ID: 906927938

View in Genome Browser
Species Human (GRCh38)
Location 1:50138911-50138933
Sequence GTGGCTGCAAAGCAATATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 180}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906927938 Original CRISPR GTGGCTGCAAAGCAATATGA AGG Intronic
900990428 1:6095985-6096007 GGGGCTGCAAAGCCACATGGAGG + Intronic
901474808 1:9482164-9482186 GCGGCTGCAAGGCAAGATGATGG + Intergenic
903477189 1:23627690-23627712 GGGGGAGCAAAGAAATATGACGG - Intronic
906927938 1:50138911-50138933 GTGGCTGCAAAGCAATATGAAGG + Intronic
909231478 1:73096229-73096251 TTGACTGCAAAGCAGTATGAGGG + Intergenic
909289373 1:73863185-73863207 GGGGTTGCAAAGAAAAATGAAGG - Intergenic
911148859 1:94578140-94578162 AAGTCTGCAAAGCATTATGATGG - Intergenic
915459955 1:156064303-156064325 GTGGCTGCAATGAACTGTGATGG - Intronic
921229569 1:213055192-213055214 CTGACTGCAAAGGAACATGAGGG - Intronic
921780180 1:219153763-219153785 TTGGCAGCAAAATAATATGATGG + Intergenic
922485748 1:225972020-225972042 GAGGCTGCAAGGAACTATGATGG + Intergenic
923423998 1:233850180-233850202 GTGGTTGCAGAGGAATAAGAAGG + Intergenic
923798560 1:237184212-237184234 GTGGCTGCAAAGAAGGATGTTGG + Intronic
923898556 1:238300749-238300771 GTAACTGCAAATCACTATGATGG + Intergenic
1063624970 10:7680220-7680242 GTGGCTGCACTGCATTGTGAAGG + Intergenic
1065331456 10:24604661-24604683 GTAGCTGCAATGCTATATTAAGG + Intronic
1066403584 10:35098183-35098205 GTGACTGCAAAGAAATATAAAGG - Intergenic
1068207473 10:53874419-53874441 ATGGCTGCAAACTAAAATGAGGG - Intronic
1068809281 10:61237793-61237815 GTGCTTGCAAAGCAATAAAAAGG + Intergenic
1069615832 10:69805694-69805716 GGGCCTGCAAAGCAACTTGAGGG + Intronic
1070422773 10:76253352-76253374 TTTGTTGCAAAGCAATATCATGG + Intronic
1073751047 10:106527597-106527619 GTGGCTGAAAAGCATGATGCTGG - Intergenic
1073842044 10:107508953-107508975 GTGATTTCAAAGCAATGTGAAGG - Intergenic
1077797879 11:5509921-5509943 GTGGCTGTGTAGCAAGATGAGGG - Exonic
1079970713 11:27032020-27032042 GTGCCAGCAAAGCCATATCAGGG - Intergenic
1080491542 11:32769838-32769860 ATGGTTGCTCAGCAATATGAAGG - Intronic
1081420329 11:42868472-42868494 AAGGCTCCAAGGCAATATGAAGG - Intergenic
1081706931 11:45187695-45187717 GAGGCTGCAAGGCCATATGGGGG + Intronic
1084000310 11:66292269-66292291 GCGGCTGGACAGCAATATGCGGG + Intronic
1084854911 11:71977174-71977196 CTGGCTGAAAAGCAATATAGTGG - Intronic
1085026486 11:73239536-73239558 GTGGCTGCAGAGCACCATGGTGG - Intergenic
1086339843 11:85837585-85837607 GAGGCTGGGAAGCCATATGATGG + Intergenic
1088522940 11:110718705-110718727 ATGGCTGCAAATAAAAATGAAGG - Intergenic
1090141195 11:124265274-124265296 TTGGCTGCAATGGCATATGACGG + Exonic
1090740436 11:129654654-129654676 ATGCCTGCAAAGCAATGTGAGGG - Intergenic
1091271554 11:134316042-134316064 GAGGCTGCATAGCATTGTGAAGG - Intronic
1092544053 12:9437714-9437736 GTGGCTGCAAATGGATCTGATGG - Intergenic
1095298898 12:40559216-40559238 GTTCCTGCAAAGGAAAATGAGGG - Exonic
1098473318 12:70870214-70870236 GGGGATGCAGAGCAACATGATGG + Intronic
1098493000 12:71104099-71104121 GTGGCTGGAAAGAAACATAAAGG + Intronic
1098743756 12:74208088-74208110 TTGTCTGCAAAGGAATAAGATGG + Intergenic
1099058911 12:77881031-77881053 GAGGCTGTAATGCACTATGATGG - Intronic
1100573161 12:95861887-95861909 ATGGCTGCAGAACAATGTGAAGG - Intronic
1101167815 12:102056432-102056454 GTGACTGCAAAGGAGCATGAGGG + Intronic
1102790486 12:115640204-115640226 GTTGCTGCAAAGCAGTCTAAAGG + Intergenic
1102912857 12:116731683-116731705 GAGGCTGCAAAGAGCTATGACGG + Intronic
1105534962 13:21257382-21257404 GTGGCTGCAGAGACATATGGGGG + Intergenic
1106547377 13:30742515-30742537 GTGGGTGCAAAGCTCTGTGACGG + Intronic
1107687490 13:42918351-42918373 GGGGCTGCAAATCAATGTGAAGG - Intronic
1107998693 13:45887141-45887163 GTGGTTGCACAGCAGTGTGAAGG + Intergenic
1110077738 13:71269997-71270019 AAGGCTGTAAAGCAATATAAAGG + Intergenic
1110566568 13:76963360-76963382 GTGGCTACAATGAGATATGATGG + Intergenic
1111645186 13:91023374-91023396 GTGACTGCAAAGCAACAACATGG + Intergenic
1115206219 14:30908434-30908456 ATGGATGAAAAGCAATATAATGG - Intronic
1116239870 14:42326356-42326378 GAGGCTGCAAAGAAACAGGAAGG - Intergenic
1116344810 14:43779069-43779091 GTGTATTCAAAGCAATGTGAAGG + Intergenic
1119182055 14:72611955-72611977 ATGGCTGAAAAGCAACTTGAAGG + Intergenic
1125899813 15:43334993-43335015 GTGGAAGTAAAGCAATCTGAAGG + Exonic
1126499086 15:49324609-49324631 TTGACTGTAAAGCAATTTGAAGG + Intronic
1127317121 15:57807719-57807741 GTGTCTGCAAAGCAATCCCATGG - Intergenic
1131542163 15:93283663-93283685 GTAGCAGCAAAGCCATTTGAAGG - Intergenic
1132263892 15:100449269-100449291 GTGGCTGCAATGGGATAGGACGG - Intronic
1136514281 16:30758476-30758498 GTGGCTTAAAACCTATATGATGG - Exonic
1136655658 16:31707672-31707694 GTGGCTACCAAGGAGTATGAGGG - Intergenic
1137708986 16:50553663-50553685 GTGGTTTCAAAGCTATGTGATGG + Intronic
1139309616 16:66017527-66017549 GTAGCTGAGAAGCAACATGAAGG + Intergenic
1139368801 16:66451999-66452021 AGGCCTGCAAAGCAATCTGATGG + Intronic
1139613604 16:68075856-68075878 GGGGCTGCAGAGCCAAATGAGGG - Intronic
1141350704 16:83292522-83292544 GAGGCTGCAAAACAAAAAGATGG - Intronic
1141890585 16:86924274-86924296 TTGGCTGCAGAGCACGATGATGG - Intergenic
1142249941 16:88986587-88986609 GGGGCTGCAAAGCAGGATGGGGG - Intergenic
1143211105 17:5188384-5188406 GTGGCAGCAAATCTGTATGAAGG + Intronic
1145768144 17:27473455-27473477 GAGGCTGCAAAGCAAGAGGTGGG + Intronic
1146600159 17:34207156-34207178 GTGACTGCAAAGAAGTATGGGGG - Intergenic
1147959502 17:44157857-44157879 GTGGCTGCAAAGCCCGAGGAAGG + Exonic
1149283495 17:55133955-55133977 GTAGCTGCAAGGAAATGTGAGGG + Intronic
1149418791 17:56488350-56488372 GTGGTTGAAGAGCAAGATGAAGG + Intronic
1153048308 18:877042-877064 GTGGCTGCCAATCACGATGAAGG + Intergenic
1160213002 18:76899179-76899201 GTTCCTGCAAAGGAATATCAGGG - Exonic
1162827242 19:13260711-13260733 AAGGCTGCAATGCACTATGATGG - Intronic
1164367200 19:27598513-27598535 CTGGCTACAAAACAAAATGAAGG + Intergenic
926303543 2:11620753-11620775 GTGGATGCAAAGATATTTGAAGG - Intronic
927565908 2:24112813-24112835 GTGGCTGGAAAGCAGTACGTGGG - Intronic
928106789 2:28475682-28475704 GTGGCTGTAATGCAGAATGAAGG - Intronic
928641713 2:33306087-33306109 CTGTCTTCAAAGCAATAAGAAGG - Intronic
928806083 2:35157405-35157427 GTAGCTGGATAGAAATATGATGG - Intergenic
929129279 2:38550642-38550664 GTGCTTGAAAAGCTATATGATGG + Intergenic
929350902 2:40953464-40953486 ATAGCTGCACAGCAATATCAAGG + Intergenic
931559395 2:63542080-63542102 GTGACTGCATAGCAATATCTTGG + Intronic
933856168 2:86416544-86416566 GTGGTTGCACAGCATTGTGAAGG - Intergenic
936032402 2:109082748-109082770 GAGGCTGCAGTGCACTATGATGG + Intergenic
940191408 2:151044311-151044333 GTGACTGCAAATGAACATGAGGG - Intronic
1168889711 20:1287033-1287055 TTGGCTGCAGGGCAAGATGATGG - Intronic
1169923718 20:10761288-10761310 GTGAGTGTAAAGGAATATGAAGG - Intergenic
1170686525 20:18574647-18574669 GTGGCTGCCAGGCAAGATGGCGG - Intronic
1172983531 20:38963061-38963083 GTGGCTGGCAGCCAATATGAAGG - Intronic
1174763744 20:53231947-53231969 GAGGCTGCAATGAACTATGATGG - Intronic
1174886153 20:54337423-54337445 TTGGCTGCAAAGCAAAGGGAAGG + Intergenic
1175277996 20:57784915-57784937 CTGGCTGCCAAGCAAGAAGATGG + Intergenic
1176063123 20:63180833-63180855 TTGGCTGCAAAGCATGGTGATGG - Intergenic
1177138649 21:17333715-17333737 ATGGCTGCACCACAATATGAAGG + Intergenic
1180753565 22:18143507-18143529 GAGGCTGGCAAGCAATAGGAGGG + Intronic
1181857915 22:25795696-25795718 GTGGCGGCCCAGAAATATGATGG + Intronic
1182535486 22:30999161-30999183 GAGGCTGCAAAGAACTATGATGG - Intergenic
1184688034 22:46105158-46105180 GTGGCTGCAGAGCAGCATCAGGG + Intronic
949319499 3:2793243-2793265 GTTTCTCCAAAGCTATATGAAGG + Intronic
950271938 3:11623803-11623825 GAGGCTGCAATGAATTATGATGG - Intronic
950478973 3:13233058-13233080 GTGGCTGCACAGCAAAGTGAAGG + Intergenic
951813157 3:26723883-26723905 GCGGCTGGAAAGCAATATTAGGG - Intergenic
952235917 3:31480103-31480125 GTGATTACAAAGCAATAAGATGG + Intergenic
952620598 3:35335982-35336004 GTGGGTGCAGAGCAATATAGGGG - Intergenic
952738653 3:36714636-36714658 GGGGCTGAAAAGCAGTATAACGG + Exonic
953775593 3:45814158-45814180 CTGGCTGCAAAGGGACATGAAGG + Intergenic
953789693 3:45937816-45937838 GCGGCTGGAAAGCAAAAAGAAGG - Intronic
953827931 3:46270359-46270381 GTGGCTGTAATGAAACATGAGGG + Intergenic
956560782 3:70571822-70571844 GTGGTTACACAACAATATGAAGG - Intergenic
958618349 3:96525940-96525962 TGGGCTGCAAAGGAATATGTGGG - Intergenic
959574116 3:107915955-107915977 GTGTAGGCAAAGCATTATGAAGG - Intergenic
960254206 3:115494032-115494054 TTTACTGCAAAGGAATATGAGGG + Intergenic
962286499 3:134090658-134090680 CTGGCTGCAAAGGAATCTGAGGG + Intronic
963734674 3:149006380-149006402 GTGGCTGTAAAAGAATATGATGG - Intronic
963923870 3:150931080-150931102 GTGACTGCTAAGAGATATGAAGG + Intronic
968529954 4:1086525-1086547 GTGGCTGTCAAGGAGTATGATGG + Intronic
970401664 4:15723210-15723232 GTGGCTGTAGAGCAATCTGTAGG + Intronic
970879406 4:20910765-20910787 GTGTTTGTAAAGCAATCTGATGG + Intronic
971242796 4:24903713-24903735 TTGGCTGCAGAGAAACATGAGGG - Intronic
971619397 4:28835719-28835741 CTAGCTGCAAATCCATATGAGGG + Intergenic
972068488 4:34983191-34983213 CTGGCTTTAAAGAAATATGAGGG + Intergenic
972209165 4:36815847-36815869 GTGGGTACAAAGGAATATAAGGG - Intergenic
972753970 4:42025079-42025101 GTAGCTGTAAAGCCAGATGATGG - Intronic
975172869 4:71252758-71252780 GTGACTGCAAATGGATATGAGGG + Intronic
976471023 4:85429341-85429363 GTAGCTTGAAAGCAAAATGAGGG + Intergenic
976814436 4:89131115-89131137 GTGGCTGCAAAGGAGATTGAGGG + Intergenic
976932373 4:90583641-90583663 TTGGCTGCAAATCAATACTAAGG - Intronic
977726458 4:100302274-100302296 GGGACTGGAAAGCAATTTGAAGG + Intergenic
978135904 4:105259303-105259325 GTGACTGAAAGGCAAAATGAGGG + Intronic
985205815 4:187535528-187535550 GCGGCTGGACAGCAATCTGAAGG + Intergenic
986214051 5:5701434-5701456 CTGGCTGAGAAGCAATATCAAGG + Intergenic
988892877 5:35638367-35638389 GTGGCTGGAAAGGTAAATGAGGG - Intronic
991921024 5:71657298-71657320 ATGGCTGCACAGCAGTGTGAGGG - Exonic
992206184 5:74432651-74432673 ATAGCTGCAAAGAAATATTAAGG - Intergenic
994730049 5:103481242-103481264 GTGGCAGAAAAGCAAAATGGAGG - Intergenic
996994041 5:129672707-129672729 GGTGCTGCAAACCCATATGAGGG - Intronic
997133848 5:131303862-131303884 TTGTCTTCATAGCAATATGATGG + Intronic
997169850 5:131706170-131706192 ATGGTTGCACAACAATATGAAGG + Intronic
998162191 5:139819934-139819956 CTGGCTGCAAAGCAACATTTTGG + Intronic
1000071941 5:157748607-157748629 GTGGCGGCAAAACAAGATGGTGG - Intronic
1001192891 5:169647122-169647144 GAGGCTGCAAGGAAGTATGAAGG - Intronic
1002433786 5:179219425-179219447 GTGGCTGCAAAGCCAAACCATGG - Intronic
1002458236 5:179358258-179358280 GTGGCCCCAATCCAATATGATGG + Intergenic
1004325830 6:14673199-14673221 TTGGGTGCAAAGCAACAAGAGGG + Intergenic
1005083449 6:21980552-21980574 GTGGTTCCAAAGCCAGATGAAGG - Intergenic
1007528153 6:42515011-42515033 GTGTCTTCAAAGCCAGATGAAGG + Intergenic
1007544505 6:42682332-42682354 CTGGTTGCACAACAATATGAAGG + Intronic
1007660194 6:43479590-43479612 GAGGCTGCAATGCACTATGATGG + Intronic
1011149517 6:84254688-84254710 CTGACTGCAAAGCCATATGAAGG + Intergenic
1012335731 6:98054486-98054508 GCGGCTGCAAAGCCATATGGTGG - Intergenic
1012336315 6:98062671-98062693 GTGGCTACATAACAAAATGAAGG - Intergenic
1012500170 6:99879646-99879668 GTGGGTGCAGAGCAATTTGTGGG + Intergenic
1012554581 6:100495971-100495993 GTAGCTGCACAGGAATATGAAGG - Intergenic
1013979197 6:116109785-116109807 GTGGCAACAAAATAATATGAAGG - Intronic
1015446592 6:133312627-133312649 ATGGCTGCAAACCAATATTGAGG - Intronic
1016602542 6:145878814-145878836 CTGGCTGCCAAGAAAAATGATGG - Intronic
1017695720 6:157013688-157013710 GTGCCTGCAACGCAATCTCATGG + Intronic
1020328828 7:6997949-6997971 GAGGCTGCAAAGAGCTATGATGG + Intergenic
1020697501 7:11432451-11432473 GTGGCTGCAAGGGAATACGGAGG - Intronic
1024062448 7:45709276-45709298 GTGCCTGAAAATCAATCTGATGG + Intronic
1026154218 7:67813144-67813166 GAGGCTGCAATGAACTATGATGG - Intergenic
1026240601 7:68571709-68571731 GGGGCTGCAAATCTATATGAAGG + Intergenic
1031147042 7:118008079-118008101 CTGTCTGCAAACCAAAATGAGGG - Intergenic
1031397907 7:121294526-121294548 GTGGCAGCAAAACAAAATGGTGG + Intronic
1031817983 7:126463175-126463197 GGGGATGCAAAGCTATAGGATGG + Intronic
1032527699 7:132592214-132592236 GTAGCTGCAAAGGAAGATGAGGG - Intronic
1037692625 8:21195084-21195106 GTGGAAGTAAAGCAGTATGATGG - Intergenic
1038015836 8:23513969-23513991 ATGGTTGCACAGCAACATGAAGG - Intergenic
1039140173 8:34378287-34378309 GTGGATGCAGAGAGATATGAGGG - Intergenic
1042522706 8:69730962-69730984 GTGGCTGCAAAGTATTAGGTTGG + Intronic
1044506890 8:93031357-93031379 GTAGCTGAAAAGAAATAAGAGGG + Intergenic
1046478112 8:114776383-114776405 GTGGCTGCAGTGAAATATGAGGG + Intergenic
1047620135 8:126597966-126597988 GTGGCTGTAAAGAAGTATCAGGG - Intergenic
1048003829 8:130402101-130402123 GTGGCTGTCCAGAAATATGAAGG + Intronic
1048604256 8:135951191-135951213 GAGGCAGCAAAGCAATATATAGG - Intergenic
1049499272 8:142952821-142952843 GAGGCTGAAAAGCAGAATGATGG + Intergenic
1050078447 9:1889473-1889495 TGGGCTGTAATGCAATATGATGG + Intergenic
1051930885 9:22384050-22384072 GCAGCTGCAAAGCAAAAGGAAGG - Intergenic
1052282589 9:26750184-26750206 TTGGCTGCACAACAATAGGAAGG - Intergenic
1054790506 9:69252334-69252356 ATGGCTGAACAGCAATGTGAAGG - Intronic
1055558596 9:77500563-77500585 ATGGCTGTAGAGCAACATGAAGG - Intronic
1056665066 9:88575068-88575090 ATGGCTTCAAAGGAATAAGAAGG - Intronic
1058415359 9:104783108-104783130 GTGCCTAGAAAGCAATGTGATGG - Exonic
1186500943 X:10050082-10050104 ATGGCTGCAAAGCACTAACAGGG - Intronic
1187310214 X:18134599-18134621 GTGGTTCCATAGAAATATGACGG - Intergenic
1189263375 X:39694144-39694166 ATGGCTACAATGGAATATGACGG - Intergenic
1190163793 X:48054810-48054832 GAGGCTGCAAAGAAGCATGATGG + Intronic
1194473381 X:94326302-94326324 TAGGCTGCAAAGCCATATGAGGG + Intergenic
1195670742 X:107467787-107467809 GAGGCTGCAAAGCAAACTGTGGG - Intergenic
1196144361 X:112300746-112300768 GTGGCTGCAGTGCCATACGATGG - Intergenic
1196812893 X:119642797-119642819 CTGGCGGCCAAGCAATTTGAGGG - Intronic
1198252625 X:134895258-134895280 GAGGCTGCAGAGAACTATGATGG + Intronic