ID: 906903762

View in Genome Browser
Species Human (GRCh38)
Location 1:49866114-49866136
Sequence GGAGCAACTCTACAACTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1259
Summary {0: 1, 1: 0, 2: 1, 3: 50, 4: 1207}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906903762 Original CRISPR GGAGCAACTCTACAACTGAT TGG Intronic