ID: 906917340

View in Genome Browser
Species Human (GRCh38)
Location 1:50024939-50024961
Sequence TTGAACTCTCTCACATTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 206}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906917336_906917340 10 Left 906917336 1:50024906-50024928 CCATTGGTTGAGGGTTGCTCTCC 0: 1
1: 0
2: 4
3: 20
4: 120
Right 906917340 1:50024939-50024961 TTGAACTCTCTCACATTTCCTGG 0: 1
1: 0
2: 0
3: 24
4: 206
906917333_906917340 24 Left 906917333 1:50024892-50024914 CCTAATTTCTGTCTCCATTGGTT 0: 1
1: 0
2: 0
3: 36
4: 440
Right 906917340 1:50024939-50024961 TTGAACTCTCTCACATTTCCTGG 0: 1
1: 0
2: 0
3: 24
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906917340 Original CRISPR TTGAACTCTCTCACATTTCC TGG Intergenic
901252058 1:7786332-7786354 TTTTTCTCTCTGACATTTCCAGG + Intronic
905630500 1:39515511-39515533 TTGAACTCCCTCACCTCTCGGGG - Intronic
905667261 1:39770678-39770700 TTGAACTCCCTCACCTCTCGGGG + Exonic
906216727 1:44045460-44045482 TTGAACACTCCAACATTTCCAGG - Intergenic
906917340 1:50024939-50024961 TTGAACTCTCTCACATTTCCTGG + Intergenic
907121927 1:52015538-52015560 TTGATCTTGCTGACATTTCCTGG + Intergenic
907718965 1:56953837-56953859 TGGAACTCACTCAACTTTCCCGG + Intronic
909336059 1:74475408-74475430 TTAAAAGCTCTCATATTTCCAGG + Exonic
909346303 1:74591452-74591474 GTAAACTCTCTGGCATTTCCAGG + Intronic
909381459 1:75003651-75003673 TAGAACTCTCACAAATTTCTTGG + Intergenic
909869102 1:80716940-80716962 TTTAACTCTCTTAATTTTCCAGG + Intergenic
910037971 1:82811374-82811396 TTGATCTCTCTAAGATTTCTGGG - Intergenic
910986835 1:93013441-93013463 TTGAACCCTCTGACTTTTCCAGG - Intergenic
911743171 1:101410351-101410373 GTGAATTCTCTCAGATTTCCTGG - Intergenic
914731386 1:150373941-150373963 TTGGTCTCTGTCCCATTTCCTGG + Intronic
914896861 1:151683207-151683229 GTGAACTCTGCCACATGTCCAGG - Intronic
914945505 1:152061880-152061902 TTGATGTCTCTCATACTTCCTGG + Intergenic
915207534 1:154281517-154281539 TTGAACTCTATCACATTTGTGGG - Intergenic
918294445 1:183142921-183142943 TTAAACTCTGTGACTTTTCCTGG - Exonic
921448689 1:215277014-215277036 TTTGACTCTCTGTCATTTCCTGG + Intergenic
922073181 1:222216507-222216529 AAGAACTCCCTTACATTTCCAGG + Intergenic
923854733 1:237834098-237834120 TTTAACGCTGTCAGATTTCCTGG + Intergenic
923883795 1:238132591-238132613 TTTAACCCTCTCACCTTTGCTGG - Intergenic
924465563 1:244296279-244296301 TTTATCTCTCTGACTTTTCCTGG - Intergenic
1064367052 10:14717581-14717603 TCGCACTCTCTCTCTTTTCCTGG - Intronic
1067144368 10:43683411-43683433 TTTAACACTTTCACATTTCCAGG - Intergenic
1067549496 10:47223982-47224004 TTGAAATCTCCCACATGGCCTGG + Intergenic
1068720633 10:60241945-60241967 TTTAATTCTCTCAAATTTCTAGG + Intronic
1069147118 10:64907529-64907551 GTGAACTCTCTCTCTCTTCCTGG - Intergenic
1069165112 10:65146247-65146269 TGGAACTCTTTTACTTTTCCAGG - Intergenic
1072867108 10:99074927-99074949 TTGAACCCTCTCCCCTTTCTTGG + Intronic
1072885074 10:99265726-99265748 GTGGACTCTCTCAGCTTTCCTGG - Intergenic
1074256844 10:111811585-111811607 TTGAAGTCTCTGACATTTAAGGG - Intergenic
1077095282 11:796502-796524 TTGAACCCTATAGCATTTCCTGG + Intronic
1077573450 11:3357850-3357872 CCGAACTCTATCACCTTTCCGGG + Intronic
1080409574 11:32010948-32010970 TTTAACTGACTCACAGTTCCAGG + Intronic
1080835979 11:35941713-35941735 CTGAAACCTCTCACATTTCCTGG + Intergenic
1081372695 11:42323572-42323594 TTTAACTTGCTCACATTTCTCGG - Intergenic
1082984980 11:59160776-59160798 TAGAGCTCACTCACATTTCTTGG - Intergenic
1084735295 11:71101591-71101613 TTGAATTGCCTCACATTCCCGGG + Intronic
1087296633 11:96384491-96384513 TTGAGCTCTCTTTCACTTCCTGG + Exonic
1087395197 11:97588630-97588652 GTGAATTCTTTCACTTTTCCTGG - Intergenic
1088770786 11:113034143-113034165 CTTAACTCACTCACATGTCCTGG + Intronic
1089166120 11:116477846-116477868 CTGACCTCTCTCATATTTCTTGG - Intergenic
1089745001 11:120610510-120610532 ATGAGCTCTCTCACCTGTCCTGG + Intronic
1089837761 11:121386344-121386366 CTGGGCTCTCTCACATGTCCAGG - Intergenic
1091197559 11:133744923-133744945 TTGAAGACTCTCTTATTTCCGGG - Intergenic
1093284825 12:17245848-17245870 TTGATCTTTCTCAGAATTCCTGG - Intergenic
1095176240 12:39095544-39095566 GTGAATTCTCTCAGCTTTCCTGG - Intergenic
1095339818 12:41076183-41076205 CTGAACTCCCTCACATGTTCGGG + Intergenic
1097607022 12:61768422-61768444 GTGAATTCTCTCAGCTTTCCTGG - Intronic
1098078145 12:66755751-66755773 GTGAATTCCCTGACATTTCCAGG - Intronic
1098408695 12:70154965-70154987 TTTATATCTCTCTCATTTCCTGG - Intergenic
1099722501 12:86382578-86382600 TTGAAGTCTCTGACATGCCCTGG - Intronic
1100781046 12:98026734-98026756 TTAGACTCTCTTTCATTTCCAGG - Intergenic
1101515244 12:105429060-105429082 TTGAACTGTCTCAGTTTTCCTGG + Intergenic
1102508728 12:113399936-113399958 CTGACCTCTCACACATTTGCTGG + Intronic
1103460225 12:121097856-121097878 TTCAGTTCTCTCTCATTTCCTGG - Intergenic
1104674947 12:130706131-130706153 TTGAACCCTCACACTATTCCAGG + Intronic
1107959199 13:45543673-45543695 TTTTACTCTCTCACAGTTCTGGG - Intronic
1108185358 13:47883234-47883256 TTGCAACTTCTCACATTTCCCGG + Intergenic
1109181375 13:59218050-59218072 TTGAACAGTTTCACATTTTCAGG - Intergenic
1109456942 13:62605496-62605518 TTTAATTCTATCACTTTTCCAGG - Intergenic
1119930774 14:78544052-78544074 ATTAACTGTCTTACATTTCCAGG + Intronic
1120676021 14:87422360-87422382 TTAAACTCTCTCACATAATCAGG + Intergenic
1122699333 14:103576912-103576934 TTGCCCTTCCTCACATTTCCGGG - Intronic
1125247050 15:37652774-37652796 GTGAATTCTCTCAGCTTTCCTGG - Intergenic
1126124373 15:45282199-45282221 ATGAACTCTCTCACACTTCTGGG - Intergenic
1129968155 15:79755262-79755284 TTGAATTCTTTTGCATTTCCAGG - Intergenic
1134331042 16:13251455-13251477 GTTAACCCTCTCACACTTCCAGG - Intergenic
1138458348 16:57133756-57133778 TAGAATTTTCCCACATTTCCTGG - Intronic
1140922876 16:79554970-79554992 CTGAACTCACTCACATTTCTGGG - Intergenic
1143364391 17:6396393-6396415 TTCAGCTCTCTCTTATTTCCTGG - Intronic
1143796696 17:9342689-9342711 TTGATCTCCCTGTCATTTCCTGG - Intronic
1144152959 17:12468581-12468603 TTGAACTCCCACTAATTTCCAGG + Intergenic
1144195087 17:12885475-12885497 TGGAACTCTCACACATTGCTAGG - Intronic
1144727597 17:17509664-17509686 TTGAACTCTCTGAAGTCTCCTGG - Intronic
1145179728 17:20736501-20736523 TTGATCTCCCTTTCATTTCCAGG - Intergenic
1149087360 17:52734029-52734051 TTGAAGTGTATCACAATTCCTGG + Intergenic
1149418062 17:56481033-56481055 TGGACCTCTTTCACATTTTCTGG + Intronic
1149453996 17:56772464-56772486 TAGAACCCGCTCACATTTCGTGG - Intergenic
1149635342 17:58163211-58163233 TTGACATTTATCACATTTCCTGG + Intergenic
1150481486 17:65514899-65514921 CTGAACTGTCTCTCATTTTCTGG + Intergenic
1152503473 17:80729770-80729792 TTTAACTCTGTCACATCTCTGGG - Intronic
1154120818 18:11651147-11651169 TTGAACCCTCAAACATTTGCAGG + Intergenic
1156701406 18:39830002-39830024 TTGACCTCTCCCCCATCTCCAGG + Intergenic
1156777912 18:40816046-40816068 TTTAACTCTCCAACATTCCCTGG + Intergenic
1156992357 18:43424716-43424738 TTCAATTCCCTCACATTTCTAGG - Intergenic
1157777288 18:50405606-50405628 CTGTAGTCTCTCACAGTTCCTGG - Intergenic
1163857459 19:19715950-19715972 TTTCTCTCTCTCACATTTCATGG + Intronic
1164193791 19:22935517-22935539 TTAAACTTTCACACATTTTCTGG - Intergenic
1164388985 19:27801331-27801353 TTGAACACTCTTACATCTCACGG + Intergenic
1167010897 19:46806793-46806815 CTGCACTCTCACACATTTGCTGG + Intergenic
925816219 2:7753387-7753409 TCAAACTGTTTCACATTTCCAGG + Intergenic
926379120 2:12266584-12266606 TGAAACTCTCTCACTTTTCTAGG - Intergenic
926952974 2:18264041-18264063 TTGAATTCTCACCCATTTCCTGG + Intronic
927598420 2:24418684-24418706 TTGACCCCTCCCACCTTTCCTGG - Intergenic
929686743 2:44041557-44041579 TTGGACACTCTCACAGGTCCTGG + Intergenic
930449660 2:51519223-51519245 ATTAACTCCCTCATATTTCCAGG + Intergenic
930573484 2:53115908-53115930 TTGAACTCTGAAAAATTTCCAGG + Intergenic
931008794 2:57883234-57883256 TTGTTCTTTCTGACATTTCCTGG + Intergenic
931904728 2:66830275-66830297 TGGAACCCACTCACATTCCCTGG + Intergenic
932259638 2:70316367-70316389 TTGAACTGTCCCATTTTTCCAGG + Intergenic
935487724 2:103678317-103678339 ATGGACTCTCTCACACTTTCAGG + Intergenic
936317776 2:111439847-111439869 TTAAACTCTGTTACATTTACAGG + Intergenic
936743436 2:115544095-115544117 TTTTACTATCTCACATTTTCAGG - Intronic
937491792 2:122377067-122377089 TTGAATTCACTCCCATTTCGTGG + Intergenic
942341462 2:174952742-174952764 TTGAAGTGTTTCTCATTTCCTGG - Intronic
943607972 2:189998192-189998214 GTGAATTCTCTCAGTTTTCCTGG + Intronic
944949730 2:204734292-204734314 TTGAACTCTCATACATTGCTGGG + Intronic
945209405 2:207366743-207366765 TTGAGCTCTCTCTCCTTCCCTGG - Intergenic
1170283709 20:14681148-14681170 TTGAACTCTCTTACATTGCTGGG + Intronic
1173888152 20:46479972-46479994 TTGAGATGTCTCACCTTTCCAGG + Intergenic
1174235279 20:49085335-49085357 TTCAAAGCTCTCACACTTCCTGG + Exonic
1178170792 21:30037710-30037732 TTGATATCTCTCATATTTTCTGG - Intergenic
1179681821 21:43027487-43027509 TTGCACTTTCTCACATTTAAAGG + Intronic
1179936390 21:44607733-44607755 TGGAACTCTCCAACATTTGCTGG + Intronic
1181477670 22:23178901-23178923 TTGCCCTGTCTCAGATTTCCAGG - Intergenic
1181992252 22:26846380-26846402 TTGAACTCTCTCCCTTTTCTGGG - Intergenic
949645896 3:6093621-6093643 TTGACCTCTCCCACACTTCAAGG + Intergenic
951980466 3:28560636-28560658 TGTAACTCTCTCATATGTCCAGG - Intergenic
953615874 3:44490151-44490173 TTGTACTCCCTAACATTACCTGG - Intergenic
953880758 3:46690264-46690286 TTGAACTCTCTCTCACTGCCTGG - Intronic
956009084 3:64811337-64811359 TTGATCTATCACATATTTCCAGG - Intergenic
956276547 3:67508155-67508177 TTGAACTCTTTCACCTTACTTGG - Intronic
956292879 3:67679743-67679765 GTGACCTCTCCCACATTCCCAGG - Intergenic
957882728 3:86241524-86241546 GAGAACTCACTCACATTTCTAGG + Intergenic
958574177 3:95926410-95926432 ATGAATTCTCTCACATTTGTTGG - Intergenic
958576726 3:95959303-95959325 TTGAACTCTTTCTGACTTCCTGG - Intergenic
959036208 3:101367908-101367930 TGGAACTCACTCTGATTTCCAGG - Exonic
960520270 3:118646763-118646785 TTTAACTGTTTCACATTTTCTGG - Intergenic
962169923 3:133090296-133090318 TTGAACTCTCTGGCATTTCAAGG + Intronic
962772344 3:138624495-138624517 CTGAACTCTGTCTCATTTCCAGG - Intronic
962926139 3:139995010-139995032 TTTATCTCTCTGACATTTGCTGG + Intronic
964017431 3:151964659-151964681 GTGAATTCTCTCAGCTTTCCTGG - Intergenic
964373783 3:156029380-156029402 TTCATCTCTCTCACTTTTCCTGG - Intergenic
965020012 3:163217416-163217438 ATCAACTCTCCCACAGTTCCAGG - Intergenic
965298311 3:166977147-166977169 TTAAACTTTCTCAGATCTCCAGG - Intergenic
966821821 3:183930792-183930814 ATGTACTATCTCACAGTTCCGGG - Intronic
967771854 3:193342645-193342667 TGGAACTCTCTGAGTTTTCCTGG + Intronic
967792823 3:193567550-193567572 TTAAACTCTCTTACATTTCTGGG - Intronic
969944068 4:10764771-10764793 TTGAAATCTCACCCATTTCTAGG + Intergenic
974164963 4:58190500-58190522 GTGGATTCTCTCACCTTTCCTGG - Intergenic
979276262 4:118817404-118817426 TTTTCCTCTCTCAGATTTCCAGG - Exonic
980555568 4:134399255-134399277 TTGAATTCTCTCAGTTTCCCAGG - Intergenic
983114455 4:163795618-163795640 TTGAACTGTCTGTCATTTCCCGG + Intronic
983693148 4:170497194-170497216 TCCAACTCCCTCACATTTGCAGG + Intergenic
987220609 5:15787150-15787172 ATGTACTCTCTCACAGTTTCCGG - Intronic
988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG + Intronic
990218643 5:53562528-53562550 TTCAAATCTCTTACATTTGCAGG - Intronic
994285467 5:97959561-97959583 TGGAACTCTCACACATTTGGTGG - Intergenic
994887857 5:105588357-105588379 TTGAACTCTCTCATAGTTCTGGG + Intergenic
995801858 5:116005340-116005362 TTGAACTCCCTGGCATTGCCAGG - Intronic
998409353 5:141897577-141897599 TTGAACCATCTCTCAGTTCCAGG - Intergenic
999566296 5:152866152-152866174 TTGAAATTTCTTACATTTTCAGG - Intergenic
1000975391 5:167758812-167758834 TTAAACTCTCTCATATTGCCAGG + Intronic
1002686898 5:181019801-181019823 TGAAACTGTTTCACATTTCCTGG - Intergenic
1003814845 6:9827561-9827583 TTGAACTCACTCACATTCAGAGG - Intronic
1005160550 6:22856979-22857001 TAGAAAACTCACACATTTCCAGG - Intergenic
1006745712 6:36340697-36340719 GTGAACTCTCACTCCTTTCCCGG + Intergenic
1007277412 6:40685314-40685336 TTGCATTCTCTCACTCTTCCTGG - Intergenic
1008311141 6:49975778-49975800 TTAATCTCTCTGCCATTTCCAGG - Intergenic
1008635813 6:53409665-53409687 TTGAACTCTGAAACATTTCCAGG + Intergenic
1008714495 6:54272588-54272610 TTGGACTCTCCCTCATTGCCAGG + Intergenic
1009348867 6:62649749-62649771 TTGAACCCATACACATTTCCTGG - Intergenic
1010516511 6:76778835-76778857 TTAAACTGTCTCTCAATTCCTGG + Intergenic
1010996728 6:82541990-82542012 TTGGACTCTCTCCCATGTCCTGG - Intergenic
1011180863 6:84618907-84618929 TTAAACTCTCTCTTACTTCCAGG + Intergenic
1015347716 6:132179658-132179680 GTGAATTCTCTCAGCTTTCCTGG - Intergenic
1016310742 6:142730915-142730937 GTGAACACACGCACATTTCCTGG + Intergenic
1017651289 6:156585123-156585145 TAGAACTCTCACACACTGCCTGG + Intergenic
1017803821 6:157925440-157925462 TTGAACCCTCTCATATGACCTGG + Intronic
1020792040 7:12639469-12639491 TTGAACTGTCTCACTTCCCCTGG - Intronic
1020903216 7:14031634-14031656 GAGAACTCTCTCACCTTTCAAGG - Intergenic
1021400886 7:20208760-20208782 TTGAAGTCTCTGACATGCCCCGG - Intronic
1022069177 7:26894383-26894405 TTGAAATCTGACACATTTTCAGG + Intronic
1022540768 7:31133621-31133643 CTGAGCTCTCTCAAATGTCCTGG + Intergenic
1025170555 7:56752788-56752810 TAGCCCTTTCTCACATTTCCAGG - Intergenic
1026174122 7:67980976-67980998 GAGACCTCTCTCAGATTTCCTGG - Intergenic
1026686797 7:72517420-72517442 TTGAAATCTTTCACCTTTCCTGG + Intergenic
1027270801 7:76517531-76517553 GTTAACTCTCTCTCAGTTCCAGG - Intergenic
1027320562 7:77007361-77007383 GTTAACTCTCTCTCAGTTCCAGG - Intergenic
1027828631 7:83149399-83149421 TGGAGCTCTTTCACATTTCTTGG + Intronic
1029008642 7:97235267-97235289 TTGAAATCTGTCTCATTTCTTGG + Intergenic
1029862888 7:103593683-103593705 TTGAACTGTAGCACATATCCAGG + Exonic
1031649312 7:124266888-124266910 TTGAGCTCTATTACCTTTCCTGG + Intergenic
1033995244 7:147337726-147337748 TTGAACCCTCTGCCATTTCTAGG + Intronic
1037755631 8:21708353-21708375 TAGCACTCTCTCTCATTTGCTGG - Intronic
1040816621 8:51514786-51514808 TGCAACTTTCTCCCATTTCCAGG - Intronic
1041208459 8:55522805-55522827 TTAAACTCCATCCCATTTCCAGG + Intronic
1041280393 8:56204387-56204409 TTGAACTATCTTAAGTTTCCAGG + Intronic
1042827123 8:72990897-72990919 TTGAGGTCTCTGACATGTCCTGG - Intergenic
1042999869 8:74744816-74744838 TTGAATTTTCTTTCATTTCCTGG - Intronic
1043176662 8:77029994-77030016 TTGAACCTTCACACACTTCCTGG + Intergenic
1043360558 8:79466858-79466880 TTGACCTCTCTCAGATATTCGGG + Intergenic
1043373447 8:79620546-79620568 TTGAACTTTCTGACATGTACAGG - Intronic
1045988434 8:108277574-108277596 GTTAACTCACTCACACTTCCAGG + Intronic
1047749626 8:127870409-127870431 ATGCACTCTCTCACAGTTCTGGG - Intergenic
1047890493 8:129303261-129303283 TTGGATTCTCTCAGCTTTCCTGG + Intergenic
1049929406 9:441627-441649 TAAAAATTTCTCACATTTCCTGG - Intronic
1050232554 9:3542603-3542625 TAGGACTCTCACACATTTCTGGG - Intergenic
1051875455 9:21788242-21788264 TTGAACTCTCACACAAACCCTGG + Intergenic
1053313136 9:37032047-37032069 TTGAACTGTCGCCCTTTTCCAGG + Intronic
1053581107 9:39405139-39405161 TGGAAATCTTTCACATTTCTTGG + Intergenic
1053845596 9:42233199-42233221 TGGAAATCTTTCACATTTCTTGG + Intergenic
1054102694 9:60963943-60963965 TGGAAATCTTTCACATTTCTTGG + Intergenic
1054583668 9:66942923-66942945 TGGAAATCTTTCACATTTCTTGG - Intergenic
1054768850 9:69066410-69066432 TTGAACTCTAGCACACTTCTTGG - Intronic
1055584876 9:77748354-77748376 TTGAATCCTCTCATCTTTCCAGG - Intronic
1055821391 9:80268795-80268817 TTGAAATCTGTGACATTACCTGG - Intergenic
1056209033 9:84347912-84347934 TTGAACTCACACATATTCCCTGG - Intergenic
1057717275 9:97504483-97504505 TTTAACTCTCTCCCCTCTCCTGG - Intronic
1060250609 9:121983888-121983910 TTGGACTCTAACACATTCCCTGG - Intronic
1060770484 9:126328063-126328085 TTTAACTCTCTAAGCTTTCCTGG - Intronic
1060908620 9:127330780-127330802 TGGAACTCTTCCACAGTTCCGGG - Intronic
1062095169 9:134699374-134699396 TTGTACTTTGTGACATTTCCTGG - Intronic
1185805275 X:3051196-3051218 TTGAAGTGTGTCACCTTTCCTGG + Intronic
1187632239 X:21186396-21186418 TTGCTCTCCCTCACATTTCTGGG + Intergenic
1187656013 X:21474552-21474574 GTTAACTCTCTCACACTACCAGG + Intronic
1189447437 X:41093912-41093934 TTGACTTCTCTCACATTTTCGGG + Intronic
1189742491 X:44134275-44134297 TTAAACTCCCTCACACTTTCTGG - Intergenic
1189946118 X:46180564-46180586 GTGAATTCTCTCAGCTTTCCTGG + Intergenic
1190171933 X:48118250-48118272 TTCACCTCTCTCAGCTTTCCTGG + Intergenic
1190210175 X:48440231-48440253 TTCAACTCTCTCAGCTTTCATGG + Intergenic
1190731593 X:53230076-53230098 TTGCATTCTCTCGCATCTCCAGG + Intergenic
1191884141 X:65872371-65872393 GTGAATTCTCTCAGTTTTCCTGG + Intergenic
1197079230 X:122392828-122392850 CTGAACTCTTTCAGTTTTCCTGG - Intergenic
1197314347 X:124946040-124946062 GTTAACCCTCTCACACTTCCAGG + Intronic
1197545138 X:127815424-127815446 GTGAATTCTCTCAGTTTTCCTGG - Intergenic
1198090268 X:133321927-133321949 TTGTTCTCTCTCTCATCTCCAGG - Intronic
1201934788 Y:19396684-19396706 CTGGACTATCTCACCTTTCCTGG + Intergenic