ID: 906910921

View in Genome Browser
Species Human (GRCh38)
Location 1:49949410-49949432
Sequence CAGAGTAAACAGAATGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 1, 2: 1, 3: 25, 4: 225}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906910919_906910921 -1 Left 906910919 1:49949388-49949410 CCATGGCAAAAGGAACAGTCAGC 0: 3
1: 9
2: 8
3: 14
4: 175
Right 906910921 1:49949410-49949432 CAGAGTAAACAGAATGCTGTGGG 0: 1
1: 1
2: 1
3: 25
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906910921 Original CRISPR CAGAGTAAACAGAATGCTGT GGG Intronic
901400676 1:9013430-9013452 CAGAGTGAACTGAGTGCTGGTGG - Intronic
903589798 1:24446175-24446197 CAGAGAAAATTGAATGCTTTCGG + Intronic
904922545 1:34020322-34020344 CAGAGTAAACAGACTGGGCTTGG - Intronic
906792927 1:48674477-48674499 GAGAGGCCACAGAATGCTGTAGG + Intronic
906910921 1:49949410-49949432 CAGAGTAAACAGAATGCTGTGGG + Intronic
906929972 1:50159722-50159744 GAGAGTATACAAAATGCTGGAGG - Intronic
907228959 1:52977066-52977088 CAGGGAAAACAAAATGCTTTGGG - Intronic
909679276 1:78273814-78273836 CAGTGAAAACAGAAAGCTATAGG - Intergenic
910382734 1:86645986-86646008 CAGAGTAATCAGAGTACTTTCGG + Intergenic
910576433 1:88770228-88770250 CAGAGTTAAAAGAATGCTGTTGG - Intronic
911274326 1:95842129-95842151 CAGAGTAAACATGATGCTTCAGG - Intergenic
911556129 1:99347162-99347184 CACAGTGAAAAGACTGCTGTGGG - Intergenic
912602539 1:110951722-110951744 CAGGAGAAACAGAATTCTGTTGG + Exonic
915457653 1:156051335-156051357 CAGAGAAAGGAGAATCCTGTTGG + Intronic
917560361 1:176146233-176146255 CAGATTAAACAAAAGGGTGTTGG - Intronic
919737845 1:200964639-200964661 CTGCTTAAACAGAATGCTGTAGG + Intergenic
919743918 1:200996762-200996784 AAGAGAAGACAGAATGGTGTGGG + Intronic
920161775 1:204004140-204004162 CAGAGTGAAAACAATCCTGTGGG + Intergenic
920361920 1:205424587-205424609 AAGAGTGAAAAGAATGCTGCAGG + Intronic
922663032 1:227446962-227446984 AAGAGCAAACAGAAGGCTGGGGG - Intergenic
923339659 1:232996498-232996520 CAGAGTAAACAGCATGGGGTGGG + Intronic
923876562 1:238055683-238055705 CAGAGTAACCAGAATTCTGAAGG - Intergenic
924830163 1:247585623-247585645 TGGAGAAAACAGAATGCTGTTGG + Intergenic
1064306771 10:14174331-14174353 CAGGGTACACAGAGAGCTGTAGG - Intronic
1065282959 10:24158825-24158847 CAGAGTTAGCAGAGTGCTGCTGG + Intronic
1066990546 10:42509305-42509327 AAGGGTACACAGAATCCTGTTGG + Intergenic
1067479945 10:46588113-46588135 CAGAGAAAACACACTGCTATGGG + Intronic
1067614792 10:47753684-47753706 CAGAGAAAACACACTGCTATGGG - Intergenic
1068633152 10:59319211-59319233 CAGATGAAAGAGAAAGCTGTGGG - Intronic
1070603145 10:77879576-77879598 CAGAGTGACAAGAATGGTGTTGG + Intronic
1071290527 10:84185649-84185671 CACAGTGAACACAATGCTGCAGG + Intergenic
1071630197 10:87213647-87213669 CAGAGAAAACACACTGCTATGGG - Intergenic
1071933143 10:90496472-90496494 CAGGGGAAACAGAGAGCTGTGGG + Intergenic
1072868425 10:99089115-99089137 CAGAGTAAACAGCATAGAGTGGG - Intronic
1073960840 10:108925524-108925546 CAGAGAAAGCAGGATGGTGTTGG + Intergenic
1074186902 10:111105628-111105650 AAAAATGAACAGAATGCTGTGGG - Intergenic
1074625592 10:115180905-115180927 CAGAGTCAACAGAATTTAGTAGG - Intronic
1078893101 11:15575135-15575157 CAGAGGAGATAGAGTGCTGTAGG + Intergenic
1079633284 11:22704747-22704769 CAGAATAAACAAAATGCAGTGGG + Intronic
1083105024 11:60349006-60349028 CAGAGTGAAGAGAATGGGGTGGG + Intronic
1085807050 11:79645752-79645774 CAGAGTAATTAGACTACTGTGGG + Intergenic
1085814528 11:79723133-79723155 CTGAGCAAAAAGAATGCTGGAGG + Intergenic
1087242864 11:95799672-95799694 CAGAAAAAACAGTATGCTTTTGG - Intronic
1087449789 11:98305551-98305573 CAGAATAGATAGAAAGCTGTGGG - Intergenic
1090638114 11:128705913-128705935 GACATTACACAGAATGCTGTGGG - Intronic
1092953569 12:13529497-13529519 AAGAGTAAACAGAAGGAAGTGGG - Intergenic
1094325123 12:29229810-29229832 CAGATTAGACAGAATACTGAAGG + Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097303557 12:58043949-58043971 CAGGGGAAACAGTATGTTGTAGG + Intergenic
1097559333 12:61182763-61182785 GACAGTAAATATAATGCTGTAGG - Intergenic
1098741101 12:74174731-74174753 CAAAGTAAACAGTGTTCTGTCGG + Intergenic
1098968996 12:76829080-76829102 CAGAGAAAAAGGAACGCTGTTGG + Intronic
1100180122 12:92076177-92076199 TAGAGGAAGTAGAATGCTGTGGG + Intronic
1100180585 12:92081271-92081293 TAGAGGAAGTAGAATGCTGTGGG - Intronic
1100740948 12:97592128-97592150 CCTGGTAAAAAGAATGCTGTAGG - Intergenic
1100962558 12:99979358-99979380 CAGAGTAAAAGGAAAACTGTGGG + Intronic
1101236451 12:102794748-102794770 CAGAGCAAACAGAGTTATGTGGG - Intergenic
1103858979 12:123996668-123996690 CAGAGTGGACAGAATGTCGTTGG + Intronic
1106334118 13:28767032-28767054 GAGGGTAAACAGAATTCTGGGGG + Intergenic
1106354941 13:28972468-28972490 CAGAATAAACAGTATGCATTTGG + Intronic
1108909357 13:55524297-55524319 CAGAGTAAAGAGAAAGTAGTGGG - Intergenic
1109103272 13:58213916-58213938 CAAAGTAAAAAGTATGATGTGGG + Intergenic
1109200633 13:59426951-59426973 CAAAGTAAATTGGATGCTGTGGG - Intergenic
1109796216 13:67316760-67316782 CAGATTTATGAGAATGCTGTAGG + Intergenic
1110468248 13:75827710-75827732 CAGAAAAAACAGAAACCTGTAGG - Intronic
1110715590 13:78700035-78700057 GAGAATAAAAAGAATTCTGTTGG + Intergenic
1112966173 13:105197270-105197292 CAGAGTAAATACCATGCTCTTGG - Intergenic
1113448489 13:110388510-110388532 CAGAGCAAGATGAATGCTGTTGG + Intronic
1114152573 14:20060769-20060791 CAGAGTGACCACAATGATGTGGG - Exonic
1114544266 14:23487007-23487029 CTGAGCAAACAGCATGCTGTGGG + Intronic
1114926818 14:27412431-27412453 TATAGTAATCAGTATGCTGTTGG + Intergenic
1115179516 14:30606464-30606486 CAGAGTAAAAATGATGCTTTAGG - Intronic
1115243000 14:31267837-31267859 GAGAGGAAAAAGAATACTGTGGG - Intergenic
1116044830 14:39731995-39732017 CCGAGTAGCCAGGATGCTGTAGG + Intergenic
1116469283 14:45268541-45268563 CAGACTATACAGTATGCTCTAGG - Intergenic
1118600314 14:67467433-67467455 CAGGGCAAAAAGAAGGCTGTGGG + Intronic
1118973336 14:70655654-70655676 CAGAGTGAGCAGCATCCTGTGGG - Intronic
1119783588 14:77296024-77296046 CAGAGAAAACAGAAGGGTGCAGG + Intronic
1120459973 14:84782483-84782505 CAGATTGAACATATTGCTGTTGG + Intergenic
1122431542 14:101651630-101651652 CATGGTAAACAGCATGCAGTTGG - Intergenic
1123022636 14:105408811-105408833 CTGAGTAGACAGAATGCTGGTGG - Intronic
1126043021 15:44610899-44610921 CAGTGTAAGCAGTATGCTATTGG - Exonic
1127800705 15:62474898-62474920 CAGAGTAACTAGAATGCTAATGG + Intronic
1128628770 15:69241225-69241247 CAGTGTATACAGAGTTCTGTAGG + Intronic
1128668860 15:69559269-69559291 CAGCGCAAAGAGAAGGCTGTGGG - Intergenic
1129256269 15:74335815-74335837 CAGAGTATCCAGAATCCAGTGGG - Intronic
1131326320 15:91450303-91450325 CAGAATAAACCAAATGCTTTTGG + Intergenic
1131368857 15:91863051-91863073 CAGAGTAAACATAAGACTTTAGG - Intronic
1132109229 15:99090097-99090119 AAGAGGAAAGAGAATGCTGAGGG - Intergenic
1133444703 16:5850063-5850085 CAGAGTAAACAGAATCACCTGGG - Intergenic
1133835141 16:9361210-9361232 GAGAGAAACCAGAATGCTGTAGG + Intergenic
1134011023 16:10853216-10853238 CAGAGTGAATAGAATGAAGTAGG + Intergenic
1134299649 16:12978245-12978267 CAGAATAAACAGTAAGCTGTTGG - Intronic
1137247746 16:46719376-46719398 CGGAGGAAACAGAATCCTGGAGG + Intronic
1137372873 16:47924996-47925018 CATAGTAGACAGAAGGCTGAAGG - Intergenic
1137706592 16:50539794-50539816 CAGAAGAAACAAAATGATGTGGG + Intergenic
1137998659 16:53249766-53249788 TAGAGAAAACATAATGCTGCAGG + Intronic
1138980527 16:62262504-62262526 AAGTGTAAAAAGAAAGCTGTTGG + Intergenic
1140546966 16:75819996-75820018 CTGATTAAACTGAATGCTGATGG + Intergenic
1140987082 16:80168293-80168315 CAGTGTGATCACAATGCTGTGGG - Intergenic
1144961543 17:19046967-19046989 CAGAGGAAGCAGGAAGCTGTCGG - Exonic
1144973617 17:19127557-19127579 CAGAGGAAGCAGGAAGCTGTCGG + Exonic
1146478003 17:33178621-33178643 CAGAGAAAACAGTGTGCAGTGGG + Intronic
1146811193 17:35904966-35904988 CAGAGGAAAGAGAATGAAGTGGG - Intergenic
1147552600 17:41454859-41454881 CAGAGGAAACAGAATGTGCTAGG - Intergenic
1149089944 17:52765550-52765572 CAGAGAAAAAAAAATGCTGATGG + Intergenic
1150168703 17:62968544-62968566 GAGAATAAAGAGAATTCTGTTGG + Intergenic
1151104011 17:71591026-71591048 CAGAATAAACAGAATGCTCCAGG + Intergenic
1153541635 18:6161761-6161783 CAGAGTGAGCAGAATGCAGTGGG - Intronic
1154067930 18:11126539-11126561 CAGAGTAAAAAAATTGCTGATGG - Intronic
1154251695 18:12750267-12750289 CAGAGTCAACAGCCTGCTCTGGG + Intergenic
1154330922 18:13428501-13428523 CTGAGTAAAATGAAAGCTGTTGG + Intronic
1156593392 18:38517762-38517784 CAGACTTAACAGAAAGCAGTAGG - Intergenic
1157076245 18:44470925-44470947 CAGAGTAAAGAAAATGCCTTGGG + Intergenic
1157448224 18:47764332-47764354 CAGAGAAAACAGAATGCTGTTGG + Intergenic
1158058176 18:53306614-53306636 CAGAGTAATCAGTAAGCTGTTGG - Intronic
1158194747 18:54872178-54872200 CAGAGAACACATAAAGCTGTCGG - Intronic
1158646706 18:59254889-59254911 CAGAGCCAACAGACTGCAGTTGG + Intergenic
1160262542 18:77308349-77308371 AAGAGAACACAGAATGCTGTAGG + Intergenic
1164927353 19:32140635-32140657 CAGAGTAAACAGCAGGTTCTGGG + Intergenic
1168355389 19:55696803-55696825 CAGAGCAAAAGGAGTGCTGTTGG + Intronic
926252471 2:11163286-11163308 CAGAATACACAGAATGAGGTGGG + Intronic
927279154 2:21288478-21288500 CAGAGTGAACAAAGGGCTGTAGG + Intergenic
934059721 2:88282998-88283020 CAGAGCACACAGAATGAGGTGGG - Intergenic
935087583 2:99863280-99863302 CAGAGTAAAAGTAATGCTTTTGG + Intronic
936856117 2:116959177-116959199 GAGAGTATACAAAATGTTGTGGG - Intergenic
937071959 2:119070988-119071010 CAGAAAAAACAGAATGTTCTAGG + Intergenic
937645566 2:124262638-124262660 AAAAAAAAACAGAATGCTGTTGG - Intronic
938996063 2:136679598-136679620 CAGAGTAAACAGAAGACTTTTGG + Intergenic
941184743 2:162308088-162308110 CAGCATAAACAGACTACTGTAGG - Intronic
941415306 2:165213322-165213344 AAGACTAAACAGAGTGCTGCTGG - Intergenic
941434651 2:165454213-165454235 CAGAGTAAACAAATTGGTCTTGG - Intergenic
941982655 2:171476211-171476233 CAATGTAAACAGATTTCTGTGGG + Intronic
942239158 2:173943105-173943127 CAGAGTAAGCATAAGGCTGATGG - Intronic
943037580 2:182766100-182766122 AAGGGGAAAGAGAATGCTGTTGG + Intronic
943072770 2:183161165-183161187 CAGAGTTAGCAGAGTGCTGCTGG + Exonic
944956493 2:204817454-204817476 CAGAGTACACAGAAGGGTATTGG - Intronic
1168815311 20:732741-732763 CAGAGAAAACACACTGTTGTGGG + Intergenic
1172823340 20:37758514-37758536 CAGTGGAAACAGAATTGTGTTGG - Intronic
1173683628 20:44907139-44907161 CATAGTGAACATATTGCTGTAGG - Exonic
1175533719 20:59692552-59692574 CAGAGTACAGAGAATGGTATTGG - Intronic
1177258521 21:18697152-18697174 GAGAGCAAACTGAATGCAGTAGG + Intergenic
1177651871 21:23968381-23968403 CAGAGCCAACAGCATTCTGTTGG + Intergenic
949295468 3:2517142-2517164 CAGAGAAAAAGGAGTGCTGTTGG + Intronic
949817056 3:8069739-8069761 CAGAGTAAGAAGAATGCATTGGG - Intergenic
950552376 3:13674604-13674626 CAGAGGATGCAGAGTGCTGTGGG + Intergenic
951695577 3:25442654-25442676 AAATGTAAACAGAATGCTGTAGG + Intronic
953439674 3:42906651-42906673 CAGAGCGCACAGAGTGCTGTCGG + Intronic
955691411 3:61594190-61594212 CGGACTAATCAGAATGCTGTGGG + Intronic
961133319 3:124488616-124488638 CAGACTAACAAGACTGCTGTAGG - Intronic
961231779 3:125319278-125319300 CAGAGTAAACAGTTTTCGGTCGG + Intronic
961969747 3:130948767-130948789 CAAAGTAAGCACCATGCTGTTGG - Intronic
962200023 3:133393270-133393292 AAGAGGAAACAGAATGAGGTTGG - Intronic
962857514 3:139361351-139361373 CACAGTTAACAGAATAATGTTGG - Intronic
964132033 3:153300195-153300217 CAGAGGAAAAGGAATTCTGTAGG + Intergenic
966773792 3:183526448-183526470 CAGAGTCAACAGAAATCAGTGGG + Intronic
969976880 4:11112086-11112108 CAGAGGAAACAGATGGCTGTTGG - Intergenic
974900962 4:67997598-67997620 CAGAGTAAAAGGAATACAGTTGG + Intergenic
977027750 4:91841963-91841985 CAGAGTAAACAGACAACTGACGG + Intergenic
977440645 4:97062810-97062832 AAAAGTAAATACAATGCTGTTGG + Intergenic
978220114 4:106261709-106261731 TAGAGAAAACACAATGCAGTTGG + Intronic
981148138 4:141349811-141349833 CAGAGAGAACTGATTGCTGTGGG - Intergenic
981177277 4:141696369-141696391 CAGAGCAAAAAGAATATTGTAGG - Intronic
981898072 4:149828263-149828285 AAGAGTAAACAGAAGGCAGATGG - Intergenic
982467199 4:155745803-155745825 CAGATTAATCAGAGTGCTGATGG + Intergenic
983441011 4:167784868-167784890 CAGAATCAACAGAATTCTGACGG + Intergenic
985096216 4:186415485-186415507 CAAAATAAACAGGATGCTTTAGG + Intergenic
985485831 5:147949-147971 CAGTGTAAACAGAATGAAGGGGG + Intronic
986636854 5:9831153-9831175 CAGGGGAAACAGATTGCAGTTGG + Intergenic
987473219 5:18357821-18357843 CAGAGTTAGGAGAATGCTGTTGG - Intergenic
988166552 5:27597380-27597402 CAGATTGACCAGAAAGCTGTGGG + Intergenic
989597217 5:43167783-43167805 CAAAGTAAGCAGAATCCTGTGGG + Intronic
990199563 5:53356146-53356168 CAAAGTTAACAGAAGACTGTGGG - Intergenic
990258784 5:53999116-53999138 GAGAATAAAGAGAAGGCTGTAGG + Intronic
991082642 5:62617889-62617911 CAGTTTATACAGAAGGCTGTGGG - Intronic
991289713 5:65021591-65021613 CAGAGGATACAGAGTGCTGAGGG - Intergenic
992409847 5:76494519-76494541 AAGAGGCAACAGAATGCTGAGGG - Intronic
992627925 5:78650754-78650776 CAGAGAACACAGGGTGCTGTAGG - Intronic
992998266 5:82354021-82354043 CAGAGTAAAGAAAATGCAGAAGG - Intronic
993090512 5:83420644-83420666 CAGAGGAAGCAGAGGGCTGTGGG + Intergenic
994728102 5:103460339-103460361 TAGAGTAAACAAAATTCTCTTGG - Intergenic
995333205 5:110968788-110968810 GAGGATGAACAGAATGCTGTTGG + Intergenic
995806909 5:116063557-116063579 CAGAGTAAAGAGCATGCTGAAGG + Intergenic
996382898 5:122880075-122880097 CAAAGTAAACAGAAGGTTGGAGG - Intronic
996627847 5:125591099-125591121 CAGATCACACAGAATGCTCTAGG - Intergenic
996732324 5:126728006-126728028 CAGAGGAAATAGAATGCATTAGG - Intergenic
997193163 5:131959070-131959092 AGGAGGAAACAGAATGCTTTGGG - Intronic
997707340 5:135969083-135969105 CACAGTAAACTGAATGCTACAGG + Intergenic
998964746 5:147527097-147527119 CAAAGGAAACAGAAAGCAGTAGG - Intergenic
1000820705 5:165979666-165979688 CATAGTATACACATTGCTGTAGG + Intergenic
1000963083 5:167623513-167623535 CAGGCTAAACAAAATCCTGTTGG - Intronic
1006751527 6:36380903-36380925 GAGAGTAAAAGGGATGCTGTGGG - Intronic
1007328494 6:41083240-41083262 ATGAGTAAACAGACTACTGTAGG - Intronic
1007893379 6:45318487-45318509 AAGAGTAAACTGAGAGCTGTTGG + Intronic
1008408705 6:51148010-51148032 CAGAGGAAAAAGAGTGCTCTTGG + Intergenic
1008798589 6:55338719-55338741 CAGAAGAAACAGAATGAAGTGGG + Intronic
1010699705 6:79028573-79028595 CTGAGTAAAAAAAATGCTTTAGG + Intronic
1010993783 6:82509952-82509974 CAAGGTCAACAGAAGGCTGTGGG - Intergenic
1012948752 6:105495491-105495513 CAGAATAAACAGAATGTATTGGG - Intergenic
1013661036 6:112297277-112297299 CAGTGTAAAATGAATGGTGTTGG + Intergenic
1014194356 6:118535597-118535619 GAGAGGAAACAAAATGGTGTGGG - Intronic
1014321697 6:119937613-119937635 CAGAGAAAAGGGAATGCTGGTGG - Intergenic
1015363007 6:132362712-132362734 CAGCTTAAACAGAAAGCTTTTGG + Intronic
1015524498 6:134162826-134162848 AAGAGTGAGCAGAATGGTGTTGG + Intergenic
1016133210 6:140503231-140503253 CAGAGTAAATAGAAAGAGGTGGG + Intergenic
1016430233 6:143976130-143976152 CAGAGTGTACAGAATACTGTGGG + Intronic
1018761841 6:166900074-166900096 CAGAGTAAATAGAACGCAATGGG + Intronic
1018761950 6:166900760-166900782 AAGAGTAAAGAGAATGCCTTGGG + Intronic
1018762078 6:166901519-166901541 CACAGTAAAGAGAAGGCCGTGGG + Intronic
1018762187 6:166902311-166902333 CAGAGTAAAGAGACCGCCGTGGG + Intronic
1021272152 7:18603122-18603144 CACACTAAACAGAAGGATGTTGG - Intronic
1021717508 7:23473433-23473455 AAGAGTAAACAGACTGCAATTGG - Intergenic
1026463257 7:70632806-70632828 CCGAGCAAACAGACTTCTGTGGG + Intronic
1026632600 7:72050350-72050372 GATAATATACAGAATGCTGTAGG + Intronic
1030892340 7:115014256-115014278 CAGAGTTAAGAGACTGCCGTAGG + Intronic
1031573434 7:123386673-123386695 CAGAGGAAACAGACTGAAGTAGG - Intergenic
1033288060 7:140059552-140059574 CAGAGTCAAACAAATGCTGTTGG - Intronic
1033449148 7:141447537-141447559 CAGAGCAAGCAGAATGCGGATGG - Intronic
1033601702 7:142893306-142893328 CAGAGTAAACAGCATTATTTGGG + Intergenic
1033810979 7:145010717-145010739 CAGAGTAACCAGAATAATCTTGG - Intergenic
1033849082 7:145472466-145472488 CTGAGTAGACAGAAGACTGTGGG - Intergenic
1033943157 7:146681077-146681099 CAGTGTCAACAGAGTGCTATGGG + Intronic
1034686662 7:152977859-152977881 CACATTAAACAGAACGCTATTGG - Intergenic
1036059697 8:5302121-5302143 CAGAGTAAGAAGAATGCCTTGGG + Intergenic
1036437648 8:8749824-8749846 TAGACAAAGCAGAATGCTGTGGG - Intergenic
1038959857 8:32506927-32506949 AAGAATAGATAGAATGCTGTAGG - Intronic
1040483740 8:47851115-47851137 CAGAGTAAACATAAAGAAGTTGG - Intronic
1042293326 8:67192772-67192794 CGGAGTTAACAAAATGCAGTGGG - Intronic
1043294761 8:78648900-78648922 AAGAGGAGAGAGAATGCTGTTGG - Intergenic
1043764418 8:84111717-84111739 CAGAGAAAAGGGAATGCTTTGGG - Intergenic
1044355148 8:91213775-91213797 GAAAGTAAACAGAATGTTTTAGG + Intronic
1044609767 8:94080133-94080155 CAGAGAAGCCAGAATGGTGTTGG + Intergenic
1045101380 8:98847984-98848006 CTGAATAAACAGCATGCTGAAGG - Intronic
1050020432 9:1278972-1278994 CAGAGAAAAGAGAAAGCTTTGGG - Intergenic
1051010863 9:12412200-12412222 CAGAGTAAAGAGACAGCTATAGG + Intergenic
1052795948 9:32923635-32923657 CAAATCAAACAGAATGATGTTGG + Intergenic
1056620358 9:88207288-88207310 AGAAGTAAACAGAAGGCTGTGGG + Intergenic
1058781818 9:108344890-108344912 CTGAATAAACATAATGGTGTGGG - Intergenic
1186944266 X:14547721-14547743 CAGAGTAGAGAGTAAGCTGTTGG - Intronic
1187303292 X:18072601-18072623 CAAAGTAAAGATAATGCTGCTGG + Intergenic
1188550379 X:31357880-31357902 GAGAGAAGACAGAATGTTGTAGG - Intronic
1190415690 X:50178418-50178440 CAGAATCATCAGAGTGCTGTTGG - Intergenic
1192754518 X:74033293-74033315 CAAAGTCAACACAATGCTGCTGG - Intergenic
1193357521 X:80538703-80538725 CAAAGAAAAAGGAATGCTGTTGG + Intergenic
1193467015 X:81861817-81861839 TAGAGAAAAGAGAATGCTGATGG + Intergenic
1195235556 X:102894017-102894039 CAGAGTAAGAGGAATGCTGAGGG + Intergenic
1195677715 X:107520035-107520057 GAGTGTAAACAGACTGCTATGGG + Intergenic
1198602173 X:138295756-138295778 TAGAGATAACAAAATGCTGTAGG + Intergenic
1199528036 X:148814042-148814064 AAGAGTAAACAGCATGCTGACGG - Intronic
1199810852 X:151347085-151347107 AGGAGTAAACAGTGTGCTGTGGG - Intergenic
1202596856 Y:26549089-26549111 CAGAGAAAAAGAAATGCTGTTGG + Intergenic