ID: 906911030

View in Genome Browser
Species Human (GRCh38)
Location 1:49950981-49951003
Sequence CATAGAAAGACAAATACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 574
Summary {0: 2, 1: 14, 2: 41, 3: 103, 4: 414}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906911027_906911030 12 Left 906911027 1:49950946-49950968 CCTAGAGGACATTATGATAAATG 0: 1
1: 25
2: 367
3: 1529
4: 3178
Right 906911030 1:49950981-49951003 CATAGAAAGACAAATACTGCAGG 0: 2
1: 14
2: 41
3: 103
4: 414

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906911030 Original CRISPR CATAGAAAGACAAATACTGC AGG Intronic
900676900 1:3892696-3892718 CAGAGAAAGACACACTCTGCAGG - Intronic
901107029 1:6764371-6764393 TATATAAGGATAAATACTGCTGG - Intergenic
901502199 1:9659619-9659641 AATAAAAAGACAAATACTGTAGG - Intronic
901517302 1:9757072-9757094 CATTAAAAGAAAAATCCTGCCGG - Intronic
906911030 1:49950981-49951003 CATAGAAAGACAAATACTGCAGG + Intronic
909524616 1:76608666-76608688 TATAAAAAGACAAACACTGAAGG - Intronic
909931012 1:81500545-81500567 AATCAAAGGACAAATACTGCAGG + Intronic
910018475 1:82555814-82555836 ACTAGAAGAACAAATACTGCTGG + Intergenic
910166241 1:84330169-84330191 CCTAGAAAGGCAAATTCTCCAGG - Intronic
910411048 1:86944974-86944996 CATAGAAAGTAGAATACAGCAGG - Intronic
911119288 1:94279218-94279240 CACAGAAATACTAATGCTGCTGG - Intergenic
911255562 1:95629191-95629213 CACAGAAAGACAAATATCACAGG - Intergenic
911313362 1:96325164-96325186 TACAGAAAGACAAATACTGCAGG + Intergenic
911908941 1:103606835-103606857 CAGAGAATGAAAAATACTACAGG + Intergenic
911911257 1:103639131-103639153 CAGAGAAAGAAAAATACTACAGG + Intergenic
911913978 1:103672626-103672648 CAGAGAATGAAAAATACTACAGG - Intronic
911917197 1:103712819-103712841 CAGAGAAAGAAAAATACTACAGG - Intronic
911918672 1:103733269-103733291 CAGAGAAAGAAAAATACTACAGG + Intronic
911921787 1:103772317-103772339 CAGAGAAAGAAAAATACTACAGG + Intergenic
913648676 1:120888065-120888087 CTCAGAAAGACAAACACTGAAGG + Intergenic
914527581 1:148484969-148484991 CTCAGAAAGACAAAGACTGAAGG - Intergenic
914906275 1:151748160-151748182 CACAGAAAGAAAAATCCTCCAGG - Intergenic
915155093 1:153868994-153869016 CATACAAAGACAATTCTTGCTGG + Intronic
915640273 1:157219312-157219334 CCTGGTAAGACAAAGACTGCTGG - Intergenic
916249091 1:162718907-162718929 TATATAAAAACAAACACTGCAGG + Intronic
916277544 1:163011389-163011411 CACAGAAAGACAAATATTATAGG - Intergenic
916716914 1:167454626-167454648 CACAGAAAACCAACTACTGCTGG + Intronic
916927468 1:169538230-169538252 CACAGAAAGACAAGTACTGCAGG + Intronic
917171778 1:172184640-172184662 CTTTAAAAGACAAATACTTCTGG + Intronic
917312857 1:173694806-173694828 TATGGAAAACCAAATACTGCAGG - Intergenic
918027762 1:180769527-180769549 CACAGAAACACAAACATTGCAGG - Intronic
918944393 1:191043150-191043172 CACCGAAAGACAAATACTGTAGG + Intergenic
919067002 1:192704901-192704923 CACAGAAAGACAAATGTTACAGG - Intergenic
921498308 1:215868154-215868176 CATATTGAGACAAATACTGTGGG - Intronic
921724184 1:218506338-218506360 AACAGAAAATCAAATACTGCAGG - Intergenic
922133796 1:222805622-222805644 CATAGAGAGACAGAAGCTGCAGG + Intergenic
924320643 1:242845240-242845262 AACAGAAAAACAAATACTGTAGG - Intergenic
924702305 1:246466425-246466447 AAAAGAAAACCAAATACTGCAGG + Intronic
924833336 1:247621790-247621812 CACAGAGAGACAAATACCACAGG - Intergenic
1063215555 10:3922505-3922527 CATATAAAAACAAAAACTGCAGG - Intergenic
1063519937 10:6732141-6732163 CACAGAAAGACAAATACCACAGG - Intergenic
1064143523 10:12809632-12809654 CATAGAAAGACATATAATGCAGG + Intronic
1064808550 10:19166324-19166346 CACAGAGAGACAAATATGGCAGG + Intronic
1065377019 10:25053528-25053550 CACAGAAAGACAAATAGGGCAGG - Intronic
1067252582 10:44600363-44600385 CATAGAAAGATACATATTGAAGG + Intergenic
1067687202 10:48473236-48473258 CACAAAAAGACAAATACTACAGG + Intronic
1068182703 10:53543116-53543138 CACAGAAAGACAAATACCACAGG - Intergenic
1068306957 10:55223953-55223975 CATAAATAAACAAATACAGCTGG + Intronic
1068365272 10:56040800-56040822 CATAGCAAGATATAAACTGCTGG - Intergenic
1069052104 10:63806027-63806049 CACAGAAAGACAAACATTGCAGG - Intergenic
1069357584 10:67605265-67605287 CATAGAAAGAAAACTATTGCAGG + Intronic
1069559885 10:69422026-69422048 CATAGATGGACAGATTCTGCTGG - Intergenic
1070406511 10:76102477-76102499 AACAGAAAGCCAAATACTGCAGG - Intronic
1072333950 10:94380788-94380810 CACAGAAAGACAAATACAAAGGG - Intergenic
1072940345 10:99758201-99758223 AACAGAAAGACAAATAGTGATGG - Intergenic
1074733788 10:116406460-116406482 AAGAGAAAGAGAAATAATGCTGG - Intergenic
1075168768 10:120093621-120093643 CAGAAAAAGACAAATACTGCAGG - Intergenic
1075321524 10:121495033-121495055 TCTCGAAAGACAAAAACTGCTGG - Intronic
1076299888 10:129417477-129417499 CTTTGAAAGACAAAAATTGCAGG - Intergenic
1076436471 10:130448201-130448223 CAGAGAGAGAAAAATACTTCAGG - Intergenic
1077761854 11:5109765-5109787 CATGCAAAGACAAATACTGCAGG + Intergenic
1077792351 11:5454621-5454643 CTTAGAAAGATAAATATTGGGGG + Intronic
1077939158 11:6821648-6821670 TACAGAAAGGCAAATACTACAGG + Intergenic
1078694056 11:13611726-13611748 CATAGAAAATCACATACGGCTGG - Intergenic
1078887675 11:15521020-15521042 CACAGAAAGACAAATACCATGGG - Intergenic
1079088784 11:17466103-17466125 CATAAAAAGACAAATAGGCCAGG + Intronic
1079604020 11:22343242-22343264 CATAGAAAGCCAAATTCAACTGG + Exonic
1079980623 11:27148057-27148079 AATGGAAAGACAAAAACAGCAGG + Intergenic
1080581193 11:33645441-33645463 CATAGATTGACCAATGCTGCAGG - Intronic
1080945848 11:36973628-36973650 CATAGAAAGAAAAATTATGAAGG - Intergenic
1082131353 11:48493344-48493366 CACAGAAAGGCAAATATTGCAGG + Intergenic
1082564849 11:54664218-54664240 CACAGAAAGGCAAATATTGCAGG + Intergenic
1082850717 11:57761962-57761984 CTGAGAAAGACAAATCCAGCAGG - Exonic
1082898871 11:58223988-58224010 CACAGAAAGACAAATACTGCAGG + Intergenic
1082950521 11:58810231-58810253 CTCAGAAAGACAAATGCTTCAGG - Intergenic
1083528216 11:63392416-63392438 CCTAGAAAAACAAATACTGAGGG - Intronic
1083550398 11:63584946-63584968 CTTACAAAGAAAAATACTGGTGG + Intronic
1084418225 11:69046617-69046639 CACAAAAGAACAAATACTGCAGG + Intergenic
1084676057 11:70635459-70635481 CACAAAAAGATAAATACTGCAGG + Intronic
1084686172 11:70697009-70697031 CACAGAAAGATGAATACTTCGGG + Intronic
1085560663 11:77470688-77470710 CAGAGAAAGACAAAAACCACAGG + Intronic
1086633306 11:89050853-89050875 GACAGAAAACCAAATACTGCAGG + Intronic
1087785925 11:102354126-102354148 CAGAGAAAGACAAATACAACTGG - Intronic
1088003975 11:104918488-104918510 CATAAAAACACAAATTCTGAAGG + Intergenic
1088601651 11:111484157-111484179 CATAGAAAAACAAAAGCTGAGGG + Intronic
1088770662 11:113032560-113032582 CATAGGAAAAGAAATTCTGCAGG - Intronic
1089877110 11:121734815-121734837 AAAAAAAAGACAAATACTGTAGG - Intergenic
1089939957 11:122405830-122405852 CATAGAAACACATATTTTGCTGG + Intergenic
1091012333 11:132014137-132014159 CACAGAAAGACAAATATCACAGG - Intronic
1092567394 12:9682610-9682632 AACAGAAAACCAAATACTGCAGG - Intronic
1093510918 12:19927272-19927294 CATAGAAGGACAAATACTGCAGG - Intergenic
1093821974 12:23631498-23631520 CATAGAATTACATCTACTGCTGG + Intronic
1094616464 12:32040773-32040795 CAGGGAAGGACACATACTGCAGG + Intergenic
1095195227 12:39306823-39306845 CAGAGCAAGACAAATGTTGCTGG - Intronic
1095242075 12:39872770-39872792 CAAAGAAAACAAAATACTGCTGG + Intronic
1095502196 12:42852294-42852316 CACAGAAAGACAAATACCACAGG + Intergenic
1097509084 12:60513731-60513753 CACAGAAAGACAAAGATTGCAGG + Intergenic
1097523699 12:60702531-60702553 CACAAAAAGACAAATACAGAAGG - Intergenic
1097596526 12:61639481-61639503 AGCAGAAAGTCAAATACTGCAGG - Intergenic
1097624921 12:61988444-61988466 TATAGAAAGACAAACTCTGCTGG + Intronic
1098066076 12:66617735-66617757 CACAGAAAAAGAAATACTACTGG + Intronic
1098194020 12:67980361-67980383 CACAGAAAGACAAATATTATAGG + Intergenic
1098513275 12:71344109-71344131 AATATTAAGACAAATACTGAGGG + Intronic
1099942040 12:89200036-89200058 CATATAAAAACAAATGCGGCTGG - Intergenic
1100252486 12:92842084-92842106 CACAAAAAGACAAATACTGTTGG + Intronic
1100402165 12:94241605-94241627 CACAGAAAGACAAATATTGCAGG - Intronic
1100566969 12:95805833-95805855 GATAGAAAGACAAATATCCCTGG - Intronic
1101044954 12:100795189-100795211 GATAAAAAGACAAACACTCCAGG - Intronic
1102450770 12:113040466-113040488 CACAAAAAGAAAAACACTGCAGG - Intergenic
1103995296 12:124825789-124825811 GACAGAAGGACAAATACTGCAGG + Intronic
1104062356 12:125279259-125279281 CATAGAAAAATAAATGCAGCAGG + Intronic
1104114405 12:125735444-125735466 AAAAGAATGACAAAGACTGCTGG + Intergenic
1104451627 12:128873753-128873775 CATAGAAAAAGAAATACAACTGG - Intronic
1104502393 12:129298724-129298746 CACAGAAAGACAAATACCGCAGG - Intronic
1105377301 13:19857555-19857577 AATAGCAAGAGAATTACTGCAGG + Intronic
1105390854 13:19976654-19976676 CACAAAAAGACAAATACTGCAGG - Intronic
1106237760 13:27879192-27879214 CACAAAAAGACAAACACCGCTGG + Intergenic
1106755469 13:32818956-32818978 CCCAGAAAGACAAATATTGCAGG + Intergenic
1107155770 13:37165492-37165514 AATGGAAAGTCAAATACCGCAGG - Intergenic
1107275014 13:38668239-38668261 CATAGAAAGACAAATCCTGCAGG + Intergenic
1107284605 13:38776886-38776908 CATAGAAAAAAAATGACTGCAGG - Intronic
1108023529 13:46154319-46154341 CACAGAAATACACTTACTGCTGG + Intronic
1108419091 13:50230414-50230436 CATAAAAAGATAAAAACTGTAGG + Intronic
1108542657 13:51458133-51458155 AAGAGAAAACCAAATACTGCTGG + Intergenic
1108962549 13:56253401-56253423 CAAAAAAATACAAAAACTGCAGG - Intergenic
1109335989 13:60994386-60994408 CACAGTAAGACAAATACTGCAGG - Intergenic
1109367577 13:61376523-61376545 AGTAGCATGACAAATACTGCAGG + Intergenic
1109510540 13:63367115-63367137 CATAGAAAGACAAATATCACAGG + Intergenic
1109807634 13:67465228-67465250 CACAGAGAGACAAATACTGGAGG - Intergenic
1110504236 13:76266560-76266582 AATAAAAAGAGAAATACTGATGG + Intergenic
1110538640 13:76682227-76682249 CACTGAAGGGCAAATACTGCAGG - Intergenic
1110547454 13:76771490-76771512 CACAAAAAGATAAATACTACAGG + Intergenic
1111152300 13:84270738-84270760 CACAAATAGACAAATACTGTAGG - Intergenic
1111896676 13:94150578-94150600 CAGAGAAAGAAAAATGTTGCAGG - Intronic
1113845950 13:113391682-113391704 CACAGAAGGACAAATTCTGTGGG - Intergenic
1114615697 14:24067157-24067179 CTGAGAAGGACTAATACTGCAGG - Intronic
1114922307 14:27347986-27348008 AACAGAAAACCAAATACTGCAGG - Intergenic
1115321381 14:32082882-32082904 AAGAGATAGACAAATACTACAGG - Intronic
1115655524 14:35439821-35439843 CATGGAAAGGAAAATCCTGCTGG - Intergenic
1115734068 14:36304798-36304820 CATAGAAAAACAAATATTTATGG - Intronic
1116096443 14:40376464-40376486 CACAGAAAGAGAAATACTGTTGG - Intergenic
1116405259 14:44558657-44558679 ATTAAAAAAACAAATACTGCTGG - Intergenic
1116780586 14:49233082-49233104 AACAGAAAGCCAAATACTCCAGG - Intergenic
1118324711 14:64773181-64773203 TAGAGAAAGACAAAAACAGCAGG + Intronic
1120578707 14:86218268-86218290 CATAGAAATGAAAATCCTGCAGG - Intergenic
1120603733 14:86545366-86545388 AATAGTCAGATAAATACTGCTGG - Intergenic
1121487929 14:94332859-94332881 GTCAGAAAGACAAATACTTCAGG - Intergenic
1122005729 14:98702004-98702026 AACAGAAAGTCAAATACTGCAGG - Intergenic
1122149416 14:99716934-99716956 GACAGAGAGACAAATACTGATGG + Intronic
1122546469 14:102525446-102525468 CACAAAAAGACAAATACTGTAGG + Intergenic
1122576055 14:102742919-102742941 CACACAGAGAAAAATACTGCGGG - Intergenic
1123880073 15:24670499-24670521 CCTAGAAAGAAATATAATGCAGG + Intergenic
1124057885 15:26259399-26259421 CACAGAAAGACAAATACTGCAGG + Intergenic
1125868153 15:43074193-43074215 CATAGAATCACAAATACAGAAGG - Intronic
1125874422 15:43131669-43131691 CGTAGAAAGAAAAATAAGGCCGG + Intronic
1125901137 15:43348921-43348943 AAAAGAAACACAAATACTCCTGG + Exonic
1126288310 15:47042163-47042185 CACAGGATGACAAATGCTGCAGG - Intergenic
1126346807 15:47704284-47704306 CATAGAAAGACATCCACTGTAGG - Intronic
1127246875 15:57186629-57186651 CAAAGTAAGACAAATATTACAGG + Intronic
1131029213 15:89172365-89172387 CACAAAAGGACAAATACTGTAGG - Intronic
1131273771 15:90963327-90963349 CATAAAAAGACAAATACTATGGG - Intergenic
1131504292 15:93002403-93002425 CATAAAAAGACAATTATTCCAGG - Intronic
1131531467 15:93196553-93196575 CAAATAAAGACAAATGCTGGTGG + Intergenic
1132127404 15:99240211-99240233 CCCAGAATAACAAATACTGCAGG - Intronic
1132145807 15:99429075-99429097 CACAGAAAGACAAATACCGCAGG + Intergenic
1132370263 15:101292342-101292364 CACAGAAATACAAATAATTCTGG + Intronic
1133881730 16:9788653-9788675 GAAAGAAAGACAAATAGTGTGGG - Intronic
1134391224 16:13821941-13821963 AATAGAAAGGAAAATAATGCTGG - Intergenic
1134448947 16:14351773-14351795 CACAGAAAGACAAATACCGCAGG - Intergenic
1135812050 16:25596630-25596652 TATAGAAAGCCAGGTACTGCTGG - Intergenic
1137684577 16:50377350-50377372 CACAGAAAGAGAAATACTGCAGG - Intergenic
1138918243 16:61494539-61494561 AACAGAAAAGCAAATACTGCAGG - Intergenic
1139698827 16:68694755-68694777 CATTGAAAGACAACATCTGCTGG + Intronic
1140646319 16:77034787-77034809 CACAGAAAGACAAACTTTGCAGG - Intergenic
1141203785 16:81917137-81917159 CACAGAAAAACAAATACCACAGG - Intronic
1141299815 16:82803721-82803743 CACAGAAGGACAGAAACTGCAGG + Intronic
1141908790 16:87044672-87044694 CTTAGAAAGAAAAAGGCTGCTGG - Intergenic
1142909572 17:3076546-3076568 CAAAGAAAGACAAAAACTGCAGG - Intergenic
1142924926 17:3227268-3227290 CAAAGAAAGACAAAAACTGCAGG + Intergenic
1143790358 17:9290237-9290259 TTTAAAAAGACAAATAGTGCAGG - Intronic
1144433136 17:15213557-15213579 CACTGCAAGACAAATACTGTGGG + Intergenic
1144588551 17:16504229-16504251 CAAAAAAAAAAAAATACTGCAGG - Intergenic
1146205723 17:30904065-30904087 CATAGAAAGAGAAAGACTTAAGG - Exonic
1146354666 17:32123969-32123991 CATAAAAAAACAAATCCCGCTGG - Intergenic
1146927747 17:36756664-36756686 CACAGAAGGACAAATATTGTAGG - Intergenic
1149404997 17:56339549-56339571 AATAGAAAACCAAATATTGCAGG - Intronic
1149976164 17:61268554-61268576 CCCAGAAAGACAATTACTGGTGG - Intronic
1150483173 17:65526293-65526315 CACGGATTGACAAATACTGCAGG + Intergenic
1151011005 17:70495948-70495970 TACAGGAAGACAAATACTGTAGG + Intergenic
1151072479 17:71231683-71231705 CATGCAAAGACTAATACTGCAGG + Intergenic
1151873783 17:76854536-76854558 CACAAAAAGACAAATACTATGGG - Intergenic
1152966097 18:115483-115505 CATATAAAAACAAATACTGTTGG - Intergenic
1153126029 18:1791472-1791494 ACTATAAAGACAAATAATGCAGG - Intergenic
1153683685 18:7524656-7524678 CTGAGAAAGGCAAATAATGCAGG - Intergenic
1153954939 18:10088086-10088108 CATGGAAAAAAAAATGCTGCAGG + Intergenic
1154299774 18:13182900-13182922 AATAAAGAGACAAATACGGCCGG + Intergenic
1154927872 18:20956572-20956594 CATATAAAAACAAATACTGTTGG + Intronic
1155684864 18:28536286-28536308 AACAGAAAACCAAATACTGCAGG + Intergenic
1155776426 18:29767557-29767579 CATAGAAATATAAATATTACTGG - Intergenic
1155963259 18:32013535-32013557 CATAGGAAGGCAAATATAGCAGG + Intergenic
1156017447 18:32562463-32562485 CATAGAAAGACAAAGAATTCAGG - Intergenic
1157310839 18:46551949-46551971 CACAAAAAGACAAATTCTGTAGG + Intronic
1158750969 18:60260425-60260447 CACAGAAAGACAAATAACTCGGG - Intergenic
1159150874 18:64522227-64522249 AACAGAAAGACGAAGACTGCAGG + Intergenic
1159394231 18:67835530-67835552 CATAGAAAGACAAACAACACAGG - Intergenic
1159420312 18:68210500-68210522 AACAGAAAATCAAATACTGCAGG + Intergenic
1159441941 18:68492640-68492662 CAAAGAAAAAAAAATACCGCAGG + Intergenic
1159478471 18:68956057-68956079 CACAGAAAGACAAACTTTGCAGG - Intronic
1159686966 18:71434657-71434679 CACAGAAAGACAAATATCACAGG + Intergenic
1159710964 18:71759344-71759366 CATAGAAAAACAAACACTGTTGG + Intronic
1159821044 18:73143806-73143828 AACAGAAAGACAAATACTGTAGG - Intergenic
1159907475 18:74109002-74109024 CTTAGAAAAACAAATATTGAAGG + Intronic
1160036500 18:75306253-75306275 CACAAAAAGACAAATACTGTAGG - Intergenic
1160181593 18:76641504-76641526 CACAGAAAGACAAGTACTGCAGG - Intergenic
1162160522 19:8711267-8711289 CACAAAAAGTCAAATACTGTAGG + Intergenic
1162610342 19:11745063-11745085 CACAGAAGGACAAATATTGTAGG + Intergenic
1162868511 19:13567657-13567679 TACACATAGACAAATACTGCAGG - Intronic
1163059170 19:14745839-14745861 CACAAAAAGACAAATACCACAGG - Intronic
1164974862 19:32565044-32565066 CATAGCAAGACAAATGCTTAAGG + Intergenic
1165984993 19:39760438-39760460 CACAGAAGGACAAATACTGCAGG + Intergenic
1166222067 19:41371778-41371800 CATAAGAGGACAAATACTGTAGG - Intronic
1168086651 19:54052517-54052539 CTCAGAAAGACAAATTCTGCAGG - Intronic
1168397253 19:56058954-56058976 CCTAAAAAGACAAATACTGTAGG + Intronic
1168521713 19:57056438-57056460 AACAGAAAGTCAAATACTGCAGG + Intergenic
925038348 2:709435-709457 CACAAAAAGACAAACGCTGCAGG - Intergenic
925732863 2:6934291-6934313 CACAGAAAGAGAAATACTAGTGG - Intronic
925954277 2:8946797-8946819 CAGAGGAAGACAGAGACTGCCGG - Intronic
926226395 2:10970057-10970079 AATAGAAAGAAAAATGCAGCGGG - Intergenic
927033994 2:19152659-19152681 CACAGAAAGACAAATATTTCAGG - Intergenic
927475837 2:23413681-23413703 CATTCCAAGACAAACACTGCAGG - Intronic
928527366 2:32155253-32155275 ATTAGAAAAAAAAATACTGCAGG - Exonic
928542380 2:32295151-32295173 AATATAAAAACAAATACTGATGG - Intronic
928655814 2:33450467-33450489 CACAGAAAGACAAGTTCTGCAGG - Intronic
929657890 2:43752307-43752329 TACACAAAGACAAATAATGCAGG - Intronic
931846906 2:66213558-66213580 CATAGAAACTCAAAGACTCCTGG + Intergenic
933044295 2:77515960-77515982 CATACAAAAACAAACATTGCAGG - Intronic
933444379 2:82359879-82359901 CACAGAAAGACAAATACTGCAGG - Intergenic
933470580 2:82717841-82717863 CAAAGAAAGAAAAACATTGCTGG + Intergenic
934783020 2:96985004-96985026 CAAAGAAAGACACAAACTGTGGG + Intronic
935445211 2:103149108-103149130 CATAAAAAGCAAAATACAGCCGG - Intergenic
935504401 2:103882300-103882322 GAGAGAAAGAAAAATAGTGCTGG + Intergenic
935515755 2:104036441-104036463 CATAGAATCACAAATATTGAGGG - Intergenic
936020650 2:108992410-108992432 CATACAAACACAAATAATCCAGG - Intergenic
937002746 2:118483085-118483107 CATAGAAATACAGAAACAGCTGG + Intergenic
938177332 2:129145525-129145547 CACAGAAAGACAAATACTGCAGG - Intergenic
938226594 2:129621908-129621930 TGCAGAAAAACAAATACTGCAGG + Intergenic
938473599 2:131588678-131588700 GACAGAAGGACAAATACTACGGG + Intergenic
938930582 2:136083204-136083226 AAAAGAATGACAACTACTGCTGG + Intergenic
939343910 2:140937344-140937366 CAAACAAAAACAAATACTGTAGG + Intronic
939375515 2:141360559-141360581 AAAAGAAAGACATATACTCCAGG + Intronic
940215749 2:151301715-151301737 CACAGAAAGACAAATATTGCAGG + Intergenic
940410777 2:153360767-153360789 CTTAGAAAGACTAAGTCTGCTGG - Intergenic
940440268 2:153707048-153707070 CAAAGAAAGAGAAATCGTGCAGG - Intergenic
941568477 2:167139479-167139501 AATAAAAAGAGAAATACAGCAGG - Intronic
941687846 2:168465629-168465651 CACAAAAAGACAAATACTGTAGG + Intronic
941820460 2:169839539-169839561 CATAAAAAGACAAATATTTAAGG + Intronic
942053176 2:172159646-172159668 CACAGAAAGAAAAATATTGCAGG - Intergenic
942302642 2:174576287-174576309 CATAAAATGAAAAATACTGATGG - Intronic
942339999 2:174933868-174933890 CATACAGACACAAATACTGATGG + Intronic
942933322 2:181523321-181523343 CCTAGAAAAGCAAATACTTCTGG + Intronic
944312338 2:198247547-198247569 CATAGAAAAAGAAATACTAAAGG + Intronic
944371380 2:198987312-198987334 AACAGAAAACCAAATACTGCAGG + Intergenic
944430932 2:199632990-199633012 CAAAGAAATACAAATACAGCTGG + Intergenic
944678425 2:202053649-202053671 CATAGAGAGAGAAAGCCTGCTGG - Intergenic
944751102 2:202710804-202710826 CAGAGAAAGACAAACTTTGCAGG - Intronic
944894249 2:204147730-204147752 CACAGAAAGGAAAATATTGCAGG - Intergenic
945237627 2:207646469-207646491 CCTAGAAAGACACAAACTACTGG + Intergenic
945255916 2:207802986-207803008 CACAAAAAAACAAATACTGTAGG - Intergenic
946591224 2:221250287-221250309 AATACAAAGACAACTACTGGAGG + Intergenic
947066389 2:226230660-226230682 CACAGAAAGACAAACACTGGAGG + Intergenic
947265975 2:228281942-228281964 CATAAAAAGACAAATACTGTAGG + Intergenic
947355480 2:229290258-229290280 CACAGATAGACAAATACCACAGG - Intergenic
947557639 2:231110429-231110451 ATTAGAAAGACAAATAATACAGG + Intronic
947578239 2:231293732-231293754 GATAGAAAGATAAATACTTTAGG - Intronic
948077857 2:235180289-235180311 CACAGAAAACCAAATACTGCAGG - Intergenic
1169223209 20:3839102-3839124 CACAGAAAGACATATCCTTCTGG + Intergenic
1169975279 20:11318839-11318861 CAAAGAAGGACAAATACTGCAGG + Intergenic
1170238760 20:14138498-14138520 CACATAAGGACAAATACTGCAGG + Intronic
1171187783 20:23135816-23135838 CATGAAAAGACAAATAATGTGGG + Intergenic
1171381338 20:24736642-24736664 CTTTGAAAGATAAATACTGGTGG + Intergenic
1171441058 20:25163376-25163398 CACAGAAAGACAAATGCGGCAGG - Intergenic
1171445468 20:25199723-25199745 CACAAAAAGACAAATATTGTAGG - Intronic
1172719428 20:36988115-36988137 CATAGAAAGCCAATCACTGCTGG - Intergenic
1172933600 20:38602603-38602625 TATAGAAAGTCAAACAGTGCAGG + Intronic
1173328578 20:42055485-42055507 CTTAGAAAAACAAATACTGCTGG - Intergenic
1173478318 20:43379041-43379063 CATAGCAACACAAATGCTCCTGG + Intergenic
1173639848 20:44593504-44593526 CACAGAAAGACAAATACTACAGG + Intronic
1174434597 20:50497066-50497088 CATAGCAAGATGAATACTACAGG + Intergenic
1175292695 20:57888377-57888399 CATAGAAAGAAAAACACAGAGGG - Intergenic
1175405174 20:58721425-58721447 CACAAAAACACAAATACTGTAGG + Intergenic
1175634004 20:60565613-60565635 TATAAAAACACAAATTCTGCTGG - Intergenic
1175917091 20:62431076-62431098 GACAGAAAGACAAATACTGCAGG - Intergenic
1176456942 21:6921503-6921525 CACAAAAAGACAAATACTATGGG - Intergenic
1176716913 21:10359406-10359428 CATAGAGAGACAAATAAGACAGG - Intergenic
1176835115 21:13786563-13786585 CACAAAAAGACAAATACTATGGG - Intergenic
1176874148 21:14110722-14110744 CACACAAAGACAAAGACTGTAGG - Intronic
1178459314 21:32787817-32787839 CATAGATAGACAAATACAGCAGG - Intergenic
1179020834 21:37639428-37639450 CATAGAAAAAAAAATAGTTCAGG - Intronic
1179589802 21:42399309-42399331 CGGAGAAAGACAAATACTGCAGG + Intergenic
1180926787 22:19560686-19560708 CACAGAAAGACAAATACCACAGG + Intergenic
1182698994 22:32217362-32217384 CACAGAAAGACAAATGCTATAGG - Intergenic
950957349 3:17068712-17068734 CATCGAGAGACAATTACTGTTGG + Intronic
951877853 3:27447385-27447407 CATAGGAAGGAAAATACTGATGG - Intronic
952332806 3:32380327-32380349 ACCAGAAAGACAAATACCGCAGG + Intergenic
952537618 3:34328808-34328830 CACAGAAAGGCAAATACCACCGG - Intergenic
952614687 3:35256229-35256251 CATAAAAAGGCAAATGCTGTAGG - Intergenic
952674176 3:36007288-36007310 CACAGAAAGAAAAATACTGTGGG + Intergenic
953513131 3:43563749-43563771 CACAGAAAGACAAATATCACAGG + Intronic
953713953 3:45300048-45300070 CATAGCCAAACATATACTGCAGG + Intergenic
953799805 3:46013755-46013777 CAAAGAAAGAGAAAAGCTGCTGG - Intergenic
954282382 3:49591403-49591425 CACAAAAAGACAAAGAGTGCTGG - Intronic
954506323 3:51078403-51078425 CAAAGAAAGAAAATTACTGAAGG + Intronic
955358834 3:58255016-58255038 CATAGAATGAAAAATACTTCAGG - Intronic
955771851 3:62392659-62392681 CATAAGAAGACAAATACTGGTGG - Intergenic
955913853 3:63886147-63886169 CACAGAAAGACAAATACTGCAGG + Intronic
956614361 3:71156415-71156437 CATTGAAGCACAAATGCTGCTGG - Intronic
957399637 3:79692565-79692587 CACAGGAAGACAAGTCCTGCAGG + Intronic
957658712 3:83118503-83118525 GATGAAATGACAAATACTGCAGG + Intergenic
957904182 3:86536802-86536824 CAGAGAAAGAAAATTACTGCAGG + Intergenic
958758068 3:98274195-98274217 CAGAGAAAGACAAAAAGTGCTGG - Intergenic
959174800 3:102893627-102893649 CATAGAAAGACAAATACTGCAGG + Intergenic
959932087 3:111996172-111996194 CATAGAAAGAAAAATGAGGCTGG - Intergenic
960324575 3:116280031-116280053 CATAAAAAAATAAATACTGGTGG + Intronic
960570584 3:119181774-119181796 CCTAGAAAGACAAATAAAACAGG + Intronic
960657287 3:120019460-120019482 CATTGACACACAAATAATGCAGG - Intronic
961769427 3:129237926-129237948 CATAAAAAGACAAATACGGGCGG - Intergenic
962515760 3:136149845-136149867 TATTTAAAGAAAAATACTGCTGG - Exonic
962903444 3:139780487-139780509 CATAAAAAGACACAGACTGGTGG + Intergenic
963324538 3:143847433-143847455 CCCAGAAAGAGCAATACTGCAGG + Intronic
963418545 3:145029177-145029199 CACAGAAAGACAAATTTTGCAGG + Intergenic
964312453 3:155409330-155409352 GAGACAAATACAAATACTGCAGG + Intronic
965854930 3:173075669-173075691 CACAGAAAGACAAATATCACAGG + Intronic
967480288 3:189964849-189964871 GAGAGAAAAAGAAATACTGCTGG + Intronic
969371865 4:6736668-6736690 CACAAAAGAACAAATACTGCAGG - Intergenic
969414336 4:7048813-7048835 CAGAAAAGGACAAATCCTGCAGG - Intronic
970314239 4:14814236-14814258 CAAAGAAACAAAAATACAGCAGG + Intergenic
970753984 4:19401639-19401661 CTTAGAAAGAAAGATACTGATGG - Intergenic
971818638 4:31523099-31523121 CATAGAAAGACAAATATTGGAGG - Intergenic
971935847 4:33145976-33145998 CATATAAGGACATATACTGATGG + Intergenic
973223978 4:47761615-47761637 CACAGAAAGACAAATACCACAGG + Intronic
973227220 4:47800553-47800575 CACAAAAAGACAACTACTGAAGG + Intronic
973813524 4:54596673-54596695 CACAGAAAGACAAATACTGTAGG + Intergenic
974544802 4:63287957-63287979 GATAGTAAGACAAATACCACAGG - Intergenic
974590753 4:63944788-63944810 AACAGAAAAACATATACTGCAGG - Intergenic
974704198 4:65490395-65490417 CATTTACAGACACATACTGCCGG + Exonic
975457724 4:74612344-74612366 AATAGAACGATAAATACTGGAGG + Intergenic
975952504 4:79790430-79790452 CATAGAAAGATAAATGCTGAAGG - Intergenic
976806171 4:89050028-89050050 CTGAGAAAGACAAATAGTACAGG + Intronic
977587368 4:98788583-98788605 CACAGAAAGACAAATACTGTAGG + Intergenic
977724029 4:100273473-100273495 AAAAGAAAGACAAATAATGAAGG - Intergenic
978037809 4:104017905-104017927 CATAGAAAGATAAATACCACAGG + Intergenic
978195916 4:105971807-105971829 CCTAGAAAGTATAATACTGCAGG - Intronic
978738415 4:112110241-112110263 AATACAAAGACAATAACTGCAGG - Intergenic
979172434 4:117618828-117618850 CATCAAAAGACAAATATTGCAGG + Intergenic
979387740 4:120089137-120089159 AATAGAAAGTCAAACACTGGTGG - Intergenic
979399811 4:120234954-120234976 AATAGAAAGACAATGGCTGCTGG - Intergenic
979543060 4:121908626-121908648 AATAGAAAACCAAATACAGCAGG + Intronic
982421515 4:155204382-155204404 CATGAAAAGGCAAATACTTCAGG - Intergenic
982519990 4:156404332-156404354 CACAGAAGGACAAATTCTACAGG + Intergenic
982685526 4:158484221-158484243 ATTAGAAAGACAAATACAGGTGG + Intronic
983370835 4:166856012-166856034 TACAGAAAGACAAATATGGCAGG + Intronic
983395533 4:167189869-167189891 CTCAGAAAGACAAATATTGTAGG - Intronic
983541742 4:168918433-168918455 CACAGAAAGATAAATACTACAGG + Intronic
983631743 4:169856430-169856452 CATGGAAAGACAAATACTGTAGG + Intergenic
983970945 4:173873600-173873622 TACAGAAAGACAAATTTTGCAGG + Intergenic
984099791 4:175471690-175471712 CACAGAAAGACAAATACTACTGG - Intergenic
984469627 4:180151660-180151682 AAAAGAAAGAAAAATACCGCTGG - Intergenic
984606731 4:181794532-181794554 CAAAGAAAAACAAATACTGCAGG - Intergenic
985044611 4:185928103-185928125 CATAGAAAAAAAAATATTTCTGG + Intronic
985178232 4:187226287-187226309 CACAGAAAGATGAATACTGCAGG - Intergenic
986810806 5:11357427-11357449 CACAGAAAGACAAATACCACAGG + Intronic
986825543 5:11517921-11517943 CGGACACAGACAAATACTGCAGG + Intronic
986906260 5:12497038-12497060 CATAGAAACACAAATACTGCAGG + Intergenic
987796286 5:22631533-22631555 GACAGAAACCCAAATACTGCAGG + Intronic
988860931 5:35277904-35277926 CACAGAAAGACAAATACCACAGG - Intergenic
989484611 5:41975272-41975294 TATAGAAAGACAATTCCAGCAGG - Intergenic
990262465 5:54039501-54039523 CTTTGAAAGGCAAATAGTGCCGG + Intronic
990330161 5:54717934-54717956 CACAGAAGGACAAATATTTCAGG + Intergenic
991906583 5:71519552-71519574 CACAGAAAGACAAATATTGCTGG - Intronic
992020024 5:72613612-72613634 CCCAGAAAAACAAATACTGCAGG - Intergenic
992632324 5:78693933-78693955 CAGAGAAAGCAAAATAGTGCGGG + Intronic
992966518 5:82007109-82007131 CATTAAAAGACAAATACTGTGGG - Intronic
993093577 5:83456996-83457018 CACAGAAAGACAAATACTGCAGG + Intergenic
993448727 5:88047098-88047120 GATAGGAAGACAAATACTAACGG + Intergenic
993518043 5:88862500-88862522 TAAAGAAAGACAAGTACTTCAGG - Intronic
993981812 5:94551570-94551592 TATTGAAAGAAAAAAACTGCTGG + Intronic
994276042 5:97839068-97839090 TATAGAAAGACAAATCCATCTGG + Intergenic
994694634 5:103058755-103058777 CATTAAATGACAATTACTGCAGG - Intergenic
994899190 5:105747787-105747809 AACAGAAAACCAAATACTGCAGG - Intergenic
995241782 5:109893257-109893279 TATTGAATGACATATACTGCAGG - Intergenic
995971411 5:117975351-117975373 CACAGAAAGACAGATACCACAGG - Intergenic
996173479 5:120325244-120325266 CACAGAAAGACAAATACCATAGG + Intergenic
997049790 5:130366099-130366121 CACAGGAAGGCAAATACTGCAGG - Intergenic
997079316 5:130719472-130719494 AATAGAAAGTCAAATACTGCAGG + Intergenic
999071012 5:148744080-148744102 AATAGAAAAAAAAATAATGCTGG + Intergenic
999456516 5:151720855-151720877 CAGAGAAAGACAGATGCTCCTGG + Intergenic
999946375 5:156600410-156600432 CATACAAAGAAAAATACCACAGG - Intronic
1001128607 5:169044481-169044503 CATAAAAGGCCACATACTGCAGG + Intronic
1001298947 5:170519667-170519689 CATAGACAGATAAAGGCTGCAGG - Intronic
1002310883 5:178313089-178313111 CACAGAAAGACAAATACGGAAGG + Intronic
1002597984 5:180336524-180336546 CAAAGAAAGACACATTCAGCTGG - Exonic
1002788258 6:419954-419976 CACAGAAGGACAAATACTGCAGG - Intergenic
1002864990 6:1113910-1113932 CACAGAAGAACAAATACTACAGG + Intergenic
1003010728 6:2424730-2424752 CATGAAAGGACAAATACTGTAGG - Intergenic
1004057727 6:12157826-12157848 CTTAGAAAAACAAAAACTGAGGG - Intronic
1005353134 6:24956131-24956153 CATTAAGAGACAATTACTGCTGG + Intronic
1005396887 6:25391737-25391759 CATAGCAATACAAGTTCTGCTGG + Intronic
1007014491 6:38450159-38450181 GCCAGAAAGACAAATACTGCAGG + Intronic
1007342342 6:41199501-41199523 CATAGAGAGAAAGATATTGCAGG - Intronic
1007348147 6:41248610-41248632 CATAGAGAGAAAGATATTGCAGG + Intergenic
1008298055 6:49802568-49802590 AACAGAAAAACAAATACTGCAGG - Intergenic
1009522538 6:64701595-64701617 CTTAGAAAATCAAATACTGCAGG + Intronic
1009803703 6:68574828-68574850 CACAGAAAGACAAATATTCCAGG + Intergenic
1011054320 6:83189883-83189905 CACATGAAGACAAATACTGCAGG + Intronic
1011456490 6:87555968-87555990 CAAAGAAAGAAAAGTACTGAGGG + Intronic
1011596045 6:89017440-89017462 CACAGAAAAACAAACATTGCAGG + Intergenic
1011725029 6:90202427-90202449 CAGAGAAAAAAAAATTCTGCTGG + Intronic
1011927426 6:92663857-92663879 CATTCAAAGATAAATATTGCAGG + Intergenic
1013005165 6:106065861-106065883 CCTAGAGAGACAAGTACAGCAGG - Intergenic
1014385443 6:120795368-120795390 CATAAAAAGACCAGTACTTCAGG - Intergenic
1014697515 6:124641867-124641889 TTTAGAAAGACAAATACCACTGG + Intronic
1015557343 6:134476863-134476885 CATGCAAAAACGAATACTGCAGG - Intergenic
1016664369 6:146618536-146618558 CATGGAAACACAAGAACTGCAGG - Intronic
1017663289 6:156694758-156694780 CACAGAAGGACAAATACTGTGGG + Intergenic
1018652589 6:166004625-166004647 CACAGAAGGACAAACCCTGCAGG - Intergenic
1019009342 6:168829522-168829544 CATAAAAAGACAAATATTTAAGG - Intergenic
1019096398 6:169584163-169584185 CACAAAAAGAAAAAGACTGCAGG - Intronic
1019311861 7:366218-366240 CACAGGAAGAGAAATACCGCAGG - Intergenic
1019773799 7:2900271-2900293 CACAAAAAGACAAATATTGTAGG - Intergenic
1020230464 7:6314497-6314519 CATAAAAGGACAAATATTGTAGG - Intergenic
1020500900 7:8918976-8918998 AATGTAAATACAAATACTGCAGG - Intergenic
1020792727 7:12645736-12645758 AACAGAAAACCAAATACTGCAGG - Intronic
1021127347 7:16867327-16867349 CATAGATAGATAGATACTACAGG - Intronic
1021497166 7:21288731-21288753 CACAGAAAGAAAAATATTGAAGG + Intergenic
1022481043 7:30743355-30743377 CAGGGAAGGACAAATACTGTAGG - Intronic
1022783318 7:33609054-33609076 CATAGAAAGAAAAATAAAACTGG - Intergenic
1023085946 7:36570256-36570278 CACAGAAGGACGAATACTGCCGG - Intronic
1023181299 7:37486342-37486364 AAAAGAAAACCAAATACTGCAGG - Intergenic
1024615770 7:51110352-51110374 CACAGAAGGAGAAATAATGCAGG - Intronic
1024726776 7:52207154-52207176 TATAAAAAGACATATACGGCCGG + Intergenic
1025871955 7:65442949-65442971 CACAGAATGACAATTACTGGTGG - Intergenic
1026213401 7:68326896-68326918 GACAGAAAACCAAATACTGCAGG + Intergenic
1027446564 7:78280280-78280302 CAAAGAAAGACAAATTGTGGGGG + Intronic
1027481594 7:78704901-78704923 AACAGAAAAACAAATACTGCAGG + Intronic
1028151878 7:87383354-87383376 AATAGAAAGACAAATACTGCAGG - Intronic
1028334174 7:89630458-89630480 AAGAGAAAGTCAAATACTGCAGG + Intergenic
1028337761 7:89678746-89678768 AACAGAAAACCAAATACTGCAGG + Intergenic
1028798146 7:94928662-94928684 CTTAGAAAGACAAATAAAGAGGG - Intronic
1028945639 7:96576718-96576740 CATAGAAAGAAAACTACCTCAGG - Intronic
1029054781 7:97730902-97730924 CATAGAGAAAAAAATACTTCTGG + Intergenic
1029879283 7:103790083-103790105 AACAGAAAACCAAATACTGCAGG + Intronic
1029963900 7:104718055-104718077 CACAGAAGGACAAACACTTCAGG + Intronic
1031464689 7:122093986-122094008 AACAGAAAACCAAATACTGCAGG + Intronic
1031792822 7:126131912-126131934 CACAGAAAGACACATATTGCAGG + Intergenic
1032260871 7:130335802-130335824 CTCAGACAGACAAATACTGAGGG + Intergenic
1032327805 7:130948316-130948338 CACAAAAGGACAAATACTGTAGG + Intergenic
1032398934 7:131610377-131610399 CAGAGACAGACAAACACTCCTGG + Intergenic
1032476206 7:132213145-132213167 CACAAAATGGCAAATACTGCAGG + Intronic
1032940688 7:136786543-136786565 CACAGAAAGACAAATATTCATGG - Intergenic
1033036783 7:137882759-137882781 TATAGAAAGCCAAATTCTGTTGG - Intronic
1033066665 7:138161887-138161909 CAGAGATAGATAAATACTTCAGG + Intergenic
1033157482 7:138969375-138969397 CATGAAAGGACAAATACTGTAGG - Intronic
1033415717 7:141159697-141159719 CACAGTAAGACAAATACTGTAGG + Intronic
1033650473 7:143338941-143338963 CAGAGAAAGATAAGTACTCCGGG + Intronic
1033899637 7:146120197-146120219 CATATAAAAGCAAATACTGCTGG + Intronic
1035567906 8:653939-653961 CACAGAAGGACAAATCCCGCAGG + Intronic
1035622825 8:1047173-1047195 TATAGAAAGAGAAAGTCTGCTGG - Intergenic
1035998105 8:4572325-4572347 CATAGAAAAGCAAATTCTGGGGG - Intronic
1036034082 8:5000207-5000229 CATAAAAACACAAATAAGGCCGG + Intergenic
1036775653 8:11611089-11611111 CAGAGAAAGACAAATATTGCAGG + Intergenic
1037622400 8:20576317-20576339 CACAGAAGGACAAATACTGTAGG - Intergenic
1037721003 8:21443959-21443981 AAAAGAAAGAAAAAAACTGCAGG - Intergenic
1039513203 8:38108209-38108231 AAAAGAAAGAAAAATACTGAAGG + Intronic
1040408984 8:47135564-47135586 CACAGAAAGACAGATACTGCAGG - Intergenic
1040738125 8:50536079-50536101 CATATCAAGGCAACTACTGCTGG - Intronic
1041623953 8:60003810-60003832 CAGAGAAACACAAAAACTTCAGG + Intergenic
1041722903 8:60992437-60992459 CAAAGAAAGAGAAAGACTGCTGG + Intergenic
1041741448 8:61161546-61161568 CATAGAAAGACAAATACTACAGG + Intronic
1041927380 8:63250715-63250737 GATAGAAAGACAAATACCTGGGG + Intergenic
1042233746 8:66586937-66586959 CAGAGAAAGATAAACACTGTAGG + Intronic
1042925105 8:73959368-73959390 GATATAAAGAAAAATAGTGCTGG - Intronic
1043026015 8:75070116-75070138 TATAAAAAGACAAATATTTCAGG + Intergenic
1043360165 8:79462640-79462662 CAAAGAAACATGAATACTGCTGG + Intergenic
1043802958 8:84634429-84634451 AATAAAATGACAAATACTGTAGG - Intronic
1043882532 8:85561863-85561885 CATGGAAATCCAAATACTCCTGG - Intergenic
1044089893 8:87986944-87986966 CATAGAATTTCAAATACTGAAGG - Intergenic
1044458758 8:92419845-92419867 AACAGAAAACCAAATACTGCAGG - Intergenic
1044562912 8:93630896-93630918 GATGGAAAGACAACCACTGCAGG + Intergenic
1044809380 8:96042048-96042070 CATGGGAAGAAAAATACTGATGG - Intergenic
1046140138 8:110080856-110080878 TACAGAAAGACAAATACTGAAGG + Intergenic
1046181886 8:110660350-110660372 AACACAAAGTCAAATACTGCAGG + Intergenic
1046500552 8:115070874-115070896 CAGAAAAAGAGCAATACTGCGGG - Intergenic
1046549750 8:115700090-115700112 AATAGAAAAAGAAATACTGGTGG - Intronic
1046580444 8:116086178-116086200 CATAGAAAGACAAATAACATAGG + Intergenic
1046859094 8:119070371-119070393 CATAGAAAGAAAAATAATGATGG - Intronic
1047057787 8:121186160-121186182 CACCAAAAGACAAATACTACAGG + Intergenic
1047297703 8:123585976-123585998 AAGAGAAAGAGAAAGACTGCTGG - Intergenic
1047874278 8:129118015-129118037 CACAGAAAGAAAAAAACTGTGGG - Intergenic
1048035722 8:130675512-130675534 CAAAGCAAATCAAATACTGCTGG + Intergenic
1048108255 8:131436852-131436874 CACAGAAAGACAAATTTTGCAGG + Intergenic
1048495800 8:134934967-134934989 CATAGAAGGATAAATACTACTGG - Intergenic
1048802596 8:138207641-138207663 CATAGGAAGGCACATACTGTGGG + Intronic
1048805107 8:138233030-138233052 CACAGAACAACAAATACTACAGG - Intronic
1049568218 8:143354296-143354318 CACAAAAGGAAAAATACTGCAGG + Intronic
1050723528 9:8619438-8619460 CACAGAAAGACAAATGCTATGGG - Intronic
1051519085 9:17964149-17964171 CATAGAAAAATAAATCCTTCTGG + Intergenic
1051945391 9:22563383-22563405 CACAGAAGGACAAATATTGCGGG + Intergenic
1052229593 9:26132930-26132952 CATAGAAAATCAAATACTCTTGG + Intergenic
1052266626 9:26581275-26581297 CACAGAAAGATAAACACTGCAGG + Intergenic
1053563357 9:39220035-39220057 CACAGAAAGACCAATACTACAGG - Intronic
1053829145 9:42057956-42057978 CACAGAAAGACCAATACTACAGG - Intronic
1054133790 9:61399031-61399053 CACAGAAAGACCAATACTACAGG + Intergenic
1054601415 9:67129491-67129513 CACAGAAAGACCAATACTACAGG + Intergenic
1055144060 9:72911602-72911624 CATAAAAAGACAAATACCGCAGG - Intronic
1055341727 9:75291725-75291747 CACAGAAAGACAAATGTTGCAGG - Intergenic
1055987834 9:82070199-82070221 CACAGAAAAGCAAATACTGCTGG - Intergenic
1056380818 9:86055689-86055711 CACAGAAGGACAAATGCTGTAGG + Intronic
1056741546 9:89260186-89260208 CATAAAAAGAAAAGTACTGATGG + Intergenic
1057191500 9:93090564-93090586 TACAAAAAGACAAATACCGCGGG - Intergenic
1057691387 9:97289866-97289888 TATAGAAAGAAAAATACGCCAGG + Intergenic
1057977450 9:99621169-99621191 CACAGGAAGATAAATACTGCAGG + Intergenic
1058893794 9:109383050-109383072 CATAGAAAGACACATACTGTAGG - Intronic
1058903143 9:109459373-109459395 CATAGAAAGACACAAAGTGAGGG + Intronic
1059013679 9:110490561-110490583 CACAGAAAGACAAATATCTCAGG - Intronic
1059096728 9:111424550-111424572 TATAGTAAGAGAAATACAGCAGG + Intronic
1059774097 9:117457655-117457677 CATACAAAGGCACATACTCCAGG + Intergenic
1059915769 9:119098284-119098306 CACAGAAAGATAAATCCTGCAGG + Intergenic
1061294585 9:129670083-129670105 CACAGAACGGCAAATACTGTAGG - Intronic
1185484784 X:474060-474082 CACAGAAAGATAAACACTGTGGG - Intergenic
1185879907 X:3731766-3731788 CACGGAAAGACAAATACTGCAGG + Intergenic
1186735981 X:12464393-12464415 CAAAGAAAAACAAATATTGGTGG - Intronic
1186968660 X:14815909-14815931 AACAGAAAGCCAAATACTTCAGG + Intergenic
1187118962 X:16384629-16384651 AACAGAAAACCAAATACTGCAGG - Intergenic
1187178473 X:16918679-16918701 CATAGAAAGACAAATACCGCAGG + Intergenic
1187894853 X:23971138-23971160 CACAGAATGATAAATACTTCAGG - Intergenic
1187994898 X:24915486-24915508 AATAAAAAGAGAAATACTCCAGG - Intronic
1188479761 X:30625151-30625173 CAAAGAAAGATAAACATTGCAGG + Intergenic
1188875064 X:35419364-35419386 CGCAAAAAGACAAATACTGTAGG - Intergenic
1188999564 X:36929261-36929283 CCAAGAACCACAAATACTGCAGG + Intergenic
1189028652 X:37427701-37427723 CATAGAAAGACAAATACCACAGG - Intronic
1189370478 X:40424174-40424196 CACAAAAAGACAAATATTGTCGG - Intergenic
1190219065 X:48499301-48499323 CAAAGAAAGAAAAAGACTTCAGG + Intergenic
1190269190 X:48849336-48849358 CAAAAAAAGACAAATACTGCAGG - Intergenic
1190524792 X:51317835-51317857 CAGGGAAATACAAAGACTGCAGG + Intergenic
1191603555 X:63037240-63037262 AACAGAAAGTCAAATACTGCAGG - Intergenic
1191663342 X:63672694-63672716 AATAGGAAGACAACTGCTGCTGG + Intronic
1192414493 X:70966478-70966500 CACAGAAAGACAAATATCACAGG + Intergenic
1193196832 X:78642263-78642285 CCTAGAAAGACATAAACTACTGG - Intergenic
1193254588 X:79332272-79332294 CATAGCAATACAATTACTGTAGG - Intergenic
1193722307 X:85001614-85001636 AACAGAAAACCAAATACTGCAGG + Intergenic
1193958354 X:87891497-87891519 CATGGAAAGACATATTTTGCAGG - Intergenic
1194207008 X:91021757-91021779 AATAAAAAGACAAATAATACAGG - Intergenic
1194489438 X:94528375-94528397 CATAGAAAGAAAAATACTGCAGG - Intergenic
1194733728 X:97487009-97487031 CACACAAAGACTCATACTGCGGG - Intronic
1195097585 X:101519410-101519432 CACAGAAGGGCAAATACTGTAGG - Intronic
1195632577 X:107073865-107073887 CACAGAAAGTTAAACACTGCAGG + Intronic
1196106872 X:111905932-111905954 GAAAGAAAGAAAAATACTGAAGG + Intronic
1196142633 X:112281232-112281254 CACAGAAAGACAAATGCCACAGG - Intergenic
1197841362 X:130750772-130750794 CAGAGAAAGACAGATACAGAGGG - Intronic
1198204919 X:134456587-134456609 CATAGAAATACAAATTTTGGCGG + Intergenic
1199010361 X:142750970-142750992 CACAGAAAGACAAATACTGCAGG - Intergenic
1199257828 X:145737048-145737070 CACAGAAAAACAAATATTGTAGG + Intergenic
1199300116 X:146203876-146203898 CATAAAAAGACAAATATTTAAGG - Intergenic
1199536199 X:148905850-148905872 CATAAAAATACAATTACTGTAGG - Intronic
1199634190 X:149800107-149800129 CATGAAAAGACAAATACTGTAGG - Intergenic
1199741204 X:150738224-150738246 CATGGGAGGACAAATACTGTAGG - Intronic
1199808843 X:151329079-151329101 CACAAAAGGACAAATACTGTAGG + Intergenic
1200082258 X:153583545-153583567 CACAGAAGGGCAAATACTGTAGG - Intergenic
1200223870 X:154405888-154405910 CACAAAAAGACAAATACTGTAGG - Intronic
1200552757 Y:4596542-4596564 AATAAAAAGACAAATAATACAGG - Intergenic
1200751064 Y:6944651-6944673 CACAAAAAGATAAATACTGCAGG - Intronic
1200894787 Y:8363576-8363598 CATAGAAAGATAATTATTGAGGG - Intergenic
1201335601 Y:12877796-12877818 CACAAAAAGACAAATACTGCAGG + Intergenic
1202093280 Y:21216442-21216464 TATAGCAAGACAACTACTGAAGG - Intergenic