAAAGTAACCCCTAGG + Intronic
968202463 3:196766751-196766773 CACCATCCATAGTTACCGCATGG - Intronic
970893437 4:21073765-21073787 CACTCTTTATGATAACCCCATGG - Intronic
975072654 4:70161001-70161023 CACCATTGAATGTAACCCCTTGG - Intronic
977344473 4:95799964-95799986 CACCATTTATAGTGTCCCCTGGG - Intergenic
978869354 4:113556668-113556690 ATCCATTTCTAGTTACCCCAGGG + Intronic
984361943 4:178745080-178745102 CACAATCCATTGTAACCCCAAGG + Intergenic
988100682 5:26673210-26673232 CACCTTTTTAAGTAACCACATGG + Intergenic
990476993 5:56171144-56171166 CTCCTTTTCTAGTAACCACAAGG + Intronic
990761901 5:59138985-59139007 CACCTTTTATAGAAACTGCAGGG - Intronic
991174174 5:63667589-63667611 CATTATTTATAGTAGCCCAAAGG + Intergenic
991498845 5:67255710-67255732 CAACATCTTTACTAACCCCAAGG + Intergenic
991732063 5:69599099-69599121 CAACATTTATGGTAACCACCTGG - Intergenic
991808496 5:70454242-70454264 CAACATTTATGGTAACCACCTGG - Intergenic
991862888 5:71028759-71028781 CAACATTTATGGTAACCACCTGG + Intergenic
992179131 5:74179698-74179720 CAATATTTATAGTAAGCACATGG + Intergenic
992325517 5:75655862-75655884 CAGCATTTATTGTCATCCCAAGG - Intronic
993935852 5:94001458-94001480 CATCATTTGTAGTTGCCCCATGG + Intronic
994876505 5:105429446-105429468 CAACATTTATAGAAAACCTAAGG - Intergenic
999455094 5:151708618-151708640 CTCCATTAATACTAACCACAGGG + Intergenic
1004628190 6:17396362-17396384 CACCATTTATAATAACCAAGAGG + Intronic
1004818137 6:19334758-19334780 TAATATTTATGGTAACCCCATGG - Intergenic
1006132587 6:31878210-31878232 CACCCTTCACAGGAACCCCAGGG + Intronic
1010284070 6:74054850-74054872 CACCAGTGATAGCAAACCCAAGG - Intergenic
1012235405 6:96808433-96808455 CTCCAGTTTTAGCAACCCCATGG - Intronic
1013547511 6:111173206-111173228 CACCACTTATTGTAACCCGTGGG - Intronic
1017126948 6:151074303-151074325 CACCAAAAATAGTAACCGCATGG + Intronic
1017903071 6:158734832-158734854 TACCATTTATTGAAAGCCCAAGG + Intronic
1019362623 7:613019-613041 CACCATTTTTAATGACCACACGG - Intronic
1019573960 7:1727279-1727301 CATCATTTCTAGCTACCCCAGGG - Intronic
1019892706 7:3959375-3959397 CACCAGTCCTAGTCACCCCATGG - Intronic
1020364851 7:7369931-7369953 ACCCATTTCTATTAACCCCATGG - Intronic
1020725150 7:11803176-11803198 AGGCATTTATAGTAACCCCAAGG - Intronic
1026386844 7:69858292-69858314 TACCATTATTAATAACCCCAAGG - Intronic
1030766921 7:113421715-113421737 CAGAATTTACAGTATCCCCAGGG - Intergenic
1030891009 7:114999163-114999185 TACCATTTATAGAAACCCAATGG + Intronic
1042207216 8:66341571-66341593 CACGATTTGAAGTTACCCCAGGG + Intergenic
1048654499 8:136520827-136520849 CACAATGTATAATAACCCAAGGG - Intergenic
1049360373 8:142209961-142209983 CACAATTTATGGGAACCCAAAGG - Intergenic
1050310121 9:4344207-4344229 CACCATTTTTATTTGCCCCAGGG + Intronic
1052048239 9:23820014-23820036 CACCATTTATATATACCCAAAGG + Intronic
1052493462 9:29195167-29195189 GACCATTTATAGGAACCTCCAGG - Intergenic
1052618638 9:30876622-30876644 CACTATTTATAGCAACAACATGG + Intergenic
1055594550 9:77851698-77851720 CAGCATTTGTAATAACCCCCAGG - Intronic
1057923692 9:99122556-99122578 TACCATGAATAATAACCCCAAGG + Intronic
1186335339 X:8581023-8581045 CACCATTTTTTGAAACACCACGG + Intronic
1188390645 X:29615285-29615307 AACCATATATAGTAACTCCTTGG - Intronic
1188555215 X:31404105-31404127 CATCTTCTAAAGTAACCCCATGG + Intronic
1194493066 X:94575556-94575578 CACCATTTAAAGCAAACCTATGG + Intergenic
1195336456 X:103859546-103859568 CACCATTTATTTTAGCCTCAAGG - Intergenic
1196512305 X:116526042-116526064 CTACATTTATAACAACCCCATGG - Intergenic
1198997919 X:142596714-142596736 CACCATTTATGTTAACTTCATGG - Intergenic