ID: 906914091

View in Genome Browser
Species Human (GRCh38)
Location 1:49989473-49989495
Sequence ACTAACTATACCTATAGTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 99}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906914091 Original CRISPR ACTAACTATACCTATAGTAT TGG (reversed) Intronic
904875824 1:33653762-33653784 CCAAACCATACCTATAGTCTTGG - Intronic
906914091 1:49989473-49989495 ACTAACTATACCTATAGTATTGG - Intronic
908311204 1:62886262-62886284 CCTAACAATACCTATATGATAGG - Intergenic
908999221 1:70198089-70198111 ACAAACTATACATATTGAATAGG + Intronic
910268023 1:85361259-85361281 ACTAAATATAACTATAGAAGTGG + Intronic
910480702 1:87655352-87655374 ACTAATTACACTTATAGTCTAGG + Intergenic
913179271 1:116304264-116304286 ACTAATTATAGCTATCCTATGGG + Intergenic
913713947 1:121514850-121514872 AGTAACTATACTTATATTAGAGG + Intergenic
916086511 1:161274071-161274093 AATAATTATACCTATTTTATAGG + Intronic
919716510 1:200783195-200783217 ACTGACAATACCAAAAGTATTGG - Intronic
921076396 1:211703324-211703346 ACTAACTATACCTCTGTTATGGG + Intergenic
921923669 1:220694359-220694381 ACTAAATATTCCCATTGTATAGG + Intronic
924680243 1:246223650-246223672 GGTACCTATACCTATACTATTGG + Intronic
1063730545 10:8692099-8692121 ACTAACTATAGTTACAGAATTGG - Intergenic
1066541532 10:36451979-36452001 AGTAATTATACCTATACTTTAGG - Intergenic
1071719076 10:88124551-88124573 ACTAACAATATCTATATGATAGG - Intergenic
1072179688 10:92969615-92969637 ACTAACTACATGTATAGTAAAGG - Intronic
1072400344 10:95092152-95092174 AATAAATATACCTATATCATAGG + Intergenic
1074990209 10:118699046-118699068 AATGACTATACCTATCTTATAGG + Intronic
1075284820 10:121174370-121174392 ACTATCTATCACTATAGAATTGG + Intergenic
1082188443 11:49212204-49212226 GCTAACTTTACCTAAAGTAGGGG + Intergenic
1086678079 11:89634499-89634521 GCTAACTTTACCTAAAGTAGGGG - Intergenic
1093418924 12:18951978-18952000 AATAATTATACCAATTGTATTGG + Intergenic
1093732964 12:22586808-22586830 CCTAAAGATACCTACAGTATTGG + Intergenic
1097446143 12:59674578-59674600 ACTACCTATACATATAACATTGG - Intronic
1097733525 12:63155331-63155353 ATTGACTTTACCTATTGTATAGG - Intergenic
1098099754 12:67002374-67002396 ACAAACTATACCAATAGAATAGG + Intergenic
1098159157 12:67631928-67631950 TCTACCTATACCTATAGATTTGG + Intergenic
1099334098 12:81331293-81331315 ACAGGCTATACCTATAGTCTAGG + Intronic
1107759616 13:43663537-43663559 ACTAAGTATACCTTTTATATAGG - Intronic
1108650485 13:52473563-52473585 ACTAACTTTGCCTGTGGTATAGG - Intronic
1111096323 13:83519994-83520016 ACCAACTTTACTTTTAGTATGGG - Intergenic
1111678949 13:91420725-91420747 ACTCACTATCTCTATAGCATGGG - Intronic
1112933639 13:104772267-104772289 AATAACTATCCCTATTTTATTGG + Intergenic
1113094958 13:106653736-106653758 AATAACTATATCTACATTATTGG + Intergenic
1116498218 14:45588298-45588320 AATAACTCTACTTATAGTATTGG - Intergenic
1117951953 14:61091619-61091641 AATAGCTATAGCTATAGTAAGGG - Intergenic
1119970998 14:78970555-78970577 AATAAATAAAGCTATAGTATTGG + Intronic
1134401723 16:13916247-13916269 TCTATCTATATCTATAGTTTAGG + Intergenic
1140166172 16:72554349-72554371 GCTAACAATACCTATAGTTAAGG + Intergenic
1140387804 16:74557525-74557547 ATTAACTATGCCTAGAGTTTTGG - Intronic
1144536846 17:16097990-16098012 ACTTACTATACCAAATGTATGGG - Intronic
1145294804 17:21579691-21579713 ACTAAAAATACCTATATTTTTGG + Intergenic
1145369027 17:22293483-22293505 ACTAAAAATACCTATATTTTTGG - Intergenic
1149476132 17:56962466-56962488 ACTGAGTATACTTATAGTATGGG - Intergenic
1153438685 18:5093155-5093177 ATTAACTATACCCCTAGGATAGG - Intergenic
927959553 2:27232546-27232568 ATTACCTATACCTAACGTATTGG + Exonic
934869051 2:97843256-97843278 AATAACTGTACCTATAACATAGG + Intronic
936686529 2:114833795-114833817 ATAAACTATACCTATAGTCAGGG + Intronic
941938681 2:171009694-171009716 AATAACAATACCTACATTATAGG - Intronic
942802945 2:179897168-179897190 TCTAGGTATACCTATAGTCTAGG - Intergenic
943119301 2:183714298-183714320 ACTAAATATGCCTATAATGTGGG - Intergenic
1172434117 20:34916358-34916380 AATAATTATACCTATGTTATCGG + Intronic
1177094369 21:16813477-16813499 ACTATCTATCACTATACTATAGG + Intergenic
1177281916 21:18991857-18991879 ACTAACTCTAACTATAGGCTAGG - Intergenic
951168356 3:19508500-19508522 ACTAAAAATACCTATATTATAGG + Intronic
951297169 3:20951797-20951819 ACTTACTAAACCAATAGTGTAGG - Intergenic
959974441 3:112442591-112442613 ACCAACTATATCTAAAATATAGG - Intergenic
960648113 3:119912703-119912725 ACTGATTATACCTCTAGTATAGG - Exonic
962058163 3:131896297-131896319 ACAAACTGTAGCTATTGTATGGG + Intronic
963446038 3:145409235-145409257 ACAAATAATACCTATATTATAGG + Intergenic
964588302 3:158332224-158332246 ACTAACAACACCCATAGTTTTGG + Intronic
964894669 3:161581216-161581238 ACTAATGATATCTATAGTAAGGG + Intergenic
971794706 4:31212109-31212131 ACTAACAATACTTATAATCTAGG + Intergenic
974421002 4:61673901-61673923 AATAACTATAAATATATTATAGG + Intronic
976073455 4:81270199-81270221 AATAACTATTCTCATAGTATGGG + Intergenic
977134014 4:93279206-93279228 ATTAATTATATATATAGTATTGG - Intronic
979061845 4:116072656-116072678 AATTGCTATACCTATAGTTTTGG - Intergenic
980236236 4:130110472-130110494 ACTATCTATAGATATAGTAGTGG + Intergenic
980246439 4:130250726-130250748 ACTAAACATACCTATATTTTAGG + Intergenic
984382201 4:179009188-179009210 ACTAAGTTTACCTATAACATCGG - Intergenic
985184726 4:187303582-187303604 ACTAACTGATCCTCTAGTATTGG - Intergenic
994046904 5:95320390-95320412 ACTAATTTTTCATATAGTATGGG - Intergenic
996383659 5:122887164-122887186 CCTAACTGTACCTATACTCTGGG + Intronic
998912025 5:146970119-146970141 AATAAGTATACCTACATTATAGG - Intronic
1006468404 6:34210569-34210591 AATAGCTAGAACTATAGTATAGG + Intergenic
1007903143 6:45430555-45430577 ACACACTATACCTATATTTTAGG - Intronic
1009918744 6:70029962-70029984 ACTTATTATACCTATTTTATAGG + Intronic
1012280736 6:97325471-97325493 AATATCTATGCCTATAGTAAGGG - Intergenic
1012387554 6:98699711-98699733 ACAAACTATCCCTGAAGTATTGG - Intergenic
1015330145 6:131968450-131968472 ATGAACTATTCCTATTGTATAGG + Intergenic
1020711432 7:11610411-11610433 ACTAACTTTACCTACAACATTGG - Intronic
1020845996 7:13284486-13284508 ACTAACAGTACTTTTAGTATGGG - Intergenic
1024717350 7:52094619-52094641 ACTAACCATAAATATAGTGTGGG - Intergenic
1025025681 7:55514524-55514546 ACTCAGTATACCTTTAGTAACGG - Intronic
1027789711 7:82624137-82624159 CATATCTATAGCTATAGTATTGG - Intergenic
1030433649 7:109486908-109486930 ACTCACTCTACCTCTAATATTGG - Intergenic
1031117838 7:117687528-117687550 ACTTGCTCTACCTATAGAATAGG + Intronic
1035132241 7:156666295-156666317 ACTAACTCTCCCTGTAGTAGAGG - Intronic
1036930299 8:12950345-12950367 ACAAAGCATACCTAAAGTATAGG - Intronic
1038057043 8:23869752-23869774 GATAACTATACTTAAAGTATAGG - Intergenic
1042242517 8:66678730-66678752 AATAATAATACCTATCGTATGGG - Intronic
1047849122 8:128837407-128837429 ACTTATAGTACCTATAGTATAGG - Intergenic
1048289295 8:133168110-133168132 AATAATTATACCTATATCATAGG - Intergenic
1051013983 9:12452879-12452901 AATGACAATACCTATAGTAGAGG + Intergenic
1052046165 9:23796680-23796702 ACTAACTCTACGTATAGATTTGG - Intronic
1052053589 9:23878140-23878162 ACCAACTATACATATATTACAGG - Intergenic
1188494866 X:30773035-30773057 AATAAATATACCTATATCATAGG - Intergenic
1189042492 X:37556917-37556939 AATAACTATAACTATAAAATAGG - Intronic
1190413058 X:50156146-50156168 ACTAGCTATCCCTATGGTGTCGG + Intergenic
1190414121 X:50164796-50164818 ACTAATTAAACCAATAATATGGG - Intergenic
1190784363 X:53629821-53629843 ACTAATAATACCTTTAGTAGTGG - Intronic
1193681636 X:84527081-84527103 ACAATCTATACCTCCAGTATTGG + Intergenic
1196456245 X:115893361-115893383 CCTAACTATGCCTTTAGAATGGG + Intergenic
1196458124 X:115904002-115904024 CCTAACTATGTCTGTAGTATGGG + Intergenic
1199940217 X:152618927-152618949 AATAACTACAGCTACAGTATAGG + Intergenic