ID: 906908198

View in Genome Browser
Species Human (GRCh38)
Location 1:49917951-49917973
Sequence GAGCAGGTTGTTCAGTTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 55, 2: 37, 3: 52, 4: 225}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906908198_906908203 11 Left 906908198 1:49917951-49917973 CCTAGAAACTGAACAACCTGCTC 0: 1
1: 55
2: 37
3: 52
4: 225
Right 906908203 1:49917985-49918007 CTGGGTACATAACGAAATGAAGG 0: 3603
1: 3565
2: 2261
3: 2025
4: 1624
906908198_906908199 -8 Left 906908198 1:49917951-49917973 CCTAGAAACTGAACAACCTGCTC 0: 1
1: 55
2: 37
3: 52
4: 225
Right 906908199 1:49917966-49917988 ACCTGCTCCTGAATGACTACTGG 0: 7186
1: 3446
2: 1974
3: 1828
4: 2105
906908198_906908201 -7 Left 906908198 1:49917951-49917973 CCTAGAAACTGAACAACCTGCTC 0: 1
1: 55
2: 37
3: 52
4: 225
Right 906908201 1:49917967-49917989 CCTGCTCCTGAATGACTACTGGG 0: 6882
1: 3380
2: 1919
3: 1766
4: 2040

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906908198 Original CRISPR GAGCAGGTTGTTCAGTTTCT AGG (reversed) Intronic
900533050 1:3164054-3164076 AAGCAGGTTGTTCTGAATCTGGG + Intronic
902392970 1:16116791-16116813 GAGCACGTTGTTCAGTTCCTGGG + Intergenic
904945588 1:34196655-34196677 GGGCAGGTTGTTCAGCATCTTGG - Intronic
905421766 1:37851304-37851326 GAGCACTTTGTTCAGTTTGCTGG - Intronic
906767754 1:48450525-48450547 GAACATCTTGTTCAGTATCTGGG - Intronic
906908198 1:49917951-49917973 GAGCAGGTTGTTCAGTTTCTAGG - Intronic
908542901 1:65138342-65138364 GTGGAGGTTGTCCAGGTTCTTGG + Intergenic
909118633 1:71572272-71572294 AAGCAGGCTGTTGAGATTCTGGG + Intronic
910281996 1:85511217-85511239 AAGCAAGTTGTTCAGTTTCCAGG - Intronic
910618590 1:89228046-89228068 GAGCAGGTTGTTCAGTTTCCAGG + Intergenic
911173992 1:94800663-94800685 GAGCAAGTTATTAACTTTCTAGG - Intergenic
911211392 1:95142418-95142440 GTGGAGGGTGTTCAGGTTCTTGG + Intronic
911672460 1:100622329-100622351 GAGCAGGCTGTTCACTTCCAGGG - Intergenic
913337638 1:117723533-117723555 GAGCAGGTTGCTCAGTTTCCAGG - Intergenic
913337980 1:117727334-117727356 GAGCAGGTTATTTAATTTCTAGG - Intergenic
913495899 1:119427939-119427961 GATCAGGTTGTTCATTTTTTAGG + Intergenic
914989286 1:152484644-152484666 GAGCAGGTAGTTCAATTTTTAGG - Intergenic
915766818 1:158371540-158371562 GAGCAGGTTCTCAGGTTTCTGGG - Intergenic
917084691 1:171293691-171293713 GATCAGGTTGTTTATTTTTTAGG + Intergenic
918750561 1:188264285-188264307 GAGCAGGTTATTTAATTTCCAGG + Intergenic
918986210 1:191630356-191630378 GTACATGTTCTTCAGTTTCTGGG - Intergenic
919495649 1:198264592-198264614 GAGCAGCTTGACCTGTTTCTTGG + Intronic
920385504 1:205568399-205568421 GAGGAAGATGTTGAGTTTCTAGG + Intergenic
922399352 1:225236300-225236322 GAGCACGTTGTTCAATTTACAGG + Intronic
923149254 1:231219034-231219056 GGGCAGGTGGTTCAGTGTCAAGG + Intronic
924298784 1:242615471-242615493 GAGCAGGTTGTTTAGTTTCCAGG - Intergenic
1063432885 10:6006348-6006370 GAACTAGTTTTTCAGTTTCTTGG - Intergenic
1063831663 10:9960444-9960466 GAGCAGGTTGTTCAGTTTCCAGG - Intergenic
1063841016 10:10072650-10072672 GAGCAGGTTGTTCAGTTTCCAGG + Intergenic
1065120347 10:22523818-22523840 GAGCAGGTTGTTCAATTTCCAGG + Intergenic
1069804432 10:71109831-71109853 GAGCATGTTGTTTAATTTCCAGG + Intergenic
1071227949 10:83553507-83553529 GATCAGGTGAGTCAGTTTCTCGG - Intergenic
1072569660 10:96647692-96647714 GAGCAGAGAGTTAAGTTTCTGGG + Intronic
1072708798 10:97701992-97702014 GAGCAGCTTCTTCAGTGCCTGGG + Intergenic
1072718691 10:97767778-97767800 GAGCAGCTTCTTCTTTTTCTGGG + Exonic
1074561660 10:114540589-114540611 GGGCAGGTTGTTCAGCCTCTTGG - Intronic
1075890754 10:125947981-125948003 GAGCAGGTTGTTCAGTTTCCAGG - Intronic
1077247646 11:1547238-1547260 GCGCAGGTTGGGCAGGTTCTGGG + Intergenic
1077411168 11:2404643-2404665 GTGCAGGCTGGTCAGTTTCCAGG + Exonic
1079909379 11:26290684-26290706 GAGCAGGTTGTTCAGTTTCCAGG + Intergenic
1080047393 11:27823131-27823153 TAACAGCTTGTTCATTTTCTTGG + Intergenic
1080200637 11:29665517-29665539 GAGCAGGTCATTCAGTTTCCAGG - Intergenic
1081308996 11:41547632-41547654 GAGCAGGTTGTTCTGTTTCCAGG - Intergenic
1081463398 11:43292985-43293007 GAGCATATTGTTTAATTTCTAGG - Intergenic
1084373890 11:68763242-68763264 GTGGAGGTGGGTCAGTTTCTAGG + Intronic
1086050028 11:82578386-82578408 AAGCTGGTTGTTCAATTTCCAGG - Intergenic
1086568887 11:88260340-88260362 GAGCATGTTGTTTAATTTCCAGG + Intergenic
1087354037 11:97071936-97071958 GAGCAAGTTGTTTAATTTCCAGG + Intergenic
1087804557 11:102541724-102541746 GAGCAGGTTATTTAATTTCCAGG - Intergenic
1088494905 11:110422991-110423013 GATCAGGTTGTTCAATTTTTAGG - Intergenic
1090807958 11:130214418-130214440 GGGCAGGTTATTCAGATTTTTGG - Intergenic
1091209791 11:133846273-133846295 GTGGAGGGTGTTCAGGTTCTTGG - Intergenic
1091576090 12:1737044-1737066 GTGCAGGTTGCTCAGTCTCATGG - Intronic
1093060443 12:14597007-14597029 AAGCAGGTTGTTCAATTTCCAGG + Intergenic
1094045992 12:26167774-26167796 GAACAGGGTGTTCAGTATCTAGG - Intronic
1096448993 12:51721596-51721618 GAGCAGCATCTTCAGTTTCAGGG + Exonic
1096957705 12:55543646-55543668 GAGCAGGTTGTTCAGTTTCCAGG + Intergenic
1097338540 12:58411905-58411927 GAGCAGGTGGGCCAGATTCTGGG + Intergenic
1097621481 12:61944171-61944193 GAGCAGGTTGTTCAGTTTCCAGG - Intronic
1097689563 12:62721723-62721745 TAGCAGGTTATTTAATTTCTTGG + Intronic
1097737596 12:63199088-63199110 GAGCATGTTGTTCAGTTTCCAGG - Intergenic
1098704864 12:73674251-73674273 GAGCAGGTTGTTCAGTTTCCAGG - Intergenic
1099140362 12:78966387-78966409 GAGAAAATTGTTCAATTTCTTGG - Intronic
1100660998 12:96698756-96698778 CTGCAAGTTGTTCAGGTTCTTGG + Intronic
1100970733 12:100067057-100067079 GAGCAGGTTATTTAATTTCCAGG - Intronic
1101133542 12:101714292-101714314 GAGCTGTTTGGTCAGTTTTTTGG + Intronic
1104258515 12:127161241-127161263 GCAGAGGTTGTTCAGGTTCTTGG + Intergenic
1105677458 13:22687584-22687606 GTGCAAGTTGTCCAGGTTCTTGG - Intergenic
1108307252 13:49150537-49150559 GAGCATGTTGTTTAGTTTCCAGG + Intronic
1110148248 13:72220768-72220790 GAGCAGGTTCTCCGGTCTCTGGG + Intergenic
1111116313 13:83782407-83782429 GAGCAAGTTGTTTAGTTTCCAGG - Intergenic
1111940117 13:94599438-94599460 CTGCAAGTTGTCCAGTTTCTTGG + Intergenic
1112214009 13:97411446-97411468 GAGAAATTTGTTCAGTTCCTTGG + Intergenic
1112404271 13:99104345-99104367 GTGCAGGGTGTCCAGGTTCTTGG + Intergenic
1112449524 13:99496165-99496187 GTGCAAGTTGTCCAGATTCTTGG + Intergenic
1112449560 13:99496484-99496506 CAGCAAGTTGTCCAGGTTCTTGG + Intergenic
1112629436 13:101144449-101144471 GAGCAGCTTCTCCAGTTTCCTGG + Intronic
1113666107 13:112143074-112143096 GAGGAGGTTGTTCAGGTGCAGGG + Intergenic
1114534515 14:23414357-23414379 GAGCAGGTTTTTCAGGGTCCGGG + Intronic
1114706241 14:24729368-24729390 GAGCAGATTGTTCAATTTCCAGG - Intergenic
1114923222 14:27360815-27360837 GAGCAGGTTTTTCAGTTTCCAGG + Intergenic
1115184199 14:30666272-30666294 AAGCAGGTTGTTCAGTTTCCAGG - Intronic
1117802299 14:59457313-59457335 TAGGAGTTTCTTCAGTTTCTTGG + Intronic
1119676746 14:76561491-76561513 GTGGAGGGTGTCCAGTTTCTTGG + Intergenic
1120449788 14:84652896-84652918 GAGCAGGTTGTTCAGTTTCCAGG + Intergenic
1126480292 15:49111148-49111170 GCGCAGGTTGTTGAGCTCCTGGG - Intronic
1126733385 15:51707608-51707630 GAGCAAGTTGCTCATCTTCTGGG - Intronic
1126854709 15:52826849-52826871 GAGCAGGTTGTTCAGTTTCCAGG - Intergenic
1126995001 15:54432466-54432488 GAGCAGGTTGTTCAGTTTCCAGG - Intronic
1127319862 15:57832891-57832913 GAGCAGGTTGTTTAATTTCCAGG - Intergenic
1127810760 15:62563355-62563377 GAGCATTTTGTTCATTTTGTTGG + Intronic
1128748697 15:70133186-70133208 GACCAGGTTTTACAGCTTCTGGG + Intergenic
1129958695 15:79663471-79663493 TAGCAATTTCTTCAGTTTCTTGG - Intergenic
1129963506 15:79711809-79711831 GAGCAGGTTGTTCAGTTTCCAGG - Intergenic
1130174733 15:81556649-81556671 AAGCAGGTTGTTTAATTTCCAGG + Intergenic
1130198187 15:81800663-81800685 GAGCAGGTTGTTCAGTTTCCAGG - Intergenic
1130692305 15:86093455-86093477 GTGCAGTATTTTCAGTTTCTGGG - Intergenic
1132984568 16:2757901-2757923 GAGCTGGTTGTTTAGCTTCTCGG - Exonic
1134107585 16:11494873-11494895 GAGCAATTTGTTCAGACTCTGGG - Intronic
1134758295 16:16689345-16689367 GAGCAGGTTGTTCAGTTTCCAGG - Intergenic
1134987777 16:18669832-18669854 GAGCAGGTTGTTCAGTTTCCAGG + Intergenic
1135231419 16:20711648-20711670 GAACAGGTGGCTCAGTTTCCAGG + Intronic
1135800122 16:25486424-25486446 GAGCAGGTCGTCCAATTTCTAGG + Intergenic
1137239564 16:46643703-46643725 AAGGAGGTTCTTCAGTTTCCAGG - Intergenic
1138192353 16:55024659-55024681 GAGCAGGTTATTTAATTTCCAGG - Intergenic
1140401490 16:74675416-74675438 GTTATGGTTGTTCAGTTTCTTGG - Intronic
1140613008 16:76624296-76624318 GAGAAGGGTGTTCAGATTCTGGG - Intronic
1141420623 16:83913078-83913100 GAGCAGGGTGTTCACTGTGTTGG + Intronic
1144066979 17:11633405-11633427 TAGCAAGTAGTTCAGTTTCTGGG + Intronic
1146463002 17:33062436-33062458 GAGCAGCTTGTTCAGTTTCCAGG + Intronic
1146520260 17:33520789-33520811 TAGCAGGGAGTTCTGTTTCTGGG + Intronic
1146527766 17:33581464-33581486 GTGTAAGTTATTCAGTTTCTTGG + Intronic
1146923510 17:36729096-36729118 GAGCAGGTTCCTCTGATTCTGGG + Intergenic
1153800616 18:8665138-8665160 CTGCAGGTTGTCCAGTTTCTAGG + Intergenic
1154061014 18:11060124-11060146 GAGCAGGTTGTTCAGTTTCCAGG - Intronic
1155127049 18:22888225-22888247 GAGCAGGTTGTTCAGTTTCCAGG - Intronic
1155430033 18:25745377-25745399 AAGCAGGTTGTTCAATTTCCAGG - Intergenic
1156158732 18:34333835-34333857 GAGCAGGTTGTTCAGTTTCCAGG - Intergenic
1157919872 18:51703888-51703910 GAGCAGGTTGTTCAGTTTCCAGG + Intergenic
1158145455 18:54307358-54307380 GAGCAGGTTGTTCAGTTTCCTGG + Intronic
1160599008 18:79998360-79998382 GATCAGGTTGTTCATTTTTTAGG - Intronic
1164567994 19:29342710-29342732 TTGGAGTTTGTTCAGTTTCTTGG - Intergenic
1164736644 19:30546005-30546027 GGGCAGGATCTTGAGTTTCTAGG + Intronic
1165122802 19:33572772-33572794 GTGAAGGGTGTTCAGGTTCTTGG + Intergenic
1166264118 19:41666531-41666553 GACCAGTTGATTCAGTTTCTTGG + Intronic
1166822793 19:45590952-45590974 GAGCAGGTTGTGCAGGGCCTTGG + Exonic
1167592000 19:50409199-50409221 GAGCAGGTTCTCCAGGATCTGGG - Exonic
926303631 2:11621444-11621466 GAGCAGGGAGGTCAGTGTCTTGG + Intronic
927117517 2:19919451-19919473 GAGAAGGTTGTTCAGTTTCCAGG - Intronic
927666271 2:25035114-25035136 GATCGGGTTGGCCAGTTTCTGGG + Intergenic
929195367 2:39179381-39179403 TAGCAAGTTATTCAGTTTGTGGG - Intronic
929371652 2:41231902-41231924 GAGCATGTTGTTTAATTTCCAGG + Intergenic
930467408 2:51772320-51772342 GAGCAGGTTGTTCAGTTTCCAGG + Intergenic
930477009 2:51894186-51894208 GAGCAAGTTGTTCAGTTTCCAGG - Intergenic
930680611 2:54253893-54253915 AAGCAGGCTTTTTAGTTTCTTGG - Exonic
931355866 2:61537561-61537583 GAGCAGTTGGTTCAATCTCTGGG - Exonic
931481480 2:62645645-62645667 GAGCAGGTTGTTCAGTTTCCAGG + Intergenic
932642515 2:73463318-73463340 GAGCAGGTTATTCAGTTTCCAGG - Intronic
933229347 2:79788176-79788198 GAGCAGGTTCTTCACCTGCTTGG - Intronic
935472194 2:103473950-103473972 GAGCAGGTTGTCCAGTTTCCAGG + Intergenic
936654259 2:114466531-114466553 AGGCAGGTTGTTTAATTTCTTGG + Intronic
937148126 2:119664875-119664897 GAGCAGGTTGTTCAATCTCCAGG - Intergenic
938800089 2:134754705-134754727 GAGCATGTTGTTTAATTTCCAGG - Intergenic
939072251 2:137557431-137557453 GAGCAGGTTGTTCAGTTTCCAGG - Intronic
939170872 2:138693778-138693800 GAGCAGGCTGTTCTGTTGATGGG - Intronic
939179884 2:138792144-138792166 GAGCAGGTTGTTTAATTTCCAGG + Intergenic
939221489 2:139307932-139307954 GAGCAGGTTGTTCACCTCCTAGG - Intergenic
940026048 2:149209455-149209477 GATCGGGTTGTTCAGATTTTAGG + Intronic
940592845 2:155751110-155751132 GAGCAGGTTGTTAAATTTGCAGG - Intergenic
940731023 2:157391964-157391986 GAACATGTTGTTTAGTTTCCAGG + Intergenic
942065537 2:172267981-172268003 GAGCAGGTTGTTCAGTTTCCAGG + Intergenic
942170551 2:173285307-173285329 GTGCAGGCTGTTCCTTTTCTCGG - Intergenic
942599511 2:177626623-177626645 GAGGAGGTTGTTCAGATTTATGG - Exonic
943260814 2:185660574-185660596 GTGCATGGTGGTCAGTTTCTAGG - Intergenic
943657036 2:190520848-190520870 GAGAAGGATGTTCAGATCCTTGG - Intronic
944215436 2:197250125-197250147 GACCAGGTAGTTCAGTGGCTTGG + Intronic
944865741 2:203859747-203859769 GAGCATTTATTTCAGTTTCTTGG - Intergenic
945481289 2:210348828-210348850 GAGCAGATTGTTCAGCTTCCCGG + Intergenic
946065036 2:216979993-216980015 GAGCAGGTTTTTTAGTTTTCAGG + Intergenic
947719542 2:232362118-232362140 CTGCAGGTTGTCCAGGTTCTTGG - Intergenic
947872713 2:233448452-233448474 CTGCAGGTTGTCCAGGTTCTTGG + Intronic
947882658 2:233532645-233532667 GTGCAAGTTGTCCAGGTTCTTGG - Intronic
947906182 2:233764964-233764986 GAGAAGGATGGTCAGTGTCTGGG + Intronic
947923377 2:233899151-233899173 GTGGAGGGTCTTCAGTTTCTAGG - Intergenic
948003978 2:234592237-234592259 GAACTGGTGGTTGAGTTTCTTGG + Intergenic
948734399 2:239991142-239991164 GGTCAGGTTGTTCTGTTTGTGGG - Intronic
1168986493 20:2053426-2053448 GAGCAAGTTCTCCAATTTCTCGG + Intergenic
1169138574 20:3213163-3213185 GAACAGGTCGTTCAGATTCTAGG + Exonic
1173288507 20:41693832-41693854 GTGGAGGGTGTTCAGGTTCTTGG + Intergenic
1173485635 20:43439032-43439054 GTGGAGGGTGTTCAGGTTCTTGG - Intergenic
1174651781 20:52132090-52132112 GAGCATGTTGTTTAATTTCCAGG - Intronic
1174829144 20:53797014-53797036 GAGCTGGTTGTTAAGTTTTCAGG - Intergenic
1175495896 20:59413870-59413892 GAGCAGGGTGATCTGTGTCTTGG + Intergenic
1176316642 21:5251618-5251640 GAGCATGTTGTTCAGCTTCTAGG + Intergenic
1176694285 21:9955986-9956008 AAGCAGATTGTTCAATTTCCAGG + Intergenic
1177534275 21:22403522-22403544 GAGGAGGGTGTCCAGGTTCTTGG - Intergenic
1177639269 21:23825693-23825715 GAGCATTCAGTTCAGTTTCTTGG + Intergenic
1178235817 21:30839989-30840011 GAGCAGGTTGTTCAGTTTCCAGG + Intergenic
1178898562 21:36580948-36580970 GACAAGGATGTGCAGTTTCTGGG - Intergenic
1181363843 22:22358466-22358488 AAGCAGGATGTTCTGTTTCCTGG - Intergenic
1181366650 22:22381552-22381574 GAGGAGGATGTTCTGTTTCCTGG - Intergenic
1184877243 22:47283505-47283527 GAGCAGCTCTTTCAGTTTCCAGG + Intergenic
949580335 3:5381868-5381890 GAGCAGGTTATTCAGTTTCCAGG + Intergenic
950109465 3:10409661-10409683 GACTTGGTTATTCAGTTTCTTGG + Intronic
950299621 3:11865253-11865275 GAGCAGGTTGTTCAGTTTCCAGG + Intergenic
950440937 3:13009946-13009968 GAGCATGTGGTTAAGATTCTGGG + Intronic
950826753 3:15831206-15831228 GACCAGCTTGTTTAGTTTGTGGG - Intronic
951595838 3:24317205-24317227 GAGCAGGTTATTTAATATCTTGG + Intronic
952638175 3:35557318-35557340 GAGTAGGATGGTCTGTTTCTTGG - Intergenic
954039587 3:47874769-47874791 GAGAGGATTTTTCAGTTTCTTGG + Intronic
959043589 3:101446636-101446658 GAGCATGTTGTTTAATTTCCAGG - Intronic
959759252 3:109940124-109940146 GAGAAGGTTGTTTTATTTCTAGG + Intergenic
960331234 3:116362727-116362749 GAGCAGGTTGTTCAGTTTCCAGG - Intronic
962004056 3:131330561-131330583 GAGGACCTTGTTAAGTTTCTTGG + Intronic
962496352 3:135944376-135944398 GTGAAGGTTGTTCATGTTCTTGG + Intergenic
962694712 3:137936787-137936809 GAGCAAGGTGTGCAGCTTCTCGG - Intergenic
963689524 3:148480988-148481010 GAGCAGGTTGTTCAGTTTCCTGG - Intergenic
964196591 3:154072014-154072036 GAGCAAGTTGTTTAATTTCCAGG - Intergenic
964882269 3:161436391-161436413 GAGCAAGTTGTTTAATTTCCAGG - Intergenic
965297359 3:166966338-166966360 GAGCATGTTGTTTAGTTTTCAGG + Intergenic
966080853 3:175998324-175998346 GAGCAGGCTGTTCAATTTCCAGG - Intergenic
966570200 3:181433092-181433114 CAGCAGGATGCTGAGTTTCTAGG + Intergenic
966573542 3:181474646-181474668 GAACAGGTTGTTCAATTTCCAGG + Intergenic
967406383 3:189119994-189120016 GAGCAAGTTGTCAAGTGTCTTGG + Intronic
968937576 4:3620224-3620246 GTGGAAGGTGTTCAGTTTCTTGG + Intergenic
969445951 4:7244833-7244855 GAGCAGGGTTTTCAGAATCTTGG + Intronic
969982401 4:11171454-11171476 GAGCAGGTTGTTCAGTTTCCAGG + Intergenic
971638282 4:29093450-29093472 AAGCATGCTGTTAAGTTTCTTGG + Intergenic
971696825 4:29915468-29915490 GTGTAAGTTGTTCAGGTTCTCGG - Intergenic
971860957 4:32104766-32104788 GTGGAGGTTGTCCAGGTTCTTGG - Intergenic
972185836 4:36526945-36526967 GAGCATGCTGTTCAATTTTTAGG + Intergenic
972859600 4:43151214-43151236 GAGCAGGTTGTTCAGTTTCCAGG + Intergenic
973341578 4:49010750-49010772 GAGCAGGTTGTTCGGTTTCCAGG + Intronic
974650309 4:64746769-64746791 GAGCAGGTTGTTTAATTTCTAGG + Intergenic
975586761 4:75957685-75957707 GGGCATGCTGTTCAGCTTCTTGG + Exonic
975731421 4:77341334-77341356 GAGCAGGTTGTTCAGTTTCCAGG + Intronic
976210112 4:82659605-82659627 GAGCAGGTTGTTCAGTTTCCAGG + Intronic
976674614 4:87690726-87690748 GATCAGGTTATACAGTTGCTTGG + Intergenic
976769702 4:88637460-88637482 GAGCAGGTTGTTCAATTTCCAGG - Intronic
977975851 4:103266093-103266115 GAACAGGTTATTTAATTTCTAGG + Intergenic
977998611 4:103528296-103528318 GAGCAGGTTATTCAGTTTCCAGG + Intergenic
979020555 4:115491597-115491619 CAGCAGGTTATTTAGTTTCCAGG - Intergenic
979512502 4:121570162-121570184 GAGCAGGTTGTTCAGATTCCAGG - Intergenic
980249020 4:130289749-130289771 CAGCATGGTTTTCAGTTTCTCGG + Intergenic
980366905 4:131816207-131816229 AAGCAGATTGTTCAATTTCCAGG + Intergenic
981481133 4:145240467-145240489 GAGCAGGTTGTTCAGTTTCCAGG + Intergenic
981512145 4:145569277-145569299 GAACAGGTTGTTTAATTTCTAGG - Intergenic
982733170 4:158978193-158978215 GAGCAGGTTGTTCAGTTTCCAGG + Intronic
982733690 4:158982590-158982612 GAGCAGATTGTTCAGTTTCCAGG - Intronic
985137200 4:186798380-186798402 TAACATGTTGTTCAGTTTCTCGG - Intergenic
985440099 4:189977235-189977257 GTACAGGTTTTTCATTTTCTTGG - Intergenic
985690767 5:1310928-1310950 GTGGAGGTTGTCCAGGTTCTTGG + Intergenic
986357723 5:6944878-6944900 GAGCAGGTTGTCCCCTTTCTAGG + Intergenic
986892250 5:12323091-12323113 TAGGAGTTTGTTGAGTTTCTAGG - Intergenic
987426925 5:17783832-17783854 GCTCAAGTAGTTCAGTTTCTTGG - Intergenic
988183368 5:27827563-27827585 GGGCGGGTTGTACAGTTCCTGGG - Intergenic
988336655 5:29916432-29916454 GAGCAGGTTTTTCAGTTTTCAGG - Intergenic
989072450 5:37525346-37525368 GAGCAGGTTGTTCAGTTTCCAGG - Intronic
989522194 5:42415588-42415610 GGGCAGGTTGTTCCGTTCCCAGG + Intergenic
992071496 5:73153140-73153162 AAGCAGGTTTTTCAGTTTCATGG + Intergenic
992117130 5:73550258-73550280 GAGCAGGCAAATCAGTTTCTTGG - Intergenic
993133974 5:83933581-83933603 GAGCAGGTTGTTTAATTTTCAGG - Intergenic
993798497 5:92300243-92300265 GAGCAGGTTGTTCAGTTTCCAGG + Intergenic
994188641 5:96843043-96843065 GCGGAGGGTGTTCAGGTTCTTGG + Intronic
994249225 5:97517190-97517212 GAGCAGGTTGTTCAGTTTCCAGG + Intergenic
995307338 5:110668845-110668867 GAGCAGGTTGTTCAGTTTCCAGG - Intronic
995955568 5:117772327-117772349 GAGCAGGTTATTTAATTTCCAGG - Intergenic
996668518 5:126088825-126088847 GAGCAGGTTATTCAGTTTCCAGG - Intergenic
996782248 5:127200004-127200026 GAGCAGGTTGTTCAGTTTCCAGG - Intergenic
996788575 5:127268192-127268214 GAGCAGGTTGTTCAGTTTCCAGG + Intergenic
998629110 5:143878703-143878725 GTGTAAGTTGTTCAGGTTCTTGG - Intergenic
999322182 5:150622381-150622403 GAAAAGGTTGTTCAGGCTCTGGG + Intronic
999618241 5:153448301-153448323 GAGGAAGTTTTTCAGTTGCTAGG - Intergenic
1000125403 5:158238947-158238969 GAGGAGGTTGGACAGTCTCTAGG - Intergenic
1000214554 5:159142416-159142438 GAGCAGCTTGTTCTGTTTCCAGG - Intergenic
1000879498 5:166680976-166680998 GAGCAGGTAGCTCAGTTTACGGG - Intergenic
1001615720 5:173042027-173042049 GACCAGTTGGGTCAGTTTCTGGG + Intergenic
1002476323 5:179468617-179468639 CAGCAGATAGTTCAGGTTCTGGG + Intergenic
1003169897 6:3712950-3712972 GGGCAGGGTGTTTGGTTTCTGGG - Intergenic
1003187191 6:3842109-3842131 AAGCAGGTGGTTCAGGTCCTGGG - Intergenic
1003943638 6:11053023-11053045 GAGCAAGTTCTTCAATGTCTAGG + Intergenic
1004480032 6:16010212-16010234 GAGCATGTAGTCCAGTTTCAGGG + Intergenic
1005390126 6:25324522-25324544 AAGAATGTTGTTCAGTTTCATGG + Intronic
1008183120 6:48357996-48358018 GAGCAGGTTATTCAATTTTCAGG - Intergenic
1008462906 6:51796774-51796796 GAGAAGGTTGTTCATTTCCATGG + Intronic
1008905552 6:56673886-56673908 GAGGATGATGTTCAGTTTATTGG - Intronic
1009233500 6:61094538-61094560 GAGCAGGTTGTTCAGTTTCCAGG - Intergenic
1009393506 6:63169827-63169849 GAGCAAGTTGTTCAGTTTCCAGG - Intergenic
1010446687 6:75956868-75956890 GAGCAGGTTGTGCAGTTTCCAGG + Intronic
1011318438 6:86063067-86063089 GAGCAGGTTGTTCAGTTTGCAGG + Intergenic
1012712935 6:102631796-102631818 GTGGAGGGTGTTCAGTTTCGTGG - Intergenic
1013807122 6:114008402-114008424 GTGGAGGGTGTTCAGGTTCTTGG + Intronic
1014085064 6:117332712-117332734 GAGCAAGTTGTTCAATTTCCAGG - Intronic
1014277489 6:119402822-119402844 GAGCAGGTTGTTCAGTTTCCAGG - Intergenic
1014343276 6:120234393-120234415 CAGAAGGTTCTTCGGTTTCTTGG - Intergenic
1014524315 6:122482919-122482941 GAGCTTGCTGTTAAGTTTCTTGG + Intronic
1014547837 6:122753593-122753615 CTGCAGGTTGTCCAGGTTCTTGG + Intergenic
1015302119 6:131665503-131665525 TAGTAGGTTATTCAGTTTGTTGG + Intronic
1015623115 6:135153626-135153648 GAGCAGGTTGTTCAGTTTCCAGG + Intergenic
1017341851 6:153333287-153333309 CAGAATATTGTTCAGTTTCTAGG + Intergenic
1017914663 6:158821957-158821979 GACCAGGTTGGTCAGTTTGCAGG - Intergenic
1018514966 6:164569492-164569514 GGACAGATTGTTCATTTTCTTGG + Intergenic
1018771253 6:166973227-166973249 GTGGAGGGTGTCCAGTTTCTTGG + Intergenic
1020450089 7:8311588-8311610 GAGCAGATTGTTTAATTCCTAGG + Intergenic
1020487391 7:8736403-8736425 GAGCAGGTTGCTCAGTTTCCAGG + Intronic
1021785038 7:24142971-24142993 AAGCAGGTTATTGATTTTCTAGG - Intergenic
1023683547 7:42713161-42713183 GAGCAGGTTGTTGTCTCTCTAGG + Intergenic
1023817277 7:43960821-43960843 GAGAAGGGTGTCCAGGTTCTTGG + Intergenic
1024337014 7:48219383-48219405 GGCCAGGTTGTTGACTTTCTTGG - Exonic
1027843632 7:83344487-83344509 GAGCAGTTTGTTCAGTTTCCAGG - Intergenic
1028442786 7:90882809-90882831 CAGCAGGTTGTTCAACTTCCAGG - Intronic
1030148177 7:106377539-106377561 GTGCAAGTTGATCAGTATCTGGG - Intergenic
1031032339 7:116748297-116748319 GAGCAGGTTATTCAGTTTCCAGG - Intronic
1031051726 7:116952102-116952124 CTGCAGGTTGTCCAGGTTCTTGG - Intergenic
1033428097 7:141263663-141263685 GATGTGGTTGTTCAGTTTCCTGG + Intronic
1034365763 7:150545525-150545547 GAGTAGGTTGTTCAGTTTCCAGG - Intergenic
1034696191 7:153056140-153056162 CAGCAGGTTGTGCGGCTTCTCGG - Intergenic
1035241158 7:157530109-157530131 GGGCAGGTTGTTAAGTTTGTAGG + Intergenic
1037374902 8:18217143-18217165 GATCAGGTTGTTCATTTTTTAGG + Intronic
1037797628 8:22009999-22010021 GACAAGGATGTGCAGTTTCTGGG + Intergenic
1038303692 8:26379847-26379869 GGGCATGGTGTTCAGCTTCTTGG + Intergenic
1044007671 8:86958103-86958125 GAGCAGGTTGTTCAGTTTCCAGG + Intronic
1044102849 8:88161829-88161851 GAGCAGGTTGTTCAGTTTCCAGG + Intronic
1044332713 8:90940564-90940586 GAACACGTTGTTTAGCTTCTGGG + Intronic
1044450677 8:92332793-92332815 GATCAGGTTGTTCTGTTTCCAGG + Intergenic
1045286244 8:100794068-100794090 GAGCTGGTTGGTGACTTTCTGGG + Intergenic
1046203243 8:110954358-110954380 GAGCAGGTTGTTCAGTTTCCAGG - Intergenic
1046465424 8:114596018-114596040 GATCAGGGTATTCAGTTTATAGG + Intergenic
1047102281 8:121690687-121690709 GAGCATGTTGTTTACTTTCCAGG - Intergenic
1050242963 9:3658107-3658129 GGGCAGGTTCTTCAGTCCCTGGG + Intergenic
1052714735 9:32101340-32101362 GAGCAGGTTGTTCAGTTTCCAGG - Intergenic
1053038164 9:34844554-34844576 GAGCATGTTGTTTAATTTCCAGG + Intergenic
1053631262 9:39942148-39942170 AAGCAGATTGTTCAATTTCCAGG + Intergenic
1053774504 9:41521385-41521407 AAGCAGATTGTTCAATTTCCAGG - Intergenic
1054212625 9:62308550-62308572 AAGCAGATTGTTCAATTTCCAGG - Intergenic
1054453580 9:65417468-65417490 GTGGAGGGTGTTCAGTTTCTTGG - Intergenic
1055400205 9:75915306-75915328 GAGCAGCCTGTTCTGTTTATGGG + Intronic
1055651696 9:78412394-78412416 GCGCAGGTAGATCAGTTTGTTGG - Intergenic
1057018063 9:91671823-91671845 GAGCAGGTTGTTCAATTTCCAGG + Intronic
1057583843 9:96311932-96311954 GTGGAGTTTGTTGAGTTTCTTGG + Intergenic
1057670344 9:97081220-97081242 GAGCGGGTTGTTCGATTTCCAGG - Intergenic
1057875832 9:98753949-98753971 GAGCCGACTGTTCAGTTTATAGG - Intronic
1058681985 9:107448012-107448034 GAACAGGTTGACCAGGTTCTAGG - Intergenic
1058814509 9:108670898-108670920 AAGCAGGTTGTTCAGTGTCCAGG - Intergenic
1059406473 9:114101055-114101077 GAGCACCTTGTTCATTTACTGGG - Intergenic
1059673282 9:116512276-116512298 GAGCACGTTGCTCAGTTTCCAGG + Intronic
1185734159 X:2484906-2484928 GAGCCGGTTGGGCTGTTTCTGGG - Intronic
1186439413 X:9572811-9572833 GAGCAGGATATTCATTTGCTAGG + Intronic
1187605460 X:20877441-20877463 GAACAGGTTGTTCAATTTCCAGG - Intergenic
1188075689 X:25772667-25772689 GAGCAGGTTGTTCAGTTTCCAGG - Intergenic
1188893002 X:35633680-35633702 GAGCAGGTTGTTCAGTTTCCAGG + Intergenic
1189113027 X:38313407-38313429 GAGCAAGTTGTTCAATCACTGGG + Intronic
1189761761 X:44329046-44329068 GCGGAGGGTGTTCAGGTTCTTGG - Intronic
1191133032 X:57035313-57035335 GATCAGGTTGTTCAGTTTCCAGG + Intergenic
1191768321 X:64726960-64726982 GAGTAGTTTATTCATTTTCTGGG + Intergenic
1191768576 X:64730542-64730564 GAGCAGGTTGTTCAATTTTCAGG + Intergenic
1191917465 X:66218412-66218434 GAGCAGGTTATTTAATATCTAGG - Intronic
1192061089 X:67827072-67827094 GAGCATGTTGTTTAATTTCTTGG + Intergenic
1192291318 X:69798534-69798556 GAGCATGTTGTTTAATTTCCAGG - Intronic
1192293101 X:69818087-69818109 CAGCAGGTTGTTCAATTTCCAGG - Intronic
1192661004 X:73042997-73043019 GATCAGGCTGTTCATTTTTTAGG - Intergenic
1193171630 X:78344009-78344031 GCACAGGTTGTTCAGTTTCTAGG - Intergenic
1193693128 X:84671999-84672021 GAGCATGTTGTTTAATTTCCAGG - Intergenic
1194248269 X:91541196-91541218 GAGCATGTTATTCAATTTCCAGG - Intergenic
1194307918 X:92271340-92271362 GTGCAGGATGTTCAGGTTCTTGG + Intronic
1194545404 X:95227568-95227590 GAGCAAGTTGTTCAGTTTCCAGG - Intergenic
1195017593 X:100794568-100794590 GATCAGGTTGTTCATTTTTTAGG - Intergenic
1195348359 X:103974039-103974061 GAGCAGTTATTTCAGTTTCTAGG + Intergenic
1195359083 X:104064802-104064824 GAGCAGTTATTTCAGTTTCTAGG - Intergenic
1195453415 X:105041153-105041175 GAGCAGGTTGTTCAGTTTCCAGG + Intronic
1195774541 X:108388989-108389011 GAGCAGGTTGTTCAGTTTCCAGG + Intronic
1195786378 X:108527984-108528006 GAGCAGGTTCTTCAGTCCCTGGG - Intronic
1196600157 X:117592340-117592362 AAGCAGGTTGTTCAATTTCCAGG - Intergenic
1196634146 X:117980943-117980965 GACCAGGTTGCTAAGTCTCTTGG - Intronic
1196858054 X:120001696-120001718 GCGGAGGCTGTTCAGTTTGTTGG + Intergenic
1197157517 X:123286135-123286157 GAGCAGGTTGTTCAGTTTCCAGG - Intronic
1197167007 X:123388989-123389011 GAGCATGTTGTTTAATTTCCAGG + Intronic
1197470248 X:126859067-126859089 TGGAAGGTTGTTTAGTTTCTGGG - Intergenic
1198165070 X:134047440-134047462 GAGCAGGTTGTTCAGTTTCCAGG + Intergenic
1198519279 X:137436165-137436187 GAGCAGGTTATTCAGTTTCCAGG - Intergenic
1198891261 X:141399642-141399664 GAGCAGGTTATTCAATTTCCCGG + Intergenic
1200567282 Y:4782716-4782738 GAGCATGTTATTCAATTTCCAGG - Intergenic
1201493367 Y:14566991-14567013 GAGCGGGTTGTTCAGTTTCCAGG - Intronic
1201542121 Y:15116639-15116661 GAGCAGGTTGCTCAGTTGCTGGG - Intergenic
1201913837 Y:19160869-19160891 GAGCAAGTTGTTCAGTTTCCAGG - Intergenic
1201961687 Y:19687919-19687941 GAGCAGGTTGTTCAGTTTCCAGG + Intergenic
1201974799 Y:19837378-19837400 GAGCAGGTTGTTCAGTTTCCAGG + Intergenic
1202044510 Y:20725066-20725088 GTGGAGGTTGTCCAGGTTCTTGG + Intergenic
1202106356 Y:21371748-21371770 TAGAAGTTTGTTCAATTTCTTGG - Intergenic
1202201270 Y:22352191-22352213 TAGAAGTTTGTTCAATTTCTTGG + Intronic