ID: 906926300

View in Genome Browser
Species Human (GRCh38)
Location 1:50120871-50120893
Sequence ATGTGTGGCCAGAGAGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 506
Summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 452}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906926298_906926300 -1 Left 906926298 1:50120849-50120871 CCAGTGCTCATTTTGTGGGATAA 0: 1
1: 0
2: 1
3: 11
4: 161
Right 906926300 1:50120871-50120893 ATGTGTGGCCAGAGAGAAGATGG 0: 1
1: 0
2: 4
3: 49
4: 452
906926295_906926300 10 Left 906926295 1:50120838-50120860 CCAACAGGTCTCCAGTGCTCATT 0: 1
1: 0
2: 2
3: 21
4: 168
Right 906926300 1:50120871-50120893 ATGTGTGGCCAGAGAGAAGATGG 0: 1
1: 0
2: 4
3: 49
4: 452

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906926300 Original CRISPR ATGTGTGGCCAGAGAGAAGA TGG Intronic
900267873 1:1768626-1768648 ATGTGGGGACACAGAGAAGATGG + Intronic
900531670 1:3156862-3156884 CCGTGTGGCCTGAGAGAAGCAGG + Intronic
901265834 1:7910133-7910155 ATGAGGGGCCAGAGACAGGAGGG - Intergenic
901270064 1:7945395-7945417 GTGTGGGTCCAGAGAGCAGATGG - Intergenic
902167132 1:14581658-14581680 AGATGAGGCCAGAGAGAAGTAGG - Intergenic
903552547 1:24168073-24168095 ATGTGTGGATAGAGAGATGGAGG - Intronic
903764163 1:25722780-25722802 ATGTGGGGCAGAAGAGAAGATGG + Intronic
903999572 1:27331183-27331205 GGGTGTGGCCATGGAGAAGAGGG + Intronic
904336261 1:29800331-29800353 AAGTCTGGCCAGAGACAACAGGG + Intergenic
905520512 1:38595896-38595918 ATGTGTGGCCACAGAGGACAGGG + Intergenic
905662772 1:39740014-39740036 ATGGGTGGGCAGAGATGAGAGGG + Intronic
905972437 1:42152426-42152448 AGGTTGGGTCAGAGAGAAGAGGG - Intergenic
906280156 1:44547586-44547608 AAGTGTGCACCGAGAGAAGAGGG - Intronic
906601862 1:47137433-47137455 AGGGGTGGTCAGAGAGAGGAAGG + Exonic
906926300 1:50120871-50120893 ATGTGTGGCCAGAGAGAAGATGG + Intronic
906931083 1:50170159-50170181 TTGTGGGGCATGAGAGAAGAAGG + Intronic
907431614 1:54415378-54415400 CTGTGTGCCCAGAGAGGTGAAGG - Intergenic
908782693 1:67706060-67706082 ATGTGTGTACAGACAGAAGGAGG + Intronic
910271072 1:85395304-85395326 CTGTGTGGTCAGAAAGATGAGGG + Intronic
910668126 1:89746013-89746035 ATCTATGGCCAGAGGGAAGAGGG - Intronic
910691562 1:89970684-89970706 ATGTAAAGACAGAGAGAAGATGG + Intergenic
910863851 1:91769411-91769433 GTGTGTGCCCAGAGAGAAGTTGG - Intronic
911575665 1:99574417-99574439 ATGTGGGGCTAGGGAGAAGTGGG + Intergenic
912468059 1:109887502-109887524 CAGAGTGGCCAGAGACAAGAGGG - Intergenic
913128669 1:115816919-115816941 ACCTGTGGCCAGAGGGAAGCAGG + Intergenic
914716525 1:150258916-150258938 GTGGGTGTCCAGAGAGCAGAAGG + Intronic
915091376 1:153428659-153428681 ATGTGTGGGCAGAGGGAGGAGGG + Intergenic
915483678 1:156204996-156205018 GTTTGTGGCCAGGGAGAAGTAGG - Intronic
915514124 1:156402713-156402735 AACTGAGGCCAGAGAGGAGAAGG - Intergenic
916847869 1:168671601-168671623 ATGTGTGGCAAGAGGGAAGAGGG + Intergenic
917199256 1:172498169-172498191 TTGGGTGGCTAGAGAGAAGCTGG + Intergenic
918170264 1:181989631-181989653 ATGTGTGAGGAGAAAGAAGAAGG - Intergenic
918314763 1:183313958-183313980 GTGTGTGGCCACTGAGAACAGGG + Intronic
919113256 1:193246665-193246687 ATGGGTGGCAAGAGAAAAGTGGG - Intronic
919614185 1:199784982-199785004 AGGTGAGGCTAGAGAGAAGGTGG - Intergenic
919664184 1:200276364-200276386 ATGTGTGGGAGGAGAGAGGATGG - Intergenic
919816385 1:201443413-201443435 AGGTGTGGATAGAGAGAAGCTGG + Intergenic
919927961 1:202202265-202202287 ATGTGTGCCCTGAGGGAAAAAGG - Intronic
921922561 1:220685795-220685817 ATGTGAGGACAGAAAGAAGGTGG + Intergenic
921980808 1:221256818-221256840 TTGTGGAGCCAGAGGGAAGAGGG + Intergenic
922241290 1:223756925-223756947 AACTGAGGCCAGAGAGGAGAGGG + Intronic
923044164 1:230343171-230343193 AGGTGCAGCCAGAGAGGAGAAGG - Intronic
923700289 1:236293722-236293744 ATGAGGACCCAGAGAGAAGATGG + Intergenic
924187596 1:241511236-241511258 ATGTGAGGACACAGAAAAGATGG + Intronic
924803343 1:247343849-247343871 ATGAGAGGCCAGAGACAGGAAGG + Intergenic
1062881658 10:983539-983561 ATGTGAGCACAGAGAGAAGGCGG - Intergenic
1062900212 10:1138205-1138227 TTGTGAGGCCAGGTAGAAGAGGG - Intergenic
1064283509 10:13971824-13971846 ATGTGGGGCCAGGGACCAGAGGG - Intronic
1064502481 10:15989251-15989273 AGGTGTGGGAAGAGAGAAGAGGG + Intergenic
1064918267 10:20486679-20486701 CTTACTGGCCAGAGAGAAGAGGG + Intergenic
1066055952 10:31680203-31680225 GTGTATGACCAGAGGGAAGAGGG + Intergenic
1066333558 10:34452060-34452082 ATGTGTCGACAAAGAGAAGGAGG + Intronic
1066596979 10:37062014-37062036 ATGTGTTGCAATAGAGGAGAGGG + Intergenic
1067517408 10:46963580-46963602 ATGTGTGTACAGAGGGATGAGGG + Intronic
1068561512 10:58519929-58519951 ATGTGTGGACAGTGGGAGGAGGG - Intronic
1069047885 10:63762200-63762222 AAGGGTGGCCACAGGGAAGAGGG + Intergenic
1069773960 10:70916193-70916215 ATGTGTGCCCAGCGTGATGAGGG - Intergenic
1071602051 10:86963099-86963121 AAGGGTGGCCAGGGAGACGAGGG - Exonic
1071742644 10:88378331-88378353 ATGAGTGGCCAGAAACAGGATGG - Intronic
1073237272 10:102028260-102028282 ATGTGTGGCCTGAGTGCAGTGGG + Intronic
1073804698 10:107084513-107084535 ATGTATGGGAAGAGAAAAGAGGG + Intronic
1074040217 10:109780828-109780850 ATGTGGGGCCAGAGAGTACAAGG + Intergenic
1077248502 11:1550537-1550559 ATGTGTGGCTAGGGAGTAGAAGG - Intergenic
1079686031 11:23360937-23360959 CCGTGTGGCCAGTGAGAAGTAGG - Intergenic
1080740491 11:35059434-35059456 ATGAATGCCCAGAGAGAGGATGG - Intergenic
1081620349 11:44615596-44615618 ATTTGTGGCCAGAGAGCATGGGG + Intronic
1084018638 11:66403346-66403368 ATGTGAAGATAGAGAGAAGAAGG + Intergenic
1084218298 11:67663400-67663422 CTGTGTGGGCACAGAGAACAAGG + Intronic
1084431835 11:69115633-69115655 AGGTGTGTCCAGAGAGAGGGAGG + Intergenic
1085745629 11:79112008-79112030 AGGTGGGGGCAGAGAGAGGAAGG + Intronic
1085892642 11:80599047-80599069 ATGTGTTGCAATAGAGGAGAGGG - Intergenic
1086696979 11:89858904-89858926 AGGGGAAGCCAGAGAGAAGAGGG + Intergenic
1086709179 11:89985583-89985605 AGGGGAAGCCAGAGAGAAGAGGG - Intergenic
1087526209 11:99316623-99316645 ATGTGTGCCCTGGGAGAAAATGG - Intronic
1087958438 11:104318951-104318973 ATGTGGGGTCAGAGTGTAGAGGG - Intergenic
1088438956 11:109846994-109847016 ATGTTTGACCAGTGAGAAGAAGG - Intergenic
1088541562 11:110919025-110919047 AACTGAGGCCAGAGAGAAGCTGG + Intergenic
1088986413 11:114913267-114913289 ATTTGTGGGCAGAGAGAGGCAGG + Intergenic
1089159794 11:116428678-116428700 GTGAGTGGCCAGGGAGAAGATGG + Intergenic
1090208672 11:124899936-124899958 CTGTGGGGCCAGAGTGATGAAGG + Intergenic
1090539495 11:127685237-127685259 AGGTGCTGGCAGAGAGAAGAAGG + Intergenic
1091303303 11:134521621-134521643 AGGGGTGGCCAGGGAGAGGAGGG - Intergenic
1091330013 11:134724938-134724960 AAGTGTGGCCCGAGCGGAGACGG + Intergenic
1092740431 12:11623448-11623470 TTGTGTTGCCAGAGGGAATAGGG - Intergenic
1092852541 12:12643571-12643593 ATGCATGGCCTGAGAGAAGAGGG - Exonic
1092897992 12:13032189-13032211 ATGTATGGCATGAGAGAAAAAGG - Intergenic
1094414803 12:30205151-30205173 GTGTGTGGCCAGAGACCAGAGGG - Intergenic
1094414814 12:30205269-30205291 GTGTGTGGCCAGAGACCAGAGGG - Intergenic
1095988844 12:48019668-48019690 ATTTGTGCCAAGAGAGGAGAGGG - Intergenic
1096555717 12:52402480-52402502 ATGGGTGGCAAGAAAGAGGAAGG - Intronic
1097442583 12:59629070-59629092 ATGTGAGGACAGCAAGAAGATGG - Intronic
1098418025 12:70258909-70258931 ATGTGTGGCTAGAGTGTAGTGGG + Intronic
1098772866 12:74576706-74576728 AGGTGAGGACAGAGAGAAGGTGG + Intergenic
1100220688 12:92501907-92501929 ATGTGTAGCTAGAGAGCAGAAGG + Intergenic
1100355684 12:93827009-93827031 AAGTGGGGCCAGGGACAAGAAGG + Intronic
1100678992 12:96898413-96898435 ATGGCTTGGCAGAGAGAAGATGG + Intergenic
1101220618 12:102635412-102635434 ACGTGAGGCCAGGGAGAAGGTGG + Intergenic
1102544731 12:113646255-113646277 ATGGATGCCCAGAGAGATGAAGG + Intergenic
1103874864 12:124119263-124119285 AACTGAGGCCAGAGAGAGGACGG + Intronic
1103987297 12:124776344-124776366 ATGTGAGGACACAGAGAAGGCGG + Intergenic
1104460938 12:128955285-128955307 ATGTGTACACAGAGAGATGAGGG - Intronic
1104995340 12:132650750-132650772 GTGTGGGGGCAGACAGAAGAGGG - Intronic
1105069017 12:133222695-133222717 ATGCAGGGCCAGAAAGAAGAAGG - Intronic
1105284842 13:18995402-18995424 AGGCCAGGCCAGAGAGAAGATGG + Intergenic
1106522872 13:30513241-30513263 TGGGGTGGCCAGAGAGAAAATGG - Intronic
1106544768 13:30720924-30720946 ATTTGTGCCCACAGAGAAGTGGG - Intronic
1106607104 13:31238954-31238976 ATGTGAAGCCTGAGAGGAGAAGG + Intronic
1106686001 13:32059771-32059793 ATCTGTGTACAGACAGAAGAGGG - Intronic
1107112716 13:36715261-36715283 ATGTGAGGTCCTAGAGAAGAGGG + Intergenic
1107671311 13:42749223-42749245 ATGAGTGGCCTGAGAGAGAAGGG + Intergenic
1108811227 13:54225515-54225537 ATGAGGGGCCAGAGATAGGAGGG + Intergenic
1109374575 13:61474540-61474562 ATGTGTGAGAAGAGAGAAAAGGG + Intergenic
1109411148 13:61971108-61971130 ATGTGAGGACAGAGACAAGCAGG - Intergenic
1110142401 13:72146972-72146994 ATGTGTGGCAGGAGAGGTGATGG - Intergenic
1110242248 13:73282305-73282327 AGTTTTGGCCAGTGAGAAGAAGG - Intergenic
1111072765 13:83189621-83189643 TTGTGTTGCCAGATAGAAGAAGG + Intergenic
1112103726 13:96218177-96218199 CTGTGTCCCCAGAGAGAAGTGGG + Intronic
1113067253 13:106384869-106384891 ATGTGGGATCATAGAGAAGAAGG + Intergenic
1114234441 14:20812264-20812286 ATGTGTTTCCTGAGAGAACATGG - Intergenic
1115791155 14:36880056-36880078 CTGAGTGGCCAGGAAGAAGAGGG - Intronic
1116034857 14:39615543-39615565 CTGTGTGCCCTGAGAGAGGATGG + Intergenic
1116232400 14:42234422-42234444 ATGTGAAGACAAAGAGAAGATGG - Intergenic
1116689709 14:48089693-48089715 ATGTGTAGTCAGAAAGAAGTGGG - Intergenic
1117659534 14:57989098-57989120 AGAGGTGGCAAGAGAGAAGAAGG - Intergenic
1118768431 14:68925669-68925691 ATGTCTGGGCAGAGACAAGAAGG + Exonic
1120367610 14:83590966-83590988 ATGAGGGGCCAGAGACAGGAGGG - Intergenic
1120536705 14:85705343-85705365 ATGTGAAGACAGAGAGAAGGTGG - Intergenic
1121586223 14:95064800-95064822 AGATGTCACCAGAGAGAAGAAGG + Intergenic
1122170891 14:99874300-99874322 GTGTGCGGACAGAGAGCAGAAGG + Intronic
1122958448 14:105083555-105083577 ATGTGTGGATAGAGAGATGGTGG - Intergenic
1123039130 14:105483246-105483268 AGGTGTGGAAAGAGGGAAGAAGG - Intergenic
1123104681 14:105835078-105835100 AGGGTTGGCCTGAGAGAAGACGG + Intergenic
1123811465 15:23930582-23930604 ATGTGTAGTCACAGAGAAAAAGG + Intergenic
1124208600 15:27743936-27743958 ATTTGTGGCCAGGGAGCAGCTGG - Intergenic
1126261366 15:46696639-46696661 TAGAGTGACCAGAGAGAAGAGGG - Intergenic
1127386739 15:58473217-58473239 TTATGTGACCAGAGAGAAGCAGG + Intronic
1127827287 15:62715861-62715883 AGGTGGGGACAGAGGGAAGAGGG - Intronic
1128311677 15:66634829-66634851 ATGAGTGCCCATAGAGGAGAAGG - Intronic
1128403563 15:67311902-67311924 ATGAGTGGACAGAGAGAAGAGGG + Intronic
1128510524 15:68311402-68311424 ATCTGTGGCCAGAGACAGGGAGG + Exonic
1128793679 15:70450087-70450109 ATGGGTGGACAGAGGGATGAGGG + Intergenic
1130220826 15:82018141-82018163 CTGTGTGTCCAGGGAGAAGTGGG + Intergenic
1130875271 15:88008410-88008432 ATGTGAGCCCCGAGAGAAGCTGG + Intronic
1131782119 15:95871045-95871067 ATGGGAGGCCACACAGAAGAGGG + Intergenic
1131858828 15:96629437-96629459 ATAAGTGGCCAGAAGGAAGAAGG - Intergenic
1131881834 15:96870485-96870507 ATGTGTTGCAAGAGTGAAAAGGG - Intergenic
1133180308 16:4049257-4049279 ACCTGGGACCAGAGAGAAGAGGG + Intronic
1133550371 16:6848615-6848637 ATGTGTGTAGAGAGAGATGATGG + Intronic
1135825721 16:25726633-25726655 ATGTGAGGGCAGGGAGAACAAGG - Intronic
1136096459 16:27960587-27960609 ATCTGAGGGCAGAGAGACGAGGG - Intronic
1136417568 16:30113150-30113172 AGGTGAGGCCAGAGGGAGGATGG - Intronic
1136690953 16:32028641-32028663 CTGGATGTCCAGAGAGAAGATGG - Intergenic
1137625366 16:49904362-49904384 GTGTGTGGACTGAGAGATGAGGG - Intergenic
1137783676 16:51119548-51119570 TTGGGAGGCCTGAGAGAAGAAGG - Intergenic
1138125304 16:54433571-54433593 ATGTGAGGCCAGGAAGAAAAGGG - Intergenic
1138746381 16:59367567-59367589 ATGTGCTGGCAAAGAGAAGATGG - Intergenic
1139940868 16:70604523-70604545 ATGTGTTGGCAGACAGAGGATGG - Intronic
1140014107 16:71165216-71165238 AGATGTGGCCAGAGAAACGATGG - Intronic
1142434705 16:90048698-90048720 ATACGTTGCCAGAGAGAAGACGG - Intergenic
1143092959 17:4460174-4460196 ACGTGAGGACAGAGAGATGATGG + Intronic
1143461644 17:7108161-7108183 AGGGGTGGCCAGAGAGAGGTGGG - Intronic
1143970138 17:10789481-10789503 TCCTGTGCCCAGAGAGAAGATGG + Intergenic
1144162916 17:12579099-12579121 ATGAGTGGCAAGAGAGGAGAAGG - Intergenic
1144670476 17:17129986-17130008 AAGTGTGACCAGGGAGGAGAGGG + Intronic
1144788714 17:17845856-17845878 ATGTGCTGCCAGAGAGGACAGGG + Intronic
1145009379 17:19358994-19359016 ATGTGAGGTCTGAGAGAAGGAGG - Intronic
1145924372 17:28634715-28634737 GTGTGTTGCCATAGAGACGACGG + Exonic
1147331752 17:39703377-39703399 ATGGGTGGCCAAACATAAGATGG - Intronic
1147399963 17:40174780-40174802 CTGGGTGGGCAGAAAGAAGAGGG + Intergenic
1148691317 17:49528491-49528513 AGGGGTGGCCTGAGGGAAGAGGG + Intergenic
1148960630 17:51389711-51389733 AACTGAGGCCAGAGAGGAGAAGG + Intergenic
1149543299 17:57484763-57484785 ATGGGTGGTCTGAGAGAGGACGG - Intronic
1150321382 17:64217256-64217278 CTGGGAGGACAGAGAGAAGAGGG - Intronic
1150434726 17:65144966-65144988 ATGTGAGAACAGAGAGAAGACGG - Intronic
1150484681 17:65535696-65535718 CTGTGTGGCCAGTCAGCAGAGGG - Exonic
1151151487 17:72091704-72091726 ATGTGTGGTTAGAGAGAGCAGGG - Intergenic
1151381257 17:73727280-73727302 AGGTGTGTCCAGAGAAGAGAGGG + Intergenic
1151398059 17:73838054-73838076 ATTTGAGGCCAGTGAGAATAAGG + Intergenic
1151428307 17:74045680-74045702 AGGTTTGGCTAAAGAGAAGAGGG - Intergenic
1152584733 17:81183830-81183852 CTGTGTGGCCAGTGAGCAGCTGG - Intergenic
1153223134 18:2879114-2879136 ATGTCGGGGGAGAGAGAAGATGG + Intronic
1153756812 18:8292373-8292395 ATGGGAGCCCAGAGAGAAAAGGG - Intronic
1153978069 18:10286889-10286911 ATTTTTGGCCAGAGTGCAGAGGG - Intergenic
1154235970 18:12606100-12606122 GTGGGTGGACAGAGAGGAGAGGG - Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156179345 18:34584794-34584816 AAGTGTTTTCAGAGAGAAGAAGG + Intronic
1156625303 18:38901070-38901092 GTGTGGGGAGAGAGAGAAGAAGG + Intergenic
1157312201 18:46560698-46560720 AGGTGTGGCCGGAGAGAGGGAGG - Intronic
1157680562 18:49602269-49602291 ATGAGAGGCCAGAGACAGGAGGG - Intergenic
1157681152 18:49608050-49608072 ATGAGAGGCCAGAGACAGGAGGG + Intergenic
1157769311 18:50331725-50331747 ATACTTGGCCAGAGAGAAAAAGG + Intergenic
1158376819 18:56880139-56880161 ATGTCTGGCCAGCGAGTAGTTGG - Exonic
1158803953 18:60947115-60947137 ATGTATGGAGAGAGAGGAGAGGG - Intergenic
1158966323 18:62625247-62625269 AGGTGTGGCCCGAGAGCTGAGGG + Intergenic
1159299580 18:66545424-66545446 ATATGGGGGCAGAGAGAGGAAGG - Intronic
1159553459 18:69921188-69921210 AGGTGAGGGCAGAGAGAAGGAGG - Intronic
1159627311 18:70709577-70709599 ATGTGTGTTCAGAGCTAAGATGG - Intergenic
1162762124 19:12894968-12894990 ATGAGTGGCCAGAGATGAGGTGG - Intronic
1164581704 19:29438980-29439002 ATGTAGGGAGAGAGAGAAGAAGG + Intergenic
1164858627 19:31544904-31544926 CTAAGTGGCCAGAGTGAAGAGGG - Intergenic
1164974385 19:32560892-32560914 AAGTCTGGCCAGGGAGAAGGGGG + Intergenic
1165101373 19:33440497-33440519 AGGTGGGGCCAGAGAGGTGAGGG - Intronic
1165144329 19:33721798-33721820 ATGTGTGGGCAGATAGGTGATGG + Intronic
1165145769 19:33729053-33729075 AGGCGTGGGCAGAGAGGAGATGG + Intronic
1166597277 19:44060917-44060939 ATGTTTGGCCATTTAGAAGAAGG - Intronic
1168679040 19:58300475-58300497 ATCTGTGGCCAGTGAGACTAAGG - Exonic
925363524 2:3295754-3295776 GTGTGTGTGCAGAGAGAGGACGG - Intronic
925363568 2:3295960-3295982 GTGTGTGTGCAGAGAGAGGATGG - Intronic
925363587 2:3296060-3296082 GTGTGTGTGCAGAGAGAGGAGGG - Intronic
925363655 2:3296375-3296397 GTGTGTGTGCAGAGAGAGGATGG - Intronic
925538714 2:4943200-4943222 ACGTGTGTACACAGAGAAGAGGG + Intergenic
926216621 2:10909537-10909559 AGGTGTGGCCAGGCAGAAGCAGG - Intergenic
926635277 2:15171841-15171863 ATGTGAGGACAGTGAGAAGGCGG + Intronic
927437873 2:23085750-23085772 ATATGAAGCCAGAGAGAAGGGGG + Intergenic
928283432 2:29968550-29968572 ATGGCTGGCCAAAGAGAAGAAGG + Intergenic
929021346 2:37556463-37556485 AGGTTTGGCCAGAGACAAGGAGG - Intergenic
929394191 2:41503341-41503363 ATGCTTGGGCTGAGAGAAGAAGG - Intergenic
929710906 2:44265599-44265621 TTGTGTGGCATGAGATAAGAAGG - Intergenic
929920605 2:46168761-46168783 GTTTGAGGACAGAGAGAAGAGGG + Intronic
929930995 2:46255367-46255389 AAGAGAGGCCACAGAGAAGAAGG - Intergenic
930164091 2:48186792-48186814 TTGTGAGGCTAGAGACAAGATGG - Intergenic
930237999 2:48906108-48906130 ATATGTGGTCAGAGGGATGATGG + Intergenic
931238513 2:60432406-60432428 ATCTGTGGTGAGAGAGAAGGAGG - Intergenic
931259635 2:60605979-60606001 ATGTGAGGCAAGTGAAAAGAGGG + Intergenic
932452069 2:71817356-71817378 GTGTGTTGCCCTAGAGAAGAGGG + Intergenic
932598162 2:73107029-73107051 AATGGTGGCCAGAGAGGAGAGGG - Intronic
935371333 2:102350157-102350179 ATGGGTGGCCAGTGGGAAAATGG - Intronic
935809049 2:106778034-106778056 ATGTGAAGAAAGAGAGAAGATGG + Intergenic
936157372 2:110057215-110057237 ATGTATCTGCAGAGAGAAGAAGG - Intergenic
936187320 2:110314229-110314251 ATGTATCTGCAGAGAGAAGAAGG + Intergenic
936270171 2:111043099-111043121 TTGTGGGGCCAGAGAAAAGGAGG + Intronic
936490871 2:112971037-112971059 ATGTGAGAACAGAGAGAAGGCGG + Intergenic
936547953 2:113409099-113409121 TTGTGAGTCCAGAGAGGAGAAGG + Intergenic
936578013 2:113671372-113671394 AAGTGAGGCCAGTGAGAACAAGG + Intergenic
937103060 2:119286466-119286488 TGGTGTGCCCAGAGAGAACAGGG + Intergenic
937275802 2:120683342-120683364 AGGCAGGGCCAGAGAGAAGACGG - Intergenic
937399953 2:121573886-121573908 ATGTGTGGTAAGAGAAAATAGGG - Intronic
937637905 2:124177275-124177297 ATGAGGGGCCAGAGACAGGAGGG + Intronic
937666138 2:124489342-124489364 ATGTGAAGACAGGGAGAAGAGGG - Intronic
938779825 2:134575091-134575113 ATGGGAGGCCAGAGGGAGGAAGG + Intronic
940147408 2:150561078-150561100 ATGAGAAGCCAAAGAGAAGAGGG - Intergenic
940279819 2:151977580-151977602 TTGTTTGGACAGAGAGAAGAAGG + Intronic
940629634 2:156221414-156221436 AAGGGAAGCCAGAGAGAAGAAGG + Intergenic
940967477 2:159855784-159855806 ATCTGTGGCCAGAATGAAAAGGG - Intronic
941817434 2:169811383-169811405 ATGATTTGCCAGAGAGAATAGGG + Intronic
942447154 2:176085657-176085679 GTGTGTCGGCAGAAAGAAGAGGG - Intergenic
942934831 2:181542148-181542170 AAGTGTGGACAGTGAGAAGGGGG + Intronic
943503638 2:188724642-188724664 ATGAATGGACAGAGAGAATATGG + Intergenic
943590909 2:189795564-189795586 ATCTGTGTCCAGAGAAAACAAGG + Intronic
943781085 2:191825003-191825025 ATGTAAGGCAAGAGAGAAAATGG + Intergenic
944938047 2:204590179-204590201 CTGTGAGGACAGAGAGATGATGG - Intronic
945448146 2:209962310-209962332 ATGAGAGGCCACAGAGAGGAGGG + Intronic
946166196 2:217865432-217865454 ATGTGCAGACAGAGAGAGGAAGG + Intronic
946715529 2:222551287-222551309 ATGTGAGGCCAGAGGGAAAACGG - Intronic
946723666 2:222639478-222639500 AGAAGTGGCAAGAGAGAAGAGGG + Intronic
947072458 2:226305655-226305677 ATGTGTAACAAGAAAGAAGAGGG + Intergenic
947165775 2:227260353-227260375 ATATGTAGCCAGAGATGAGAGGG - Intronic
947219511 2:227779111-227779133 ACGTGTGTCAAGAGAGAAGTAGG + Intergenic
947478204 2:230471279-230471301 AAGTGTGGCCAGATAGAGTAGGG + Intronic
947551768 2:231051451-231051473 ATGGGAGGTCAGAGGGAAGAAGG + Intergenic
948231210 2:236350891-236350913 AGGTCTGGCCAGAAAGAAGATGG + Intronic
948577699 2:238965145-238965167 AAGTGAGGCAAGAGGGAAGAGGG - Intergenic
948577742 2:238965295-238965317 AAGTGAGGCAAGAGGGAAGAGGG - Intergenic
948674388 2:239588545-239588567 ATGTGGGGACAGAGAGGAGTGGG - Intergenic
948814361 2:240502357-240502379 ATGTTGGGCCAGAGGGGAGAAGG - Intronic
948900001 2:240951415-240951437 ATGGGTGGATAGAGAGATGATGG - Intronic
948991164 2:241554797-241554819 TTGTGTGACCAGAGAGAGGTCGG - Intergenic
1170494461 20:16911838-16911860 AAGGGTAGCCAGAGAGAAAAAGG - Intergenic
1172744225 20:37194203-37194225 CTGTGTGGGAAGAGAGAAGGTGG + Intronic
1174602493 20:51736038-51736060 ATGGGTGGCCAGGGAGGTGAGGG + Intronic
1175743339 20:61435969-61435991 AAGTGTGGCCAGACTGGAGAAGG - Intronic
1176149379 20:63581510-63581532 CTGTATGTCCAGGGAGAAGAGGG - Intergenic
1177741364 21:25158064-25158086 AAGTGTGGGGAGAGAGAAAAAGG + Intergenic
1178015330 21:28339419-28339441 AGGTGTGGCCAGAGACACAAGGG - Intergenic
1178124804 21:29504949-29504971 TTGTGGGGCCAGAGAGAGAAGGG + Intronic
1178235714 21:30838680-30838702 GTCTGTGGCGAGAGAGTAGAAGG + Intergenic
1178279329 21:31267249-31267271 GTCTCTGCCCAGAGAGAAGATGG + Intronic
1178909669 21:36664366-36664388 CTGTGAGGCCAGAGAGAAAGTGG + Intergenic
1179239307 21:39575008-39575030 ATGTGAGGACACAGAGGAGAAGG - Intronic
1179304977 21:40145432-40145454 ATGTGGGGCAAGAGAGAGGCTGG + Intronic
1180022229 21:45135780-45135802 AGGTGTGGCCACAGTCAAGAGGG + Intronic
1180624231 22:17183402-17183424 CTGTGGGGTCAGAGAGACGAAGG - Intronic
1181172153 22:21015796-21015818 AAGTGGGGCCAGAGAGGAGGTGG + Intronic
1181486512 22:23234961-23234983 ATGTGTGGCCACAGAGTCGGGGG - Intronic
1182394921 22:30028309-30028331 ATGGGTGGGCAGAGAGAACTGGG + Intronic
1182766628 22:32762290-32762312 ATGTATGGACGGGGAGAAGAGGG - Intronic
1183989900 22:41590683-41590705 ATGTGTGGACAGAAGGAATAAGG - Intergenic
1184928421 22:47660891-47660913 GTGTATTGCCAGAGAGAGGAGGG - Intergenic
1185125656 22:49009297-49009319 ACCTGTGGACACAGAGAAGAAGG - Intergenic
1185422210 22:50741284-50741306 AAGTGAGGCCAGTGAGAACAAGG - Intronic
949539300 3:5019941-5019963 AGCTGTGGCCAGAGAGGAAAGGG - Intergenic
950153261 3:10704533-10704555 ATGTGTGGCCTGTGCTAAGAAGG - Intronic
950279069 3:11690354-11690376 ATTTTTGGCAAGAGAGAAGCTGG + Intronic
950553623 3:13682344-13682366 ATGTGGGGCCAGAGAGTGGCTGG + Intergenic
951946985 3:28149535-28149557 ATGTGCAGGCAGAGAGCAGACGG + Intergenic
951965727 3:28382322-28382344 ATGTGAGGACAGGGAGAAGATGG - Intronic
952999544 3:38920123-38920145 AGGTGTGTCCAGAGAGAAACTGG + Intronic
953082071 3:39630118-39630140 ATGTGCTTCCAGAGAGAAGAGGG - Intergenic
954591857 3:51789743-51789765 AGGTGTGGCCAGACAGGGGATGG + Intergenic
954803118 3:53198882-53198904 AGCTGAGGCCAGAGAGGAGAAGG + Intergenic
955122553 3:56075303-56075325 ATGTGAGGGCAGAGGAAAGAGGG + Intronic
958018661 3:87971160-87971182 ATTTGAGGCCAGAAAGAAGAAGG - Intergenic
959292791 3:104495690-104495712 ATCTGTGGCCAGGGAGCAGAAGG - Intergenic
959500472 3:107101094-107101116 TTCTGTGGCTAGAGAGTAGAGGG - Intergenic
961061893 3:123835685-123835707 ATGAGTGGCCAGAGACAGGAGGG - Intronic
961313096 3:126016298-126016320 ATGTGTGGCCAGTGACCAGGAGG + Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961347727 3:126274900-126274922 ATGGGAGGCAAGAAAGAAGAGGG - Intergenic
961837040 3:129670764-129670786 ATGGGTGGCCTGGGAGAAGCTGG + Exonic
962403391 3:135080317-135080339 AAGTAGGGCCAGAGAGAAGGGGG + Intronic
962568280 3:136686347-136686369 ATGTGGGACCAGAGACAACAAGG - Intronic
962751947 3:138440106-138440128 ATGTGTCACCAGAGAAAAGCAGG - Intronic
963621588 3:147614198-147614220 ATGTGTGGCAGAAAAGAAGAGGG - Intergenic
963942375 3:151107977-151107999 ATTTGGGGCCAGAGATAAGTGGG + Intronic
964250088 3:154704435-154704457 ATCTTTGGTTAGAGAGAAGAAGG - Intergenic
964415885 3:156446982-156447004 CAGTGTGGCCAGAGAAGAGAAGG - Intronic
964551575 3:157890739-157890761 ATGTGGGGGCACAGAGAAGTGGG + Intergenic
965125936 3:164628955-164628977 AGGTGTGGACAGAGAGATGGGGG - Intergenic
965742124 3:171886520-171886542 ATGTGTGGCAGAAGGGAAGAAGG - Intronic
966135692 3:176695714-176695736 TAGTGTGGACAGAGACAAGACGG + Intergenic
966562387 3:181337407-181337429 ATGTGGGGCCAGAGGGTATATGG + Intergenic
969429565 4:7146234-7146256 AAGTGTGGGCAGGGAGGAGAGGG + Intergenic
969934305 4:10666035-10666057 AAATATGGCCAGAGAGGAGAAGG + Intronic
970307661 4:14750023-14750045 ATCTGTGCCCAGAGACAAAATGG - Intergenic
970326557 4:14930941-14930963 ATGTGAGGACACAGCGAAGATGG + Intergenic
971325247 4:25638156-25638178 ATGTGAGTCCTGAAAGAAGATGG + Intergenic
971345967 4:25812154-25812176 ATGTGTGGTCATATAGAAGAAGG - Intronic
971477130 4:27082929-27082951 TTATGTTGCAAGAGAGAAGAAGG + Intergenic
972580521 4:40391715-40391737 TTTTGTGACCAGAGAGAATAAGG + Intergenic
973113514 4:46425605-46425627 ATGTATGGCCAGATAGAAAGTGG - Intronic
974092508 4:57326814-57326836 ATGTATAGACAGAGAGAAAATGG - Intergenic
974220624 4:58965483-58965505 ATTTGTGGCCAGAAAGACAATGG + Intergenic
974396846 4:61347550-61347572 ATATGAGGCCAGAGGGAAGGGGG - Intronic
975896108 4:79093037-79093059 ATCTGGGGCCAGAGATAAGGAGG - Intergenic
976115637 4:81722963-81722985 AGGTGGGCCCAGAGAGGAGAGGG - Intronic
976131882 4:81893179-81893201 ATGGGTCACCAGAGAGAAGCCGG + Intronic
976307021 4:83570199-83570221 GCCTGGGGCCAGAGAGAAGAAGG - Intronic
976413069 4:84739518-84739540 ATGAATGCCCAGAGGGAAGAAGG - Intronic
976671074 4:87654330-87654352 ATGAGGGGCCAGAGATAGGAGGG + Intronic
976827410 4:89276095-89276117 CTGTGTGGCAAGGGACAAGATGG - Intronic
977285796 4:95105267-95105289 GTGTGTGCCAAGAGAGAAGTGGG + Intronic
977647800 4:99433694-99433716 ATGTGAAGACAGCGAGAAGAGGG + Intronic
978685077 4:111431190-111431212 ATGTGGGGGCTGAGGGAAGAGGG + Intergenic
978716653 4:111851929-111851951 ATGTGTGCCAAGAGAGACAAAGG + Intergenic
978855239 4:113387091-113387113 ATGTGAGGACAGCGAGAAGGTGG - Intergenic
979194899 4:117909160-117909182 ATGTGGAGCCAGGGAGAAGGAGG - Intergenic
979271347 4:118766271-118766293 ATGTGTGGTCAGAGACATGCAGG - Intronic
980250064 4:130303513-130303535 ATGGGAGGCTAGAGAGAGGAGGG + Intergenic
980281738 4:130731967-130731989 ATGTGAGGCCAGAGGGCAAACGG + Intergenic
980534762 4:134103455-134103477 ATGTGAGGACAGTGAGAAGGTGG - Intergenic
980639644 4:135560572-135560594 GTGTGTACCCAGAGAGAAGGAGG - Intergenic
981486389 4:145291073-145291095 ATGTGTGGGCAGGGAGTATATGG - Intergenic
982636190 4:157899714-157899736 ATGTGTGGGCTGAGGGAGGAGGG + Intergenic
983790673 4:171793724-171793746 ATATGTTGCCAGAGAGAGAACGG - Intergenic
984258143 4:177411516-177411538 TAGTGTGGCTAGAGACAAGAAGG - Intergenic
985206029 4:187538077-187538099 GTGTGTGGCCAGAAAGTAAAAGG - Intergenic
985624553 5:978287-978309 ATGTGTGGACAGAGAAAACGAGG - Intergenic
988410298 5:30877621-30877643 ATGTCAGGACAGAGAGAAGGTGG + Intergenic
988634954 5:32972898-32972920 GTGAGGGGCCAGAGACAAGAAGG - Intergenic
990275490 5:54191629-54191651 ATGTGTGGTTTGAGAGAAAAAGG - Intronic
990999348 5:61767346-61767368 ATGGGAGGCCAGAGACAACAGGG - Intergenic
993954623 5:94216660-94216682 ATGTGGGGGAAGTGAGAAGACGG - Intronic
994472739 5:100229597-100229619 AAATGTGGCAAGAAAGAAGAAGG - Intergenic
995610782 5:113908465-113908487 ATGTGAAGACAGGGAGAAGATGG + Intergenic
995652999 5:114392443-114392465 CTGGGTGGCCAGAGTGAACAGGG + Intronic
996435441 5:123428854-123428876 ATGTCAGGGCAGAGAAAAGACGG + Intergenic
997340726 5:133142486-133142508 CTGTGCGGCCAGGGAGGAGATGG + Intergenic
997415768 5:133727453-133727475 AGGTGTGCCCAGTGGGAAGATGG - Intergenic
997601489 5:135141626-135141648 AACTGAGGCCAGAGAGAAGGAGG - Intronic
998388540 5:141772459-141772481 ATGTGTGGGCCGAGGGCAGAAGG + Intergenic
998511999 5:142721502-142721524 ATAAGTGGCCAGAGAGAAAGGGG + Intergenic
1000723988 5:164745644-164745666 ATGTGAGGACAGTGAGAAGGTGG - Intergenic
1001006296 5:168053392-168053414 AAGTGTGGCCAGTGAGGATATGG - Intronic
1001141519 5:169147905-169147927 AGGAGGGGGCAGAGAGAAGACGG - Intronic
1001581499 5:172801640-172801662 ATCAGGGGCCAGAGAGAAGGTGG + Intergenic
1001670301 5:173468181-173468203 GTGTCTGGGCAGAGAGGAGAAGG + Intergenic
1003277893 6:4667847-4667869 GTCTGTGGGAAGAGAGAAGAAGG - Intergenic
1004112857 6:12737431-12737453 ATATGTGTCCAGAGAGATGAGGG + Intronic
1004267812 6:14164610-14164632 ATGTGAGGTCAGGGAGAAGGGGG + Intergenic
1004634892 6:17457169-17457191 ATGTGTGTGCAGAGAGGAAAGGG - Intronic
1006898163 6:37483861-37483883 AAGTGTGGCCATAGAGCAGCAGG - Intronic
1007074767 6:39059451-39059473 AGGTGTGCCCAGACAGCAGAGGG - Intronic
1007697621 6:43743849-43743871 ATCTGTGGCCTGAGAGGGGAAGG + Intergenic
1008055524 6:46941788-46941810 ATGTGTGGGGAGAGAAGAGATGG - Intronic
1008242432 6:49129042-49129064 TGGTGTGGCAAGAGAGAATAAGG - Intergenic
1008508716 6:52256215-52256237 ATGTGGGGCTGGAGAGCAGATGG - Intergenic
1009413051 6:63388546-63388568 ATGTGAAGCCAGGGAGAAGACGG + Intergenic
1010121775 6:72384341-72384363 AGGAGTGGCCAGTCAGAAGAGGG - Intronic
1011293675 6:85804858-85804880 AGCTGTGGCCTGAGAGCAGATGG - Intergenic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1012117288 6:95318295-95318317 ATGGGAGCCCACAGAGAAGAAGG + Intergenic
1012167305 6:95973387-95973409 ATGAGTTGCCAGAGGGAAGAAGG + Intergenic
1012979007 6:105810602-105810624 ATGTCTGGCCACAGAGCAGAAGG + Intergenic
1014827838 6:126066469-126066491 ATGTATGTCGAGAGGGAAGATGG + Intergenic
1014850963 6:126339242-126339264 ATGGGAGGCCAGATAGTAGAAGG + Intergenic
1015443622 6:133277337-133277359 TTTTGGGGCCAGAGAGAAGTTGG - Intronic
1018205806 6:161436197-161436219 ATGGGAGGGCAGAGAGCAGAGGG + Intronic
1020334371 7:7051342-7051364 AAGTGTGGCAAGAGGGAGGAGGG + Intergenic
1021288242 7:18809571-18809593 ATATCTGGCCAGATAAAAGAAGG + Intronic
1021425418 7:20494732-20494754 ATGTGAGGACACAGTGAAGATGG + Intergenic
1023043570 7:36193362-36193384 AGGTATGGCCAGAGAGCAGAGGG + Intronic
1023106626 7:36769416-36769438 ATGTGAGGCCAGCAAGAAGGTGG - Intergenic
1024557477 7:50615773-50615795 ATGTATCCCCAGTGAGAAGAAGG - Intronic
1024885821 7:54140957-54140979 ATATATGACCAGAGAGAAGGTGG - Intergenic
1025832973 7:65070288-65070310 ATGTGTGCAAAGAGAGAAGAGGG - Intergenic
1025902739 7:65759802-65759824 ATGTGTGCAAAGAGAGAAGAGGG - Intergenic
1027657481 7:80948542-80948564 ATGCATGGAGAGAGAGAAGAAGG + Intergenic
1028071865 7:86460579-86460601 ATGTGTGGGGAGAGAGTAGGAGG - Intergenic
1028325017 7:89512866-89512888 ATGAGAGGGCAGAGAGAAGAAGG - Intergenic
1028745781 7:94324687-94324709 ATGATTGGCCAGAAATAAGAAGG + Intergenic
1029188254 7:98754701-98754723 ATATGAGGACACAGAGAAGACGG - Intergenic
1029290263 7:99496980-99497002 ACGTGTCCCCACAGAGAAGAGGG - Intronic
1029489203 7:100861278-100861300 CTGTGTCCCCAGAGAGAAGAAGG + Intronic
1029538834 7:101171477-101171499 ATGAGGGGCTAGAGAGAAGTGGG + Exonic
1030318343 7:108139175-108139197 ATGTGAGGACAGAGAGAAGGTGG - Intergenic
1030937677 7:115605964-115605986 GTGGGTGGGGAGAGAGAAGAGGG - Intergenic
1031200735 7:118682008-118682030 TTGTGTTGCCAGAAAGAAAAAGG + Intergenic
1033074949 7:138240118-138240140 CTGTGCGGCCAGAAGGAAGATGG + Intergenic
1033951315 7:146788193-146788215 CCGTGTGGCCTGAGAGCAGAGGG + Intronic
1034413874 7:150955090-150955112 ATGGGTGCCCAGAGAGATGGTGG - Intronic
1036766299 8:11551347-11551369 ACGTGAGGACACAGAGAAGACGG - Intronic
1037765656 8:21770797-21770819 TTGTGGGGCTAGAGAGAAGTGGG - Intronic
1037918196 8:22785526-22785548 ATCTGTGGCCAGGGAGCACATGG - Intronic
1038157031 8:25000631-25000653 ATGTCAGGCCATAGAGAAAAAGG + Intergenic
1038556620 8:28523946-28523968 ATGTGGGGCCAGGGAGGAAAAGG - Intronic
1039737104 8:40344787-40344809 ATGAGTGCACAGAGAGATGATGG - Intergenic
1040055601 8:43054883-43054905 ATGAGTGGCCACAGAGAGGAGGG + Intronic
1041053733 8:53961479-53961501 ATGTGTGGGAAGAGAAAAGGAGG - Intergenic
1041468360 8:58180605-58180627 GAGTGGGGCCAGAGAGCAGAAGG + Intronic
1043022424 8:75020491-75020513 ATGTGAGGACACAGAGAAGGTGG - Intronic
1043562738 8:81513845-81513867 ATCTGTGGCCAGAGTGGAGATGG - Intergenic
1043573625 8:81631863-81631885 ATGTGGGGCCAGAGACAGGAAGG - Intergenic
1044023632 8:87139541-87139563 ATGTATGGGCAGAGAGAACTTGG + Intronic
1044952084 8:97444780-97444802 ATACGTGGCCAGAGAGACAACGG + Intergenic
1045299070 8:100895185-100895207 ATGTGAGAACAGTGAGAAGATGG + Intergenic
1045377478 8:101589264-101589286 ATTTGTGGACAGAGACAAAATGG + Intronic
1045417321 8:101980215-101980237 TTGAGTGGGCAGGGAGAAGATGG - Intronic
1045726372 8:105178536-105178558 GTCTGTGGGCAGAGAGAAGTTGG + Intronic
1046056982 8:109090620-109090642 ATGTGAGTTCAGAGAAAAGAAGG + Intronic
1046830713 8:118742753-118742775 ATGTGTGGCCATTTATAAGATGG + Intergenic
1047775515 8:128067309-128067331 ATGTGGGGCTAGAGAGTAGAAGG + Intergenic
1047995844 8:130335005-130335027 CAGTGTGGCCAGAGAGAATTTGG - Intronic
1048213880 8:132479236-132479258 ATGCATGGCCAGAAGGAAGAAGG - Intronic
1048736521 8:137508100-137508122 ATTTTTAGCCAGAGAGAAGCAGG - Intergenic
1048779351 8:137984679-137984701 TGGTGTGGGCAGAGAGAAAAGGG - Intergenic
1049046242 8:140154294-140154316 ATGTGGAGCCAGAGAGAAATGGG - Intronic
1049476617 8:142799867-142799889 AGGTGTGGCCAGAGTGGGGAGGG + Intergenic
1051202441 9:14642661-14642683 ATGTGGGGACAGAGAGAAGGTGG + Intronic
1051760744 9:20461023-20461045 ATGTGTGGATGGAGAGGAGAAGG - Intronic
1051874444 9:21776596-21776618 GTCTGTGACCAAAGAGAAGATGG + Intergenic
1053205818 9:36185779-36185801 ATGTGAGGACAGAGTGAAGGTGG + Intergenic
1053412533 9:37925055-37925077 ATGTGTGCCCAGAGGCCAGAGGG - Intronic
1055401643 9:75930357-75930379 AGGTGAGGCCAGAGAGAGGCTGG + Intronic
1055645757 9:78359917-78359939 ATGTGTGAGCACAGAGAAAAAGG - Intergenic
1056832865 9:89930890-89930912 ATGTGTGGACTGAGAGAAGAAGG + Intergenic
1057431013 9:94994025-94994047 ATGCGTGGCTCGGGAGAAGAAGG - Intronic
1057964327 9:99488556-99488578 ATTTGTGACCAGACAGAAAAGGG + Intergenic
1058040109 9:100293834-100293856 ATGAATGTCCAGAGAGAAGCTGG + Intronic
1059011310 9:110464623-110464645 CTGTGTAGCCTGAGAGAAGTAGG + Intronic
1059411868 9:114137669-114137691 TTGTGTGCTCAGTGAGAAGATGG + Intergenic
1059414050 9:114152425-114152447 ATGTGCAGCCACAGAGGAGAAGG - Intergenic
1059501074 9:114754776-114754798 AGGTGAGGCCAGAGAGTAGGTGG + Intergenic
1060246521 9:121951006-121951028 GAGTGTGCCCAGAAAGAAGATGG - Intronic
1061442197 9:130613242-130613264 ATGTCTGGCCACAGAGCTGAGGG - Intronic
1061774207 9:132949741-132949763 AGCTGTGGCCACAGAGAGGAAGG + Intronic
1062185435 9:135215861-135215883 GGGAGTGGCCAGAGAGGAGAGGG + Intergenic
1062195294 9:135269682-135269704 ATGTGTGGGCAGTGTGAACAGGG - Intergenic
1203544841 Un_KI270743v1:121156-121178 AAGCGGGACCAGAGAGAAGAGGG + Intergenic
1203556864 Un_KI270744v1:7039-7061 ATGTGGGGCCAAAGAAAACAAGG - Intergenic
1185843033 X:3410905-3410927 GTGAGGGCCCAGAGAGAAGACGG - Intergenic
1186253298 X:7692329-7692351 ATGTGAAAACAGAGAGAAGACGG + Intergenic
1186417289 X:9394743-9394765 GTGTGTTTCCAGAGAGAAGGGGG + Intergenic
1187344798 X:18453152-18453174 TTGTGTGACCAAAAAGAAGAGGG - Intronic
1187820276 X:23280058-23280080 CTATGTGGCCATAGAAAAGAGGG + Intergenic
1188479943 X:30627303-30627325 ATGAGAGGCCAGCGATAAGAGGG - Intergenic
1189194204 X:39138698-39138720 CTGTGAGGCAAGAGACAAGATGG + Intergenic
1189249171 X:39586770-39586792 ATGTGTGGCCACAGAGCCCAAGG + Intergenic
1189549763 X:42080728-42080750 ATGTGTGACCCGGGAGAAGGAGG + Intergenic
1190044670 X:47102190-47102212 AGGTGAGGTCAGAGAGAAGTAGG + Intergenic
1190190718 X:48274675-48274697 ATGTGTGGGCTGTGAGCAGATGG + Intronic
1190198099 X:48336819-48336841 ATGTGTGGGCTGTGAGCAGATGG + Intergenic
1190212655 X:48460377-48460399 ATGGATGGCTAGAAAGAAGAGGG - Intronic
1190290217 X:48987618-48987640 ATGGATGGCCAGAGAGAAGAGGG + Intronic
1190515691 X:51221688-51221710 TTGGATGGGCAGAGAGAAGAAGG - Intergenic
1190877925 X:54472697-54472719 AGGTGGGGCCAGAGAGGAGTGGG + Intronic
1191697267 X:64003141-64003163 AGATGAGGCCAGAGAGAATAAGG + Intergenic
1192537935 X:71944454-71944476 TTGTTTGGGCACAGAGAAGATGG - Intergenic
1196652687 X:118184686-118184708 CGGTGTGGCCACAGAGAAAAGGG + Intergenic
1196804567 X:119573289-119573311 ATATGGGGCAAGAGAGAGGAAGG - Intergenic
1197339954 X:125255361-125255383 ATGTGTGCCTAGAGAGTAGTAGG - Intergenic
1198102217 X:133432075-133432097 ATGTATTGACAGGGAGAAGAAGG + Intergenic
1198258973 X:134949620-134949642 ATGTGAAGCCAGAGAGAGGAAGG - Intergenic
1198662237 X:138982149-138982171 AGGTGTGACCAGAGAGAGGTTGG + Intronic
1199183581 X:144888491-144888513 ATGTGAGGACTCAGAGAAGAAGG - Intergenic
1199466354 X:148141977-148141999 CTGTGTGGCCATAAAAAAGAAGG + Intergenic
1199709614 X:150459904-150459926 GTGAGTGGCTAGAGAGAACAAGG - Intronic
1200358289 X:155575169-155575191 ATGTGAAGACAGGGAGAAGATGG - Intronic
1201232162 Y:11875670-11875692 GTGAGGGCCCAGAGAGAAGACGG + Intergenic
1201420242 Y:13790357-13790379 AAGTGTGGCCAGAGAGACTCAGG - Intergenic
1202162292 Y:21948037-21948059 AAGTGTGGCCAAAGAGAAGCAGG + Intergenic
1202229064 Y:22638336-22638358 AAGTGTGGCCAAAGAGAAGCAGG - Intergenic
1202263290 Y:22992282-22992304 ACCTGTGGGCAGAGAGAAAAAGG - Exonic
1202314090 Y:23557829-23557851 AAGTGTGGCCAAAGAGAAGCAGG + Intergenic
1202416280 Y:24626023-24626045 ACCTGTGGGCAGAGAGAAAAAGG - Exonic
1202454507 Y:25044063-25044085 ACCTGTGGGCAGAGAGAAAAAGG + Exonic
1202556712 Y:26112766-26112788 AAGTGTGGCCAAAGAGAAGCAGG - Intergenic