ID: 906929796

View in Genome Browser
Species Human (GRCh38)
Location 1:50158152-50158174
Sequence TATATGCCAGGTGTTGTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1989
Summary {0: 1, 1: 4, 2: 43, 3: 335, 4: 1606}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906929796_906929799 -4 Left 906929796 1:50158152-50158174 CCCAGAACAACACCTGGCATATA 0: 1
1: 4
2: 43
3: 335
4: 1606
Right 906929799 1:50158171-50158193 TATAGTAATATAATTCTTACAGG 0: 1
1: 0
2: 2
3: 34
4: 327
906929796_906929800 14 Left 906929796 1:50158152-50158174 CCCAGAACAACACCTGGCATATA 0: 1
1: 4
2: 43
3: 335
4: 1606
Right 906929800 1:50158189-50158211 ACAGGAGTTCTGTGAGATGTAGG 0: 1
1: 0
2: 2
3: 18
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906929796 Original CRISPR TATATGCCAGGTGTTGTTCT GGG (reversed) Intronic
900802577 1:4746501-4746523 TCTATGCCAGGTGCTCTGCTGGG - Intronic
900929961 1:5730203-5730225 TATGTGCCAGGTGCTATTCTAGG - Intergenic
901215745 1:7554337-7554359 TATGTGCCAAATGCTGTTCTAGG + Intronic
901342669 1:8509479-8509501 TATAAGCCAGGAATTGTCCTAGG + Intronic
901346124 1:8544671-8544693 AATATGCCAGGTCTTGTTTAGGG + Intronic
901933251 1:12610488-12610510 TATATGCCAGGCACTGTTCTGGG - Intronic
902106188 1:14038108-14038130 TATATGCCAGGCTCTGTTTTAGG + Intergenic
902118334 1:14140345-14140367 TGTATGCCAGGCCTTGTGCTGGG - Intergenic
902133104 1:14280804-14280826 TATATGCCAGGCATTTTTGTAGG + Intergenic
902154429 1:14472832-14472854 TATGTTCCAGGTGCTGTGCTGGG + Intergenic
902178744 1:14671322-14671344 TATGTGCCAGGCACTGTTCTTGG - Intronic
902201864 1:14839389-14839411 TTTATGCCAGGTACTGTTCTAGG - Intronic
902220058 1:14958940-14958962 CAGGTGCCAGGTGCTGTTCTAGG + Intronic
902260896 1:15224048-15224070 TAGATGCCAGGTACTGCTCTAGG + Intergenic
902271651 1:15309329-15309351 TAGATGCCAGGCACTGTTCTAGG + Intronic
902661715 1:17908931-17908953 TTTATGCCAGGTATTGTACTAGG - Intergenic
902760552 1:18578009-18578031 TATATGCCAGGTGTTTTTCTGGG + Intergenic
902779485 1:18695368-18695390 TGTGTGCCAGGCGCTGTTCTAGG + Intronic
902781382 1:18707104-18707126 TATGTGCCAGGCACTGTTCTAGG + Intronic
902805177 1:18856582-18856604 TATGTGCCAGGTACTGTTGTAGG - Intronic
903042015 1:20537868-20537890 TACGTGCCAGGTGTTGTGCGAGG - Intergenic
903046766 1:20570168-20570190 TATATCCCAGGCACTGTTCTAGG + Intergenic
903104979 1:21069485-21069507 TATATGCAAGGTTTTGTGCCTGG - Intronic
903168088 1:21535055-21535077 AATATGCCAGGGGCTGTTCTAGG - Intronic
903303774 1:22398031-22398053 TACATGTCAGGTGTTGTTTTAGG + Intergenic
903381120 1:22897455-22897477 CATATGCCAGGCACTGTTCTAGG + Intronic
903409220 1:23126597-23126619 CATATGCCAGGTACTGTTCTGGG - Intronic
903746829 1:25592731-25592753 TAGGTGCCAGGCGCTGTTCTAGG - Intergenic
903882215 1:26518777-26518799 TACATGCCAGGCACTGTTCTAGG - Intergenic
903989543 1:27256744-27256766 TACATGCCAGGTGCTGTTCCTGG - Intronic
903993589 1:27290499-27290521 TATGTGCCAGGCGCTGTGCTGGG - Intronic
904187649 1:28718211-28718233 TATGTGCCAGGCTTTGTGCTAGG + Intronic
904222658 1:28985286-28985308 TATGTGTCAGGTACTGTTCTAGG + Intronic
904302382 1:29562659-29562681 TGTGTGCCAGGCTTTGTTCTAGG + Intergenic
904380088 1:30104762-30104784 TATGTGCCAGGCACTGTTCTAGG + Intergenic
904933679 1:34111138-34111160 TATGTGCCAGTTACTGTTCTAGG - Intronic
904942445 1:34174300-34174322 TATCTGTCAGTTGTTGTTCAAGG + Intronic
904990629 1:34589920-34589942 TATATGCCAGGTGTTGTGCTGGG + Intergenic
905003494 1:34692381-34692403 TATATGCCAGCTTATTTTCTGGG - Intergenic
905094636 1:35458978-35459000 TATATGGTAGGTATTGTGCTAGG + Intronic
905160506 1:36029147-36029169 TATATGACAGGTGCTATTCTAGG - Intronic
905229525 1:36506190-36506212 TTTGTGCCAGGTGTTGCACTGGG - Intergenic
905241729 1:36585975-36585997 TATGTGCCAGGTTTTTTTCTAGG + Intergenic
905251816 1:36654069-36654091 ACTATGCCAGGCATTGTTCTAGG - Intergenic
905257675 1:36695495-36695517 TATGGGCCAGGAGCTGTTCTAGG - Intergenic
905286077 1:36881221-36881243 TCTGTGCCAGGTTCTGTTCTTGG + Intronic
905290064 1:36915363-36915385 TATGTGCCAGGTCTTGTTCTAGG - Intronic
905329227 1:37180477-37180499 TATATGCCAGGACTTATTCTAGG - Intergenic
905342697 1:37290126-37290148 CATAGGCCAGGTTTTGTGCTAGG + Intergenic
905364208 1:37440023-37440045 TATGTGCCAGGCATTGTTTTAGG - Intergenic
905595476 1:39202831-39202853 TATGTGCCAGGTCATGTTCCAGG - Intronic
905771576 1:40641563-40641585 CATACACCAGGTGCTGTTCTAGG - Intronic
905927997 1:41765719-41765741 TGTATGCCAAGTGTTGTACCAGG - Intronic
905971960 1:42148580-42148602 TATGTGCCAGGTATTGTTTTGGG + Intergenic
906087777 1:43150628-43150650 TACATGCCAGGTATTATCCTGGG - Intronic
906188068 1:43876862-43876884 AATATGCTAGGTGCTGTTCTAGG + Intronic
906272019 1:44486920-44486942 TGTTTGCCAGGCATTGTTCTAGG - Intronic
906280368 1:44549289-44549311 TATATGCAAGGCATTGTGCTAGG - Intronic
906647925 1:47489543-47489565 TATGTGCTAGATGTGGTTCTAGG + Intergenic
906650004 1:47506255-47506277 TATATGCCAGGTTCTGTTTTAGG + Intergenic
906699251 1:47845878-47845900 TATGTGCCAGGCATTGTTCTAGG - Intronic
906929796 1:50158152-50158174 TATATGCCAGGTGTTGTTCTGGG - Intronic
907009187 1:50947067-50947089 TATATGTCAGGTACTGTGCTAGG - Intronic
907026082 1:51120828-51120850 TATATGCCAGGCATTGTATTAGG + Intronic
907101988 1:51845806-51845828 TATATGCCTGGTGTTGTCCCAGG - Intronic
907192780 1:52662758-52662780 TGTGTGCCAGGTCTTGTCCTGGG + Intronic
907194267 1:52673822-52673844 TATATGTCAGACATTGTTCTAGG + Intergenic
907321966 1:53608677-53608699 TGTATGCCAGTTTCTGTTCTAGG - Intronic
907400424 1:54221856-54221878 TGTGTACCAGGTGTTGTGCTGGG + Intronic
907423027 1:54360023-54360045 TATATGTCAGGTACTGTTCTAGG - Intronic
907454365 1:54565628-54565650 TGTATGCCAGGTCTCGTTCTTGG - Intronic
907637349 1:56149265-56149287 TACATGCCAGGTGCTGTGATGGG + Intergenic
907701282 1:56790606-56790628 TATATTCCAGGTATTGTTCTAGG + Intronic
907709063 1:56861156-56861178 TATATGCCAGGTACTGTTCTGGG + Intronic
907762625 1:57376526-57376548 TATTTGCCAGGGATTGTTCTAGG - Intronic
907793263 1:57689264-57689286 AATATTCCAGCTGTTGTCCTAGG - Intronic
907809758 1:57856905-57856927 TATGTGCCAGGCTCTGTTCTAGG - Intronic
907829491 1:58050942-58050964 TACATGCTACATGTTGTTCTAGG + Intronic
907843288 1:58177303-58177325 TATATGTCAGGTATTGTGCCTGG - Intronic
907864971 1:58390691-58390713 TATATGCCAGGCCCTGTACTAGG + Intronic
907928511 1:58977318-58977340 GGTATGCCAGGTATTATTCTAGG - Intergenic
908167338 1:61471437-61471459 TATATGCCAAGCACTGTTCTGGG - Intergenic
908295326 1:62707143-62707165 TGTATGCCAGGGTTTGTGCTAGG + Intergenic
908452855 1:64273360-64273382 TATGTGCCAGGCCTTGTACTAGG + Intergenic
908475425 1:64483369-64483391 TATGTGCCAGGTATTATGCTTGG + Intronic
908790697 1:67778561-67778583 TATGTGCCAGGAACTGTTCTTGG + Intronic
908911754 1:69079453-69079475 TATGTGCCAGGAACTGTTCTAGG - Intergenic
908959086 1:69672564-69672586 TATATGCCAGGTGCTTTGTTAGG - Intronic
909093243 1:71253536-71253558 TATGTGCAAGGTACTGTTCTAGG + Intergenic
909408833 1:75324974-75324996 TATATACCAGGTCTTGTACTAGG + Intronic
909461885 1:75926120-75926142 TATATGCCAGGAACTGTTTTAGG + Intronic
909464658 1:75959912-75959934 TATGTGCTAGGTGGTGTACTTGG + Intergenic
909520943 1:76566837-76566859 TTTGTGCCAGGTATTATTCTAGG - Intronic
909547498 1:76863827-76863849 TGTGTGCCAGGTATTATTCTAGG - Intergenic
909554078 1:76933318-76933340 TATCTGCCTGGTGCTATTCTAGG + Intronic
909580416 1:77227308-77227330 TATGTACCAGGTATTGTGCTAGG + Intergenic
909600165 1:77453267-77453289 CATGTGCCATGTGTTGCTCTAGG - Intronic
909680724 1:78288403-78288425 TATATGCAAGGTACTGTTATAGG - Intergenic
909698992 1:78499437-78499459 TATATGCCAGGCACTGGTCTAGG - Intronic
909822163 1:80079497-80079519 TATATTCCAGGTATTGTTCTAGG + Intergenic
910134246 1:83948126-83948148 TATGTGCCAGGGATTGTACTAGG - Intronic
910160677 1:84269222-84269244 TATATGCCAGGCATTGCTTTAGG - Intergenic
910181468 1:84487997-84488019 TATATGCTTGGTCTTTTTCTGGG + Intronic
910241173 1:85087645-85087667 TATATGCCAGGAACTGTCCTAGG - Intronic
910244047 1:85120104-85120126 TATATGCCAGGCATTGCTCTTGG + Intronic
910278132 1:85469765-85469787 CATATGCCAGGTATTGTGCTAGG + Intronic
910298499 1:85677942-85677964 TATATGCTAGGTCCTGTACTAGG + Intronic
910465312 1:87492916-87492938 TATGTGCCAGGCTTTATTCTAGG + Intergenic
910562252 1:88603022-88603044 TATGTGTCAGGTGCTGTGCTAGG - Intergenic
910660491 1:89666798-89666820 TATGTGCCAGATACTGTTCTAGG + Intronic
910683616 1:89893010-89893032 TATATGACAGGTACTGTCCTAGG + Intronic
910725933 1:90338891-90338913 TATATGCCAGAGGCTGTACTAGG + Intergenic
910825175 1:91399122-91399144 TATGTGCCAGGTATTGTTCTAGG + Intronic
911056365 1:93711679-93711701 TATGTGCCAGGTACTGTACTAGG - Intronic
911056673 1:93714406-93714428 TATGTGCCAGGCAGTGTTCTAGG - Intronic
911069184 1:93818655-93818677 TATATGTCAGGCATTATTCTAGG + Intronic
911121404 1:94300730-94300752 TATATGCCAGGTATTATGCCAGG - Intergenic
911152365 1:94607957-94607979 TACATGCCAGGAGTTGTGCTAGG - Intergenic
911365746 1:96935441-96935463 TATAGGCCAGGTATTTTTCTGGG + Intergenic
911411061 1:97508036-97508058 TATCTGCCAGACATTGTTCTTGG + Intronic
911417361 1:97591423-97591445 TATGTACCAGGTATTGTTCTGGG - Intronic
911478190 1:98400467-98400489 TATATGCTAGATATTGTTTTAGG + Intergenic
911584399 1:99673804-99673826 TATGTGCTAGGCGTTGTACTAGG - Intronic
911632280 1:100196734-100196756 TATGTGCCAAGTATTCTTCTAGG + Intronic
911645492 1:100333417-100333439 TATGTGCCAGGTACTGTTCTAGG + Intergenic
911648031 1:100356295-100356317 TGTGTGCCAGATGCTGTTCTAGG + Intronic
911716949 1:101143934-101143956 CATGTGCCAGATATTGTTCTAGG + Intergenic
911768087 1:101703032-101703054 TATATGCCAGGCAGTGTTCTAGG + Intergenic
911817342 1:102369462-102369484 TCTATGCCAGATAGTGTTCTAGG + Intergenic
911855913 1:102874460-102874482 TATATGCCAGATTTTGTGTTAGG + Intergenic
912367837 1:109149619-109149641 ACTATGTCAGGTGCTGTTCTGGG + Intronic
912507152 1:110164133-110164155 TATATGCCAGCCTCTGTTCTAGG - Intronic
912638624 1:111322201-111322223 TATGTGTCAGGTGATATTCTAGG + Intergenic
912638790 1:111323737-111323759 AATATGCCAGGCCTTGTTCTAGG - Intergenic
913028972 1:114878501-114878523 TATGTGCCAGGCATTGTTCTCGG - Intronic
913032533 1:114924066-114924088 TATGTGCCAGGCACTGTTCTGGG + Intronic
913044304 1:115060860-115060882 TAGGTGCCAGGTGGTGTTCTAGG - Intronic
913079974 1:115374769-115374791 TATGTGCCAGGCACTGTTCTAGG - Intergenic
913162272 1:116155065-116155087 TATGTGCCAGGTTCTGTTCCAGG + Intergenic
913303429 1:117398069-117398091 TATATGCCAGGTAGTGTCCTAGG + Intronic
913574555 1:120158423-120158445 TATATACCAGGCCCTGTTCTGGG - Intronic
913690637 1:121276667-121276689 ATAATGCTAGGTGTTGTTCTGGG + Intronic
914146901 1:145003291-145003313 ATAATGCTAGGTGTTGTTCTGGG - Intronic
914235530 1:145807049-145807071 TATATTCCAGGAGCTGTTCTAGG - Intronic
914295824 1:146323235-146323257 TATATACCAGGCCCTGTTCTGGG - Intergenic
914360136 1:146927993-146928015 TATGTGCCAGGCCTTATTCTAGG + Intergenic
914448335 1:147769499-147769521 TATATGCCAGATACTGTTCTAGG - Intronic
914449288 1:147776332-147776354 TACATGCCAGGCATTGTACTAGG + Intergenic
914493611 1:148171904-148171926 TATGTGCCAGGCCTTATTCTAGG - Intergenic
914556863 1:148774033-148774055 TATATACCAGGCCCTGTTCTGGG - Intergenic
914615971 1:149356197-149356219 TATATACCAGGCCCTGTTCTGGG + Intergenic
914680592 1:149935888-149935910 TATGTGCCAGGCCTTGTTCTAGG - Intronic
914738717 1:150444790-150444812 TATGTGCCAAGCATTGTTCTAGG - Intronic
914760784 1:150596354-150596376 GATATGCCAACAGTTGTTCTAGG - Intergenic
914949930 1:152104219-152104241 TATGTGCCAGGCATTGTTCCAGG - Intergenic
915245599 1:154554061-154554083 TACATGCCAGGTTCTGTCCTAGG + Intronic
915919659 1:159965117-159965139 TAAATGCCAGGCACTGTTCTAGG + Intergenic
915949572 1:160179699-160179721 TATGTACCAGGTACTGTTCTAGG + Intronic
916228443 1:162514463-162514485 TATTTGCCAGGCATGGTTCTAGG - Intronic
916331741 1:163625187-163625209 TATATGCCTGTGGTAGTTCTTGG + Intergenic
916500342 1:165381661-165381683 TATAAGTCAGGTTTTGTTCTAGG - Intergenic
916582328 1:166120147-166120169 TCTGTGCCAGGTGCTGTGCTGGG + Intronic
916582916 1:166124403-166124425 TATATGCCAGGCACTGTTCTAGG + Intronic
916611041 1:166392057-166392079 TATATTCCAGATACTGTTCTAGG + Intergenic
916828682 1:168468706-168468728 TATATGACAGGTGCTGTGCCAGG - Intergenic
916832445 1:168506831-168506853 AATGTGCCAGGTATTGTACTGGG - Intergenic
916932845 1:169597282-169597304 TATATTCCAGGTATTTTGCTAGG + Intronic
916982259 1:170151298-170151320 TATGTGCCAGGTATTATGCTAGG - Intronic
917179875 1:172284535-172284557 TATGTGCCAGGCATTGTGCTAGG - Intronic
917211533 1:172636732-172636754 TATATGTCAGGCATTGTACTAGG - Intergenic
917216570 1:172684732-172684754 TATTTGCTAGGTTTTCTTCTAGG + Intergenic
917611501 1:176693224-176693246 TATATGTGAAGTGTTGTGCTAGG + Intronic
917625017 1:176836895-176836917 TATGTGCCAGGCATTGTTATGGG - Intronic
917731929 1:177883082-177883104 TTTATGTCAGGTACTGTTCTGGG + Intergenic
918069583 1:181125115-181125137 TATTGGCCAGGTGCTGTTCCAGG + Intergenic
918163922 1:181926340-181926362 TATGTCCCAGGCATTGTTCTAGG - Intergenic
918255630 1:182744062-182744084 TATGAGTCAGGAGTTGTTCTGGG - Intergenic
918277209 1:182964857-182964879 TATATGCCAGGTTCTGTTCTGGG + Intergenic
918323615 1:183388811-183388833 TGTGTGCCAGGCATTGTTCTAGG - Intronic
918398217 1:184137552-184137574 TATGTGTCAGGTACTGTTCTTGG - Intergenic
918418278 1:184335268-184335290 TGTATGTCAGGAATTGTTCTAGG + Intergenic
918439722 1:184555140-184555162 TATAGGCTAGATATTGTTCTAGG - Intronic
918480983 1:184976165-184976187 TACATGCTAGGTGCTCTTCTAGG - Intergenic
918519412 1:185398937-185398959 TATGTGCCAGGCATTATTCTAGG - Intergenic
918653615 1:186997206-186997228 TATTTGCCAGGTATTGTCCTAGG + Intergenic
918674701 1:187268709-187268731 TCTATGTCAGGTTCTGTTCTTGG + Intergenic
919121612 1:193347955-193347977 TATATGCCAGGCACTGTTCTAGG - Intergenic
919616284 1:199812686-199812708 TTTATGCTAGGTGTAGTGCTTGG - Intergenic
919632396 1:199972025-199972047 TATATGCCAGGCACTGTTCCAGG + Intergenic
919911900 1:202116454-202116476 TATGTGCCAGGCATTGTCCTAGG - Intergenic
919965731 1:202523152-202523174 TATTTGCCAGATATTGTTCGAGG + Intronic
920477957 1:206295156-206295178 ATAATGCTAGGTGTTGTTCTGGG + Intronic
920548912 1:206841766-206841788 TATAAGCCAGGTATTGCTCTAGG + Intronic
920729428 1:208468944-208468966 TATTAGCCAGGTACTGTTCTAGG - Intergenic
920737066 1:208542461-208542483 TATGTACCAGATGTTGCTCTAGG - Intergenic
920743409 1:208602653-208602675 TGTAGGCCAGGTGCTGTGCTAGG + Intergenic
920768653 1:208858593-208858615 TATATGCCAAGTACTTTTCTTGG + Intergenic
920833839 1:209489182-209489204 TACATACCAGGTGTTTTCCTGGG - Intergenic
920864667 1:209741910-209741932 TATGTGCCAGGTGCTCCTCTAGG - Intergenic
921080022 1:211731825-211731847 TACATGCCAGCCATTGTTCTAGG + Intergenic
921188188 1:212687373-212687395 TATGTTCCAGGTACTGTTCTAGG - Intronic
921277761 1:213536507-213536529 TATACCCCAGGTGTTGTCCTAGG - Intergenic
921338825 1:214114153-214114175 TCTGTGCCAGGTGCTATTCTAGG + Intergenic
921353704 1:214264168-214264190 TATATGCCAGGTGCTGTTTTAGG - Intergenic
921371480 1:214427557-214427579 TACATGCCAGGAGTTATTCTAGG + Intronic
921453389 1:215337308-215337330 TATGTGCCAGGCATTGTTCTAGG - Intergenic
921515701 1:216088416-216088438 TATGTTCCAGGTATTGTTCTAGG - Intronic
921556857 1:216609304-216609326 AATATGCCAGGTATTGTGCTAGG - Intronic
921621165 1:217327995-217328017 TATGTGCCAAGTGCTGTGCTAGG + Intergenic
921791055 1:219291100-219291122 TATATACCAAGTGTTATTTTAGG - Intergenic
921839797 1:219816095-219816117 TATATGCCTGGTGCTATGCTAGG - Intronic
922014872 1:221635142-221635164 TATGTGCCAGGTACTGTGCTGGG + Intergenic
922083807 1:222325720-222325742 TATGTGCCAGGCATTGTGCTAGG + Intergenic
922083936 1:222326909-222326931 TATGTGCCAGGCATTGTGCTAGG - Intergenic
922115967 1:222615205-222615227 TATATTCCAGACATTGTTCTAGG + Intergenic
922277270 1:224090645-224090667 AATATGCCAGGTATTGCTCTAGG - Intergenic
922383027 1:225052534-225052556 TATATGCCAGGCATTGTACTAGG + Intronic
922632315 1:227128533-227128555 TATGTAGCAGGTGTTGTTTTAGG - Intronic
923002517 1:230019367-230019389 TATATGCCAGGTGCTGAACTAGG + Intergenic
923040027 1:230313129-230313151 TGTATGCCAGGTGATGGGCTAGG + Intergenic
923265467 1:232309411-232309433 TGTATTCCAGGTGTTATGCTAGG + Intergenic
923577472 1:235172921-235172943 TATGTGCCAGGCATTGTTCTAGG - Intronic
923705441 1:236340772-236340794 AAAATGCCGGGTGCTGTTCTAGG + Intergenic
923768945 1:236920474-236920496 TATTTGCCAGTTGTTGGTCATGG + Intergenic
923871637 1:238001018-238001040 TATATTCCAGGTATTCTTCTAGG - Intergenic
924132490 1:240926237-240926259 TATATCCTAGGTTTTCTTCTAGG + Intronic
924445571 1:244127216-244127238 TATATGCCAGGCACGGTTCTAGG + Intergenic
924594739 1:245435213-245435235 TGTATGCCAGGTATTGTGTTAGG + Intronic
924659011 1:245999335-245999357 TCTGTGCCAGGAATTGTTCTGGG + Intronic
924951083 1:248884024-248884046 TATTTCCCAGGTTTTCTTCTAGG + Intergenic
1063068602 10:2636192-2636214 TATATGCCAGGTCCTATTCTTGG - Intergenic
1063272208 10:4522986-4523008 TATTTGCTAGGTGCTGATCTTGG + Intergenic
1063746533 10:8890330-8890352 TATATGCTGGGTGTTGGACTTGG + Intergenic
1063945961 10:11176609-11176631 CATATGCCAGGCGCTGTCCTAGG - Intronic
1064270312 10:13859416-13859438 TATATGCCAGGCACTTTTCTGGG + Intronic
1064286963 10:13999998-14000020 TTTATCCCAGGTATTGTTGTAGG + Intronic
1064371923 10:14759600-14759622 TAGGTGCCAGGCATTGTTCTAGG - Intronic
1064452781 10:15458429-15458451 TATATGCCAGGTTTTCTGCCAGG + Intergenic
1064763815 10:18650732-18650754 TAAATGCCAGCAGTTGTGCTAGG - Intronic
1064885680 10:20109846-20109868 TTGATGCCAGATGTTGTTTTGGG - Intronic
1065018918 10:21486544-21486566 TATGTGCCTGGCATTGTTCTGGG - Intergenic
1065095932 10:22280659-22280681 TTTATGCCAAGCTTTGTTCTAGG - Intergenic
1065334807 10:24645735-24645757 TATGTGCCAGGAACTGTTCTGGG + Intronic
1065344536 10:24736249-24736271 TGTATGTCAGGATTTGTTCTAGG - Intergenic
1065389956 10:25173505-25173527 TATGTGCCAGGTAGTGTTCTGGG + Intergenic
1065849815 10:29778455-29778477 TATATGCCAGGCATCATTCTAGG - Intergenic
1067204279 10:44200105-44200127 AACATGCCAGGTCTTGTCCTTGG + Intergenic
1067925634 10:50505622-50505644 AATATGCCAGGCACTGTTCTAGG + Intronic
1068113151 10:52705424-52705446 TATGTTCCAGGTACTGTTCTAGG + Intergenic
1068581701 10:58748211-58748233 TATATGCCAGGCAGTGTTCTAGG + Intronic
1068712016 10:60145850-60145872 TATGTGCCAGGTTCTGTTCTGGG - Intronic
1068856312 10:61800989-61801011 TTTATTCTAGGTGTTGTGCTAGG - Intergenic
1069072931 10:64008595-64008617 TATGTGCCAGGCATTGTTATAGG + Intergenic
1069184439 10:65405450-65405472 TTTGTGCCAGGTGCTGTGCTAGG + Intergenic
1069407374 10:68116119-68116141 TATGTGCCAGGCACTGTTCTAGG - Intronic
1069444177 10:68457632-68457654 TATATGCCAAGTAATGTTTTAGG - Intronic
1069851285 10:71406769-71406791 TGTGTGTCAGGTGCTGTTCTAGG + Intronic
1069976634 10:72218637-72218659 TATAGGCCAGGTGTTATGTTTGG + Intronic
1069999908 10:72368581-72368603 TATATGCCAGGTCTTGTGCCAGG + Intronic
1070002750 10:72393179-72393201 TCTATCCCAAGTGTTGTTCTAGG + Intronic
1070225258 10:74497526-74497548 TATGTGCCAGGCATGGTTCTAGG + Intronic
1070408982 10:76121909-76121931 TATGTGCCAGGTACTGTTCTAGG + Intronic
1070511734 10:77167496-77167518 AATGTGCCAGCTGTTGTCCTAGG - Intronic
1070804031 10:79260197-79260219 TGTGTGCCAGGTATTGTTCTAGG + Intronic
1070829592 10:79410345-79410367 TATGTGCCAGGTGCTGCTCCAGG - Intronic
1071060110 10:81560021-81560043 TATATGCCAGGCATTTTTTTAGG - Intergenic
1071177475 10:82943174-82943196 TATATGCCATGTATTATTCTAGG + Intronic
1071230148 10:83576913-83576935 TATTTCCCAGGTTTTCTTCTAGG + Intergenic
1071252730 10:83837606-83837628 TATATGCCAGGTACTATTCTAGG - Intergenic
1071474204 10:86011356-86011378 TATTTGCTAGGTATTGTTCCAGG - Intronic
1071538694 10:86458505-86458527 TATACGCCAAGTACTGTTCTAGG + Intronic
1071676775 10:87662229-87662251 TGTATGCCAGGTGGTATACTGGG + Intronic
1071692109 10:87831829-87831851 TATATACCAGCTACTGTTCTAGG + Intronic
1071745379 10:88412839-88412861 TATTTGCCAGATATTATTCTAGG - Intronic
1071847200 10:89533380-89533402 TGTATGCCTAGTGCTGTTCTGGG - Intronic
1071907180 10:90187208-90187230 TGTATGCCAGATACTGTTCTAGG - Intergenic
1071998001 10:91164976-91164998 TATATGCCAGGCACTGTTCTAGG - Intronic
1072074450 10:91955308-91955330 TATTTGCCAGGTATTGTTCTAGG + Intronic
1072229626 10:93403324-93403346 AATGTGCCAGGTGCTGTACTAGG + Intronic
1072346462 10:94512524-94512546 TATATGTCAGGCATTGTTCTAGG + Intronic
1072557412 10:96531460-96531482 TTTGTGCCAGGTATTGTGCTAGG - Intronic
1072729822 10:97838171-97838193 TATGTTCCAGGTACTGTTCTGGG - Intergenic
1072790417 10:98313731-98313753 TATAAGCCAGGTGCTGTGCCAGG + Intergenic
1072839720 10:98758234-98758256 TATATCCTAGGTCTTTTTCTAGG - Intronic
1072923521 10:99596428-99596450 TGTGTTCCAGGTCTTGTTCTTGG + Intergenic
1073093556 10:100966104-100966126 TATATGCCAGGCACTGTACTAGG - Intergenic
1073237154 10:102026940-102026962 TATATGCCAGGTACTGTGGTAGG - Intronic
1073480318 10:103782575-103782597 TATATGGCAGGTACTGTTCTAGG + Intronic
1073727016 10:106244489-106244511 TTTATGCCAGATTTTGTACTAGG - Intergenic
1073786289 10:106893475-106893497 TATATGCCAGGCATTGTGCTAGG - Intronic
1073792172 10:106951752-106951774 TATATGCTAAGTCTTGTACTTGG + Intronic
1074042593 10:109806654-109806676 TATATGCCCTTTGTTTTTCTTGG - Intergenic
1074063519 10:109991029-109991051 TATATGCCAGGTTCTATGCTAGG + Intergenic
1074064270 10:109999018-109999040 TATGTGCCAGGCACTGTTCTGGG - Intronic
1074297862 10:112207704-112207726 TATGTGCCAGGAGATGTGCTGGG + Intronic
1074302323 10:112243634-112243656 TTTATGGCAGGTGTTGTTGTAGG + Intergenic
1074417243 10:113277703-113277725 TGTATACCAGGTATTGTGCTAGG - Intergenic
1074446392 10:113524618-113524640 TATGTGCCAGGAACTGTTCTAGG + Intergenic
1074754961 10:116617573-116617595 TATCTGGCAGGTGCTGTGCTAGG + Intergenic
1074793378 10:116915018-116915040 TATGTGCCAGATGCTGTTTTAGG - Intronic
1074794616 10:116929771-116929793 TATATGCCAGGTTTTGTACTAGG + Intronic
1074827348 10:117223999-117224021 TATGTGCCAGAAGTTGTGCTAGG - Intergenic
1075067226 10:119297270-119297292 TAAATGCCAGATCCTGTTCTAGG - Intronic
1075203184 10:120423308-120423330 TAAATGGGAGGAGTTGTTCTTGG + Intergenic
1075204939 10:120438865-120438887 TCTGTGCCAGGTATTTTTCTAGG + Intergenic
1075294922 10:121266617-121266639 TATCTGCCAAGTGCTGTGCTAGG - Intergenic
1075384448 10:122045197-122045219 TCTGTGCCAGGTGCTATTCTGGG + Intronic
1075432570 10:122400824-122400846 TATATGCCAGGCACTGTGCTTGG + Intronic
1075539293 10:123299041-123299063 TATATGCCAGACCCTGTTCTAGG + Intergenic
1075905222 10:126075400-126075422 TAGGTGCCAGGCATTGTTCTAGG + Intronic
1075980940 10:126738641-126738663 ACCATGCCAGGTGTGGTTCTTGG - Intergenic
1076651818 10:131994856-131994878 TATATACCAGGCATGGTTCTAGG - Intergenic
1077403758 11:2372768-2372790 TAAATGCAAGGATTTGTTCTTGG + Intergenic
1077988258 11:7377193-7377215 TCTATGCCAGGCACTGTTCTAGG + Intronic
1078001940 11:7503897-7503919 TATGTGCCAGATGCTATTCTAGG + Intronic
1078335772 11:10462094-10462116 TATTTGCCGGGTGCTGTGCTGGG + Intronic
1078491293 11:11771516-11771538 TATGTGCCAGGTGCTGTTCTAGG + Intergenic
1078541144 11:12214009-12214031 TGTGTGCCAGATGCTGTTCTAGG + Intronic
1078656463 11:13245225-13245247 TATGTGCCAGGTGCTGTGCATGG + Intergenic
1078717421 11:13853465-13853487 TGGATGCCAGGCATTGTTCTAGG - Intergenic
1078788765 11:14522937-14522959 TATATGCCAGGCTTTGTTTCAGG - Intronic
1078805100 11:14691601-14691623 TATATGCCAGGAGCAGGTCTAGG + Intronic
1078808063 11:14726357-14726379 TATATACCAGGCATTATTCTTGG - Intronic
1078839150 11:15061883-15061905 TATGTGCCAGGCATTGTTCTAGG - Intronic
1078871187 11:15346514-15346536 TCTATGCCAGGCATTGCTCTAGG - Intergenic
1078872361 11:15360628-15360650 TATATGTCACGTACTGTTCTTGG + Intergenic
1078884606 11:15487889-15487911 CATATGCCAGAGGCTGTTCTAGG - Intergenic
1078926273 11:15878386-15878408 TATGTGCCAGGTGCTATTTTAGG + Intergenic
1079154241 11:17929628-17929650 TATATGCCAGGCGCTGTGCTAGG + Intronic
1079158193 11:17968371-17968393 TATACACCAGGTGCTGTCCTAGG + Intronic
1079287734 11:19154217-19154239 TATATGCAAGGTACTATTCTAGG - Intronic
1079304865 11:19313131-19313153 AATGTGCCAGGTATTGTTCTGGG - Intergenic
1079315257 11:19402623-19402645 TATGTGCGAGGGGTTGTTCCAGG - Intronic
1079348492 11:19673292-19673314 TATATGCCAGGCACTGTGCTGGG + Intronic
1079810603 11:24994896-24994918 TATATTCTAGGTGTCATTCTAGG + Intronic
1079982871 11:27169947-27169969 TCTTTGCCAGGTTTTCTTCTAGG + Intergenic
1080099954 11:28448378-28448400 TATGTGCCAAGTGTTATTCTCGG + Intergenic
1080255292 11:30283543-30283565 TATTTCCCAGGTTTTCTTCTAGG - Intergenic
1080262261 11:30362094-30362116 TACATGCCAGGAATTGTTCCAGG - Intergenic
1080290599 11:30666786-30666808 TATGTGCCAGGCCATGTTCTAGG + Intergenic
1080303311 11:30809270-30809292 TATATCCCAGGTACTGTGCTAGG - Intergenic
1080318652 11:30980168-30980190 TATATGCCAGATGCTGTGCTAGG - Intronic
1080514290 11:33005822-33005844 TGTATGCCAGGCACTGTTCTAGG + Intergenic
1080526082 11:33120690-33120712 TATATGTTAGGCTTTGTTCTAGG - Intronic
1080549358 11:33358306-33358328 TATATGCCAGGCACTGTGCTGGG - Intergenic
1080786183 11:35477237-35477259 TATATGCCAGGTACCATTCTAGG - Intronic
1081049684 11:38322786-38322808 TAAATGCCAGGCAATGTTCTAGG + Intergenic
1081162526 11:39767419-39767441 TATGTGCCTGGGGTGGTTCTTGG + Intergenic
1081219324 11:40440185-40440207 TCTATGCCAGGAAATGTTCTAGG - Intronic
1081305188 11:41503119-41503141 TCTGTGCCAGGCTTTGTTCTAGG - Intergenic
1081505946 11:43717257-43717279 TATATGTCAGGTACTGTTCTAGG - Intronic
1081506761 11:43725596-43725618 TATATGCCAGCTACTATTCTAGG + Intronic
1081555736 11:44159049-44159071 CATATGCTAGGTGTGGTTTTTGG + Intronic
1081633030 11:44702212-44702234 TGTATGCCAGGCACTGTTCTGGG - Intergenic
1081849325 11:46264235-46264257 TATGTGCCAGGCACTGTTCTAGG - Intergenic
1081885344 11:46490813-46490835 CATATGCCAGGCAGTGTTCTAGG - Intronic
1081954133 11:47074901-47074923 TCTGTGCCAGGTATTATTCTAGG + Intronic
1082774290 11:57234038-57234060 TCTATTCCGGGTTTTGTTCTTGG - Exonic
1082874423 11:57973429-57973451 TATGTGCCAGGCTGTGTTCTAGG + Intergenic
1083056275 11:59823635-59823657 TTTATGCCAGATGCTGTGCTAGG + Intergenic
1083303464 11:61750835-61750857 TGTGTGCCAGGTCATGTTCTTGG + Intergenic
1084268210 11:68015662-68015684 TATGTGCCAGGTACTGTTCTAGG + Intronic
1084409476 11:68998067-68998089 TACATGCCAGGCAATGTTCTAGG - Intergenic
1085067647 11:73512047-73512069 TGTGTGCCAGGTATTGTTTTAGG - Intronic
1085184808 11:74566539-74566561 TACATGCCAGCTGCTGCTCTGGG + Intronic
1085190507 11:74616987-74617009 TATGTGCCAGGTCTTGAGCTGGG + Intronic
1085268072 11:75249366-75249388 TATGTGCCAGAGATTGTTCTAGG + Intergenic
1085344771 11:75761562-75761584 TATATGCCAGGCCCTGTCCTGGG + Intronic
1085526944 11:77169680-77169702 TATATGCCAGGCATTGTCATGGG + Intronic
1085565163 11:77507001-77507023 CTTATGCCAGGTATTGTTCTTGG - Intergenic
1085603335 11:77875235-77875257 TATGTGCCAGGAGTTGTGCTGGG + Intronic
1085813085 11:79703956-79703978 TCTCTGCCAGGTGTTGATATTGG - Intergenic
1085819788 11:79780201-79780223 TATATGCCAGGGACTGTGCTGGG - Intergenic
1085825548 11:79843214-79843236 TGTATGCCAGGAATTATTCTAGG + Intergenic
1085853260 11:80146304-80146326 AATATGCCAAGTATTGTTCCTGG + Intergenic
1085862057 11:80245787-80245809 TCCATGCCAGGTCTGGTTCTTGG - Intergenic
1085862478 11:80250599-80250621 AATATGCCAGGAGCTGTTCAAGG - Intergenic
1085962856 11:81482980-81483002 TATATGCCAATTATTGTTATAGG + Intergenic
1086089360 11:82989886-82989908 TATATGCAAGGTACTGTGCTAGG + Intronic
1086159523 11:83706295-83706317 TCTATATCAGGTGTTGTGCTAGG + Intronic
1086294952 11:85355218-85355240 TATGTGCAAGGTATTTTTCTAGG + Intronic
1086415822 11:86588092-86588114 TATGTGCCAGGCATTGTACTAGG + Intronic
1086474466 11:87156171-87156193 TATATGCAAGGTTTTATTTTTGG + Intronic
1086478734 11:87209723-87209745 TATGTAACATGTGTTGTTCTTGG - Intronic
1086749567 11:90474296-90474318 TGTGTGCTAGGTTTTGTTCTAGG - Intergenic
1087006028 11:93472707-93472729 TATGTGCCAGGTACTGTTCTTGG - Intergenic
1087040051 11:93790114-93790136 TATGTGCCAGGCATTGTTCTAGG + Intronic
1087043195 11:93821429-93821451 TATATGCCAGGAACTGTTCTAGG + Intronic
1087043240 11:93821842-93821864 TATGTGCCAGGCATTGTACTGGG - Intronic
1087092445 11:94287535-94287557 GATATGTCAGGTGCTATTCTGGG + Intergenic
1087182992 11:95157880-95157902 TATGTGCCAGGTACTGTGCTAGG + Intergenic
1087192487 11:95269530-95269552 TACATGCCAGGTACTATTCTAGG - Intergenic
1087218119 11:95516804-95516826 TTTATGCCATGTAATGTTCTGGG + Intergenic
1087220105 11:95537596-95537618 TATATGCCAGGCATTATTCCAGG - Intergenic
1087230273 11:95653471-95653493 TATGAGCCAGATGCTGTTCTGGG + Intergenic
1087577301 11:100005129-100005151 TATGTGCCAGGTGCTGTGGTAGG - Intronic
1087611890 11:100444658-100444680 TATATGCCAGGCATTGTGCTAGG + Intergenic
1088076369 11:105854070-105854092 TAGATGCCAAGTCTTCTTCTAGG + Intronic
1088329747 11:108639113-108639135 TGTGTGCCAGGTGCTGTTCTAGG + Intergenic
1088372516 11:109107014-109107036 TATATTCCTGTGGTTGTTCTTGG + Intergenic
1088403966 11:109451456-109451478 TAAATGCAAGGTGTTGGTATTGG - Intergenic
1088531098 11:110810506-110810528 TATATGCCAGGTACTGTTCTAGG - Intergenic
1088888189 11:114024051-114024073 TATGTGCCAGGCATTGTGCTGGG + Intergenic
1089000521 11:115048224-115048246 TTTATACCAGGCATTGTTCTAGG - Intergenic
1089085477 11:115813459-115813481 TATGTGCCAGGCACTGTTCTGGG - Intergenic
1089189717 11:116644936-116644958 TATGTGCCAGGTGCTTTGCTGGG + Intergenic
1089298440 11:117483447-117483469 TATGTGCCAGGTCTTGTCCCGGG + Intronic
1089326728 11:117662595-117662617 TATGTGCAGGGTGTTGTGCTAGG - Intronic
1089488506 11:118865813-118865835 TATGTGCCAGGTTGTGGTCTAGG - Intergenic
1089654324 11:119935835-119935857 TAAGTGCCAGGTGCTGTGCTGGG + Intergenic
1089704371 11:120266901-120266923 TATGTGCAAGGTGCTGTTCCAGG - Intronic
1089749825 11:120643059-120643081 TGTATGGCAGGCATTGTTCTAGG + Intronic
1089828958 11:121307722-121307744 AAAATGCCAGATGTTGTTCGGGG + Exonic
1090024877 11:123158977-123158999 TATGTGCCAGGGATTGTGCTAGG + Intronic
1090235532 11:125144103-125144125 CATGTCCCAGGTGTTGTTTTAGG - Intergenic
1090253930 11:125269945-125269967 TATGTGCCAGGTGTTGTTGTGGG + Intronic
1090257687 11:125297014-125297036 TATGTGCCAGGCATTGTTGTAGG - Intronic
1090655888 11:128845200-128845222 TATATACCAGGTGCTATGCTAGG + Intronic
1090775911 11:129965695-129965717 TATGTGCCAGGCACTGTTCTAGG + Intronic
1090808876 11:130219903-130219925 TGTTTGCCAGGCCTTGTTCTAGG + Intergenic
1091002954 11:131926022-131926044 TATGAGCCAGGAGCTGTTCTAGG + Intronic
1091109873 11:132955952-132955974 TATATGCCAGGAATTATTCTGGG - Intronic
1091328311 11:134709427-134709449 TATGTGCCAGATGTTATTCTAGG - Intergenic
1091436024 12:473725-473747 TATATGCCAGGCTATGCTCTGGG + Intronic
1091619527 12:2075814-2075836 GATGTGCCAGGGCTTGTTCTTGG + Intronic
1091674433 12:2478593-2478615 TATGGGCCTGATGTTGTTCTGGG + Intronic
1091810267 12:3391163-3391185 TATGTGCCCGGTGCTGTTCCAGG + Intronic
1092786236 12:12029535-12029557 TATAGGCCAGGTGGTGAGCTAGG - Intergenic
1092827194 12:12411937-12411959 TATATGTGAGGGTTTGTTCTGGG + Intronic
1092830992 12:12444086-12444108 TACATGCCAGGCATTGTTCTAGG - Intronic
1092870133 12:12798902-12798924 TATATGCTAGGTATTTTTCTAGG + Intronic
1092929694 12:13304302-13304324 TATATGGCAGGAGCTGTGCTAGG + Intergenic
1092954143 12:13533822-13533844 TATGTGCCAGGCATTGTTCTAGG - Intergenic
1093100703 12:15025392-15025414 TATTTTCCAGGTTTTCTTCTAGG + Intergenic
1093707819 12:22295024-22295046 TATGTGCCTAGTGCTGTTCTAGG + Intronic
1093874915 12:24339011-24339033 TATATGCCAGGTAGTATTCTAGG + Intergenic
1093877085 12:24361503-24361525 TTTGTGCCAGGAATTGTTCTTGG - Intergenic
1094055541 12:26265824-26265846 TATATGCCAGGCACTGTTCCAGG + Intronic
1094117631 12:26934768-26934790 TATATGCCAGGTGCTATTGCTGG + Intronic
1094252409 12:28379198-28379220 TATTTCCCAGGTTTTCTTCTAGG - Intronic
1094268103 12:28581337-28581359 TACAAGCCAGGTGTTGCTCCAGG - Intergenic
1094384381 12:29878171-29878193 TACATGTCAGGCATTGTTCTTGG - Intergenic
1094398197 12:30031479-30031501 TAAATGCCAGGTTCTATTCTAGG + Intergenic
1094482781 12:30898001-30898023 TATGTGCCAGATGCTGTTCCAGG - Intergenic
1094566533 12:31603435-31603457 TATATGCCAGGTAATGTTCCAGG + Intergenic
1094574392 12:31670770-31670792 TATATACCAGGCACTGTTCTAGG + Exonic
1094588305 12:31798029-31798051 TATACAACAGGTGTTGGTCTAGG + Intergenic
1094643064 12:32295418-32295440 TATGTGCCAGGTGCTGTGCTAGG + Intronic
1095130135 12:38531485-38531507 TATTTCCCAGGTTTTCTTCTAGG + Intergenic
1095214213 12:39529001-39529023 TGTGTGCCAGGTTTTGTCCTAGG + Intergenic
1095215830 12:39546374-39546396 TATCTGCCATGTATTGTTCTAGG + Intergenic
1095275939 12:40282290-40282312 TATTTGCTAGATGTTGTGCTAGG + Intronic
1095390185 12:41696776-41696798 TATATGCCAGGCAGAGTTCTAGG - Intergenic
1095452218 12:42344138-42344160 TGTGTGCCAGGTGCTGTTCTAGG + Intronic
1095679572 12:44958443-44958465 TATATACCAGGCGCTGCTCTAGG + Intergenic
1095705458 12:45232274-45232296 TGTATGTCAGGTGTTGTGTTAGG + Intronic
1095909321 12:47409814-47409836 TATGTGCCAGGCATTGTTCTAGG - Intergenic
1096136496 12:49206464-49206486 TATGTGCCAGGCTGTGTTCTGGG + Intronic
1096167816 12:49438844-49438866 TATGTGCCCGGTATAGTTCTAGG + Intronic
1096209048 12:49748294-49748316 TAAATGCCTTGTTTTGTTCTAGG - Intronic
1096261429 12:50094676-50094698 TATATGTCAGGTACTGTGCTTGG + Intronic
1096446475 12:51697409-51697431 TTTGTGCCAGGTCTTGTGCTAGG + Intronic
1096752605 12:53771511-53771533 TATATGCCAGTCGCTGTGCTTGG - Intergenic
1096768151 12:53911501-53911523 TTTGTGCCAGGTACTGTTCTAGG + Intergenic
1097268122 12:57757281-57757303 TATATTCCAGGCACTGTTCTAGG + Intronic
1097298061 12:57988783-57988805 TTTATGCCAGGCACTGTTCTAGG + Intergenic
1097370052 12:58767301-58767323 TATGTGCCAAGTGCTGTTCTAGG + Intronic
1097545923 12:61001455-61001477 TATTACCCAGGTGTTCTTCTAGG + Intergenic
1097636992 12:62134719-62134741 TATATGCTAGGTGTTGGTGATGG - Intronic
1097664699 12:62466108-62466130 TATATGCCAGACACTGTTCTAGG + Intergenic
1097856444 12:64468563-64468585 TATATACCAGATACTGTTCTAGG + Intronic
1097924308 12:65110712-65110734 TATGTGCCAGGAGCTGTTCCGGG + Intronic
1097970088 12:65624191-65624213 TATATGTCAGTTATTGTTCTAGG - Intergenic
1098072671 12:66692929-66692951 TATATGTTAGGTACTGTTCTAGG - Intronic
1098093865 12:66933574-66933596 TATATACCAGGCATTTTTCTAGG + Intergenic
1098141340 12:67453047-67453069 TATATGCCAGGCACTTTTCTAGG + Intergenic
1098158883 12:67628726-67628748 TATGTCCCAGGCATTGTTCTGGG + Intergenic
1098364455 12:69687945-69687967 TATATGCCAGGCACTGTGCTGGG - Intronic
1098424282 12:70341637-70341659 TATATGCCTGGCACTGTTCTAGG - Intronic
1098444946 12:70556893-70556915 TATGTGCCAGGTGCTCTTCTGGG + Intronic
1098469870 12:70830939-70830961 TATATGTCAGGCATTGTGCTAGG - Intronic
1098597310 12:72289651-72289673 TGAATGGCAGGTATTGTTCTAGG + Intronic
1098784337 12:74731222-74731244 TATATGCCAGGTGCTGTTCTAGG + Intergenic
1098848540 12:75567228-75567250 TATGTTCCAGGTATTGTTCTAGG + Intergenic
1099033451 12:77557693-77557715 TATGTGTCAGAGGTTGTTCTTGG - Intergenic
1099127106 12:78775840-78775862 TATATTCCAGGTATTTTTCTAGG + Intergenic
1099140869 12:78973801-78973823 TATATGCCAAGTGATGTTCTAGG + Intronic
1099225595 12:79965167-79965189 TATATGTTAGGTTTGGTTCTAGG - Intergenic
1099325292 12:81207527-81207549 TATATGCCAGGAATTCTTCTAGG - Intronic
1099362153 12:81717661-81717683 TATATGCCAGGCACTGTCCTGGG + Intronic
1099388952 12:82054797-82054819 TATATTCCAGGCCTTGTGCTAGG - Intergenic
1099783439 12:87230141-87230163 TAGATGCCAGGTACTGTACTAGG - Intergenic
1099849614 12:88075454-88075476 TATGTGCCAGCGATTGTTCTAGG + Intronic
1099936187 12:89128553-89128575 TATATGCCTGGCCTTGTTCTAGG - Intergenic
1099942363 12:89203689-89203711 TATATGCCAGATCCTATTCTAGG - Intergenic
1100271244 12:93027226-93027248 CATCTGCCAGATCTTGTTCTTGG - Intergenic
1100364653 12:93908679-93908701 TATATGCCAGGCCCTGCTCTAGG - Intergenic
1100394821 12:94175751-94175773 TATGTGCCAGGCACTGTTCTGGG + Intronic
1100429604 12:94518826-94518848 TGTATGCTAGGTATGGTTCTAGG - Intergenic
1100580195 12:95931618-95931640 TATGTGCCAGGTAGTGTTTTAGG + Intronic
1100596039 12:96072955-96072977 TATGTGCCAGGCACTGTTCTTGG - Intergenic
1100643891 12:96509042-96509064 CATATGCTAGGCATTGTTCTAGG + Intronic
1100675554 12:96863118-96863140 TATGTGCCAGGTATTGTTCTAGG - Intronic
1100890713 12:99122942-99122964 CATGTGCCAGGTTCTGTTCTAGG + Intronic
1100892192 12:99138088-99138110 CATATGCCAGATGTTATGCTAGG - Intronic
1100999971 12:100347624-100347646 TATGTGCCAGGAGCTGTGCTAGG - Intergenic
1101066133 12:101023117-101023139 TATATGCCAGGCACTGTGCTAGG - Intronic
1101140609 12:101791899-101791921 TATGTGCTAGGTACTGTTCTAGG + Intronic
1101201675 12:102442879-102442901 TATATGCCAGGCACTGTGCTAGG + Intronic
1101268706 12:103119684-103119706 TATATGCCAGGTGTTGGGCTAGG - Intergenic
1101310312 12:103572653-103572675 TATGTGCCAGATGCTGTTTTAGG - Intergenic
1101349224 12:103912954-103912976 TATGTGTCTGGTGTTGTTTTTGG + Intergenic
1101521519 12:105486554-105486576 TATGTGCCAGGTGTTGTGTTTGG + Intergenic
1101563242 12:105880258-105880280 ATTATGTCAGGTGCTGTTCTAGG - Intergenic
1101649025 12:106658085-106658107 TCTGTGCCAGGCATTGTTCTGGG - Intronic
1101691899 12:107090649-107090671 TATATGCCAGGCACTGTTTTAGG - Intronic
1101815036 12:108139704-108139726 TATGTGCTAGGTATTGTGCTGGG - Intronic
1101861340 12:108484877-108484899 TATATGCCAGGTACTGTTCTAGG - Intergenic
1102053262 12:109878770-109878792 TATGTGCCAGGCACTGTTCTGGG + Intronic
1102330126 12:112021863-112021885 TATGTGTCAGATGCTGTTCTAGG - Intronic
1102531791 12:113552056-113552078 TATGTCCTAGGTGTTCTTCTTGG - Intergenic
1102742462 12:115220186-115220208 TATGTGCTAGGCTTTGTTCTAGG + Intergenic
1102972321 12:117178942-117178964 TATGTGCCAGATGCTATTCTAGG - Intronic
1103039603 12:117684344-117684366 TATATGCCAGGCTTTGTGCTGGG - Intronic
1103142280 12:118559147-118559169 TCTGTGCCAGGCGTTGTGCTAGG - Intergenic
1103282281 12:119769433-119769455 TATGTGCCAGGCACTGTTCTAGG - Intronic
1103400112 12:120638107-120638129 TATCTGCCAGGCAGTGTTCTAGG - Intergenic
1103569362 12:121834325-121834347 TATGTGCCAGGTACTCTTCTAGG + Intergenic
1103586316 12:121958861-121958883 TCTGTGCCAGGCTTTGTTCTGGG - Intronic
1103673827 12:122640314-122640336 TATGTGCCAGGAACTGTTCTGGG + Intergenic
1103681750 12:122699760-122699782 TGTGTGCCAGGCGCTGTTCTGGG - Intergenic
1103683503 12:122713224-122713246 TGTGTGCCAGGCGCTGTTCTGGG - Intergenic
1103861010 12:124013994-124014016 TATATGCCAGGCACTGTGCTAGG + Exonic
1103987408 12:124777267-124777289 GACATGCCCCGTGTTGTTCTAGG - Intronic
1104390841 12:128389556-128389578 TATGTGCCAGGCTCTGTTCTGGG - Intronic
1104520880 12:129473846-129473868 TATGTACCAGGTGTTTTGCTAGG - Intronic
1104548648 12:129735291-129735313 TAAATGCCAGGTGGTGTGATAGG - Intronic
1104646090 12:130498377-130498399 TATATGCCAGATTTTGTGCTGGG + Intronic
1105353295 13:19634954-19634976 TGTATGCCAGGTGCTGTGTTAGG + Intronic
1105914748 13:24902980-24903002 TTTATTCCAGGTGTTGCTCTGGG - Intronic
1106081542 13:26504799-26504821 CATGTGTCAGGTGTTTTTCTGGG + Intergenic
1106110382 13:26771814-26771836 TATCTGCCAGGCAGTGTTCTAGG - Intergenic
1106186134 13:27411676-27411698 TACATTCCAGGCATTGTTCTAGG - Intergenic
1106607464 13:31242408-31242430 TATGTACCAGGTACTGTTCTAGG - Intronic
1106713149 13:32359861-32359883 TATGTGCCAGGTACTATTCTGGG + Intronic
1106826623 13:33529522-33529544 CATATGCCAAGTGTTGTCCCAGG + Intergenic
1106833709 13:33612084-33612106 TATGTACCAGGTGTTGTGTTAGG + Intergenic
1107006829 13:35621267-35621289 TATGTGCCAGGCAGTGTTCTAGG - Intronic
1107047031 13:36004389-36004411 TATGTGCCAGGTCCTGTTTTAGG - Intronic
1107134094 13:36925222-36925244 TATGTGCCAGGCATTGTTCCAGG - Intergenic
1107180305 13:37450681-37450703 TTTATGCCTGGTACTGTTCTAGG - Intergenic
1107293471 13:38884011-38884033 TATGTGCTAAGTGTTATTCTTGG - Exonic
1107312260 13:39092010-39092032 TATATGCCAGGCATTATACTTGG - Intergenic
1107386009 13:39910161-39910183 AATATGCCAGGTATTGTTTGAGG - Intergenic
1107536209 13:41336213-41336235 TACATGCCAGGTACTGTTCTAGG - Intronic
1107734745 13:43387075-43387097 CATATGCCAGGCATTGTTTTAGG + Intronic
1107979877 13:45724541-45724563 TATATGCCAGGTACTGTGCTGGG - Intergenic
1108564946 13:51687220-51687242 TATGTGCCAGGCAGTGTTCTAGG + Intronic
1108614507 13:52118460-52118482 TCTATGCCAGGCATTGTTCTAGG - Intronic
1108801768 13:54105349-54105371 TATGTGCTAGGCCTTGTTCTTGG - Intergenic
1109185977 13:59268999-59269021 TATATGCTAGGTAGTGTTTTTGG - Intergenic
1109249000 13:59995544-59995566 TATATACCAGGCACTGTTCTTGG + Intronic
1110169878 13:72487866-72487888 TATGTGCCAGGTATTGTGCTAGG + Intergenic
1110650948 13:77940162-77940184 TGTATTCCAGGTGCTATTCTAGG + Intergenic
1110687907 13:78396832-78396854 TATATGCCAGACACTGTTCTAGG + Intergenic
1110693459 13:78459178-78459200 TTTATGCTAGGTACTGTTCTAGG - Intergenic
1110717200 13:78719846-78719868 TAGATGCCAGTTGTGGTGCTAGG + Intergenic
1110745777 13:79051717-79051739 TATGTGCCAGGTCTTGTGGTAGG + Intergenic
1110798778 13:79670719-79670741 TATATGCCAGGCACTGTGCTAGG - Intergenic
1111066330 13:83097383-83097405 TACATGCCAGGCATTGTTTTAGG - Intergenic
1111089696 13:83427344-83427366 TATTTACCAGGTTTTCTTCTGGG + Intergenic
1111251539 13:85608214-85608236 TATATGCCAGATGTTGATTTAGG - Intergenic
1111666085 13:91270255-91270277 TACATTCCAGGAATTGTTCTTGG + Intergenic
1111836747 13:93397636-93397658 TATGTGCCAGGTACTGTGCTGGG + Intronic
1111922250 13:94424721-94424743 TATGTGCCAGGCACTGTTCTGGG + Intergenic
1112193718 13:97203809-97203831 TATATGCCAGGCAATGTTCTAGG - Intergenic
1112674527 13:101684174-101684196 TATATGCAAGGAATTGTTTTTGG + Intronic
1112690193 13:101884525-101884547 TATATGACAGGCTCTGTTCTAGG - Intronic
1112703759 13:102042531-102042553 TATATGCCAGGCCCTGTTCTAGG - Intronic
1113174208 13:107543491-107543513 TATATGGCAGATTTTTTTCTAGG - Intronic
1114332986 14:21657017-21657039 TATATTCCAGGCACTGTTCTAGG - Intergenic
1114925991 14:27399666-27399688 TCTATGCCAGATATTGTTCTAGG + Intergenic
1115129181 14:30033155-30033177 TATGTGTCAGGCATTGTTCTTGG - Intronic
1115330713 14:32194296-32194318 TATATGCCAGGCAATGTTCTAGG - Intergenic
1115813780 14:37140339-37140361 TATGTGTCAGATGTGGTTCTAGG - Intronic
1115846630 14:37542819-37542841 TATGTGCCAGGCATTGTGCTGGG - Intronic
1115862247 14:37700370-37700392 TATATGCCAGATTCTGTGCTAGG - Intronic
1115882072 14:37930691-37930713 AATATGCCAGTTATTTTTCTAGG - Intronic
1115993547 14:39173400-39173422 TATGTGCCAGGTGCTATTCTAGG - Intergenic
1116425659 14:44787490-44787512 TATGTGCCAGATATTATTCTAGG + Intergenic
1116509853 14:45731360-45731382 TACATGCCCGGTGTTGCGCTGGG + Intergenic
1116604645 14:46974557-46974579 TATATGCAAGGGGTACTTCTGGG - Intronic
1116942885 14:50808628-50808650 TCTATGCCAGGCATTGTACTTGG + Intronic
1117118583 14:52543618-52543640 TCTGTGCCAGGTGTTGTCTTAGG - Exonic
1117560232 14:56930064-56930086 TATATGCCAAATGCTATTCTAGG - Intergenic
1118063906 14:62169569-62169591 TATATGTCAGGCACTGTTCTAGG - Intergenic
1118373190 14:65154927-65154949 CATATGCCAGGCCTTGCTCTAGG - Intergenic
1118477239 14:66128965-66128987 TAAATGCCAGGCACTGTTCTAGG + Intergenic
1118650255 14:67883820-67883842 TATATGCCAGGCACTGTTCTGGG - Intronic
1118851719 14:69588901-69588923 TAAATGTCAGGTCTTGTGCTTGG + Intergenic
1118889933 14:69900383-69900405 TATGTGCCAGCTAGTGTTCTAGG + Intronic
1118919638 14:70138327-70138349 TATGTGCCAGGTACTCTTCTAGG - Intronic
1119045288 14:71313652-71313674 TATGTGCCAGGCACTGTTCTAGG + Intergenic
1119109760 14:71960518-71960540 TATGTGCCAGGTTCTGCTCTAGG + Intronic
1119469280 14:74883859-74883881 TATATGCCAGCCACTGTTCTAGG + Intronic
1119475804 14:74927134-74927156 TATATGCCAGATGCTGCCCTAGG - Intergenic
1119529914 14:75352827-75352849 TATGTGCCAAGTACTGTTCTAGG - Intergenic
1119680267 14:76586878-76586900 TATGTGCCAGGCACTGTTCTAGG + Intergenic
1119691169 14:76673891-76673913 TGCATGCCAGGTGCTGATCTTGG - Intergenic
1119787393 14:77323778-77323800 TATCTGCCAGCTGTTTTTATGGG + Intronic
1119912776 14:78365789-78365811 TATATGCCAGGCACTCTTCTTGG + Intronic
1120106062 14:80496186-80496208 TATATGCCAGTCATTGTGCTAGG - Intronic
1120162121 14:81156990-81157012 TATGTGCCAGGGATTGTTCTAGG - Intergenic
1120291225 14:82573406-82573428 TATGTGACAGGCATTGTTCTAGG - Intergenic
1120390340 14:83899198-83899220 TGTATGTCAGGTTTTGTGCTAGG + Intergenic
1120915679 14:89708034-89708056 TATCTGCCAGATCTTGTTCTAGG + Intergenic
1121239762 14:92420571-92420593 TATGTGCCAGGCTTTGATCTGGG + Intronic
1121300153 14:92863649-92863671 TATTTGCCAGGCATTATTCTTGG + Intergenic
1121316482 14:92964066-92964088 TATATGCCCTGTGTAATTCTTGG - Intronic
1121508007 14:94491106-94491128 TGTATACCAGGTGCTGTTCTAGG + Intronic
1121634234 14:95442958-95442980 CATATGCCAGGCAGTGTTCTAGG - Intronic
1121742110 14:96261331-96261353 TATGTGCCAGGCACTGTTCTAGG - Intronic
1121746002 14:96293458-96293480 TGTATGCCAGGTTTTGATCTAGG - Intronic
1121867331 14:97374752-97374774 TATGTGCCAGGCACTGTTCTAGG - Intergenic
1122165157 14:99817704-99817726 TCTGTGCCAGGTGTTGTGCTAGG + Intronic
1122223403 14:100257302-100257324 TATGTGCCTGGCATTGTTCTGGG - Intronic
1122373255 14:101241144-101241166 TCTGTGCCAGGTACTGTTCTAGG + Intergenic
1122474091 14:101993876-101993898 TATGTGCCAGGCACTGTTCTAGG - Intronic
1122848845 14:104515790-104515812 TATGTGCCAGGTGTCCTTCCAGG + Intronic
1122896733 14:104761325-104761347 TATATGCCAGGTACTGCTCTAGG - Intronic
1123693084 15:22855491-22855513 TGTATGCCAGGCATTGTTCTAGG + Intronic
1123887146 15:24737679-24737701 TATATGCCAGGTGTGGTGGCAGG - Intergenic
1123976679 15:25560205-25560227 TGTATGCCAGGCGTCATTCTTGG - Intergenic
1124035758 15:26052465-26052487 TTTTTGCCAGGTGTTGCTATTGG - Intergenic
1124047606 15:26164464-26164486 TATGTGCCAGCTGCTGTGCTAGG + Intergenic
1124242863 15:28045675-28045697 TATGTGCCGGGTGCTGTGCTGGG - Intronic
1125285163 15:38084700-38084722 TATATGCCAAGGTTTGTGCTAGG - Intergenic
1125669249 15:41458269-41458291 TCTGTGCCAGGTACTGTTCTAGG - Intronic
1125718441 15:41833269-41833291 TATGTGCTAGGTACTGTTCTAGG + Intronic
1125777875 15:42234467-42234489 TATATGCCAGGAAGTATTCTAGG - Intronic
1125905077 15:43384224-43384246 TATGTGCTAGGCATTGTTCTAGG + Intronic
1126164386 15:45642066-45642088 TAAATGCCAGGGATTGTGCTAGG - Intronic
1126167234 15:45663882-45663904 TATAAGCCAGGTGCAGTTTTAGG + Intronic
1126167509 15:45666395-45666417 TATGTGCCAGATATTGTGCTAGG - Intronic
1126270084 15:46805631-46805653 TATTTCCTAGGTTTTGTTCTAGG - Intergenic
1126491946 15:49246869-49246891 TATATGCCATGCGTTGTTCTAGG + Intronic
1126522302 15:49609055-49609077 TATTTGCCAGATATTTTTCTGGG - Intronic
1126682897 15:51220441-51220463 TTTATGCCAGGCACTGTTCTAGG - Intronic
1126780180 15:52133089-52133111 TATATGCTAGATATTATTCTAGG - Intronic
1126978084 15:54208494-54208516 TATGTGCTAGGTGTTATTCAAGG + Intronic
1127006557 15:54577364-54577386 CATATGCCAGGCTTTGTGCTAGG + Intronic
1127445866 15:59062526-59062548 TATATGTCAGGCACTGTTCTAGG + Intronic
1127575966 15:60292676-60292698 TATGTGCCAGGTCCTGTACTAGG - Intergenic
1127641824 15:60923375-60923397 TATGTGCCAGGTGCTGTGCTGGG - Intronic
1127646783 15:60966536-60966558 CATGTGCCAGATATTGTTCTAGG - Intronic
1127705563 15:61544230-61544252 TATGTGCCAGGCGCTGTACTAGG + Intergenic
1127732675 15:61815078-61815100 TACATGCCAGGCACTGTTCTAGG + Intergenic
1127852329 15:62924673-62924695 TCTGTGCCAGGTGCTGTGCTAGG - Intergenic
1128075045 15:64820707-64820729 TTTATGCCAGGCCTTGTGCTAGG + Intronic
1128197026 15:65767394-65767416 TATTTGCCAGGTACTGTTCTAGG - Intronic
1128240966 15:66100729-66100751 TATGTGCCAGATGCTGTGCTGGG + Intronic
1128250498 15:66160632-66160654 TATATGCCAGGCACTGCTCTAGG + Intronic
1128306913 15:66604756-66604778 TACATGCCAGGTTCTGTTCTAGG - Intronic
1128366055 15:67004074-67004096 TAGATGTCAGGCATTGTTCTGGG - Intergenic
1128521283 15:68376508-68376530 TCTGTGCCAGATGCTGTTCTGGG - Intronic
1128694993 15:69754937-69754959 TGTATGCCAGGTACTTTTCTTGG + Intergenic
1128714733 15:69899888-69899910 TCTGTGACAGGTGTTGTGCTTGG + Intergenic
1128803314 15:70511649-70511671 TATTTCCCAGGTTTTCTTCTAGG - Intergenic
1128848387 15:70923510-70923532 TATATGCCAGGCATTGTTCTAGG + Intronic
1129060239 15:72855249-72855271 TATGTGCCAGGCACTGTTCTAGG - Intergenic
1129268300 15:74406542-74406564 TATGTGCCAGGCACTGTTCTAGG + Intergenic
1129411001 15:75350250-75350272 TTCATGCCAGGCCTTGTTCTAGG + Intronic
1129482881 15:75842422-75842444 TATATAACAGGTCTTGTTCTAGG + Intergenic
1129553078 15:76474275-76474297 GATGTTCCAGGTGTTGTGCTAGG + Intronic
1129807913 15:78480117-78480139 TATGTGCCAGCAATTGTTCTAGG - Intronic
1130010618 15:80150953-80150975 TCTGTGCCAGGTGTTTTGCTGGG + Intergenic
1130010757 15:80151906-80151928 TATATGCCAGGCACTATTCTAGG + Intergenic
1130189403 15:81718419-81718441 TATGTTCCAGGAATTGTTCTAGG + Intergenic
1130237531 15:82150464-82150486 TGTGTGCCAGGTGCTGTTCTGGG + Intronic
1130569081 15:85024300-85024322 TATATGCCAGGTACTGTGCCAGG - Intronic
1130759302 15:86801573-86801595 TATATGCCAAGAGACGTTCTTGG - Intronic
1130795996 15:87209985-87210007 TTCAAGCCAGGTGTTTTTCTTGG + Intergenic
1130891692 15:88138871-88138893 TATATGCCAGGCTCAGTTCTAGG - Intronic
1131216344 15:90539015-90539037 GATGGGCCAGGTGCTGTTCTCGG - Intronic
1131286746 15:91065693-91065715 TATCTGCCAGGTATTGTGCTAGG - Intergenic
1131368431 15:91859738-91859760 TATGTGCCAGATATTGTTCAAGG - Intronic
1131775742 15:95796429-95796451 TATGTGCCAGATGTTCTCCTGGG + Intergenic
1131801712 15:96076048-96076070 TATAGGACAGGTGTTGTCCTGGG - Intergenic
1131926772 15:97393279-97393301 TATATACCTGGTTTTATTCTAGG - Intergenic
1132237676 15:100234347-100234369 CATATGCCAGGCGGTGTCCTGGG - Intronic
1132635752 16:945375-945397 TATTAGCCAGGTGTGGTGCTGGG + Intronic
1132818933 16:1851527-1851549 TGTATGCTGGGTGCTGTTCTGGG - Intronic
1133073236 16:3260713-3260735 TGTATGCCAGATGCTATTCTAGG + Intergenic
1133347750 16:5081708-5081730 AATAAGCCAGGTGTTGTGGTGGG - Intronic
1134174321 16:11993529-11993551 TATATACCAGGCACTGTTCTAGG + Intronic
1134178171 16:12025491-12025513 TATATACCAGGTGCTGAGCTAGG + Intronic
1134389618 16:13807426-13807448 GATATGCCTGCTGATGTTCTAGG - Intergenic
1134433793 16:14236400-14236422 TATGTGCCAGGCACTGTTCTGGG + Intronic
1134560985 16:15209348-15209370 TATGTGTCAGATGTTTTTCTTGG - Intergenic
1134655809 16:15947776-15947798 TATATGCCAGATGTCTTGCTAGG - Intergenic
1134749790 16:16616984-16617006 TATGTGCCAGGCACTGTTCTAGG + Intergenic
1134760071 16:16706428-16706450 TATATGCCAGACATTGTTCTGGG + Intergenic
1134801261 16:17086870-17086892 TATATGCCAGGTCGTGGGCTAGG - Intergenic
1134872026 16:17660818-17660840 TATATACCAGGTTCTGTGCTGGG - Intergenic
1134884248 16:17775775-17775797 TGTGTGCCAGGTGCAGTTCTAGG - Intergenic
1134914384 16:18057757-18057779 GATATGCCAGGCACTGTTCTAGG + Intergenic
1134921522 16:18120968-18120990 TATGTGTCAGATGTTTTTCTTGG - Intergenic
1134986000 16:18652777-18652799 TATATGCCAGACATTGTTCTGGG - Intergenic
1134995683 16:18736631-18736653 TATGTGCCAGGCACTGTTCTAGG - Intergenic
1135115934 16:19723427-19723449 TATGTGCCAGGCATTGTGCTAGG + Intronic
1135174203 16:20213671-20213693 TGTATGCCAGGCACTGTTCTAGG - Intergenic
1135188096 16:20332249-20332271 TATGTGCCAGGCACTGTTCTAGG - Intergenic
1135485601 16:22862111-22862133 TAAGTGCCAGGTGCTGTACTTGG - Intronic
1135550082 16:23391165-23391187 TGTGTGCCAGCTGTAGTTCTAGG - Intronic
1135812176 16:25598022-25598044 TCTGTGCCAGGTACTGTTCTAGG + Intergenic
1135823316 16:25704044-25704066 TATCTGCCAGGCACTGTTCTGGG - Intronic
1135997199 16:27259402-27259424 TATTTGCCAGTGGTTGTTCTGGG + Intronic
1136012616 16:27373793-27373815 TATGTGCCAGGCACTGTTCTAGG - Intergenic
1136595772 16:31248883-31248905 TATGTGCCAGGTGCTGCTCCAGG - Intergenic
1137256606 16:46780162-46780184 TAAATGTCAGGTGTTCTGCTAGG - Intronic
1137316546 16:47330339-47330361 TATTTCCTAGGTTTTGTTCTAGG - Intronic
1137688726 16:50405032-50405054 TTTATGCCAAGTAGTGTTCTGGG - Intergenic
1137731034 16:50690662-50690684 TGCATGCCAGGTCCTGTTCTAGG + Intergenic
1137973273 16:53006840-53006862 TATATGCCAAGTTCTGTGCTAGG + Intergenic
1138292864 16:55862796-55862818 TATATACCAGGTATTATGCTGGG + Intronic
1138395988 16:56705268-56705290 TGTGTGCCAGATATTGTTCTGGG - Intronic
1138945144 16:61840480-61840502 TATGTGCCAGGTATTTTTCTAGG - Intronic
1139223137 16:65205286-65205308 TACATGCCAGGAAATGTTCTGGG + Intergenic
1139232221 16:65294758-65294780 TGTATGCTAGGCTTTGTTCTTGG + Intergenic
1139331880 16:66198875-66198897 TGTATGCCAGGCATTGTTCAGGG - Intergenic
1139353166 16:66350651-66350673 TATGTGCCAGGTGTGGGGCTGGG - Intergenic
1139485034 16:67250736-67250758 TATGTGCCAGGCACTGTTCTAGG + Intronic
1139680318 16:68556562-68556584 TAGGTGCCGGGCGTTGTTCTGGG + Intronic
1139745189 16:69068487-69068509 TATATGCCAGGTATGATTCCAGG - Intronic
1139800651 16:69519997-69520019 TGTATGCCAGACGCTGTTCTAGG - Intergenic
1140052687 16:71496416-71496438 TATGTGCCAGGTATCATTCTGGG + Intronic
1140294133 16:73691684-73691706 TATATACTGGGTGTTTTTCTTGG - Intergenic
1140675451 16:77324467-77324489 TATATACCAAGTGCTGTTCTTGG + Intronic
1141020653 16:80493012-80493034 TCTGTGCCAGGTACTGTTCTAGG - Intergenic
1141179264 16:81741229-81741251 TGTGTGCCAGGTATTGTGCTGGG + Intronic
1141197001 16:81867583-81867605 CAGGTGACAGGTGTTGTTCTAGG - Intronic
1141848742 16:86629706-86629728 TATATGCCGGGTGCTGGGCTAGG + Intergenic
1143301590 17:5914656-5914678 TACATACCAGGCATTGTTCTAGG - Intronic
1143396172 17:6599480-6599502 CAAATGCCATGTGTTGATCTTGG + Intronic
1143660753 17:8323208-8323230 TATGTGCCAGGCATTGTTCTAGG + Intergenic
1143808079 17:9446234-9446256 TATGTGCCAGGCATTCTTCTAGG - Intronic
1143849990 17:9803688-9803710 TGTATGCCAGGTGCTGTGATGGG + Intronic
1144076640 17:11725449-11725471 TATGTGCCAGAGATTGTTCTAGG - Intronic
1144121902 17:12163046-12163068 TATATCCTAGGTTTTCTTCTAGG + Intergenic
1144528170 17:16009045-16009067 TATGTGCCAGGCACTGTTCTAGG - Intronic
1144846140 17:18220568-18220590 TATGTGCCAGGCGCTATTCTAGG + Intergenic
1145205608 17:20983641-20983663 TATGTGCCAGGTGCTGTGCTGGG + Intergenic
1145778527 17:27546210-27546232 TTTATGCCAGGTGCTGTAGTAGG + Intronic
1145800483 17:27680495-27680517 TAAGTGCCAGGTGCTGTACTAGG + Intergenic
1146146026 17:30417300-30417322 TATATGCCAGGCACTATTCTAGG - Intronic
1146146154 17:30418460-30418482 TATATGCCAGGCACTATTCTAGG + Intronic
1146367392 17:32239415-32239437 TATGTACCAAGTATTGTTCTAGG - Intronic
1146817859 17:35958450-35958472 TGTATGCCAGGCATTGTGCTAGG + Intergenic
1146926140 17:36747002-36747024 TAGATGCCATGTGCTGTACTTGG + Intergenic
1146951519 17:36909973-36909995 TTTGTGCCAAGTGCTGTTCTGGG - Intergenic
1147252223 17:39159714-39159736 TTTGTGCCAGGTACTGTTCTAGG - Intronic
1147476857 17:40720192-40720214 GATATGCCAGGTCTTCTGCTAGG + Intergenic
1147576138 17:41600095-41600117 TCTGGGCCAGGTGTTGTGCTGGG - Intergenic
1147833460 17:43313584-43313606 TATATGCCAGGCATTGTTCAGGG + Intergenic
1147852872 17:43455950-43455972 TATGTACCAGGCTTTGTTCTAGG - Intergenic
1147874351 17:43610458-43610480 TATATGCCAGGCACTGATCTAGG - Intergenic
1147889812 17:43709405-43709427 TGTGTGCCAGGTGTTACTCTAGG - Intergenic
1148522324 17:48290705-48290727 TATGTGCCAGGTACTGTTCTAGG - Intronic
1148651425 17:49252832-49252854 TATGTGTCTGGTGCTGTTCTAGG + Intergenic
1149011831 17:51864948-51864970 TATGTGTCAGATGTTGTGCTGGG + Intronic
1149033812 17:52112691-52112713 TATATGCTAGATGCTGGTCTAGG - Intronic
1149080331 17:52648680-52648702 TATGTGCCAGGTATTGTTTTGGG + Intergenic
1149150981 17:53563657-53563679 CATATGCCAGGCATTGTGCTAGG + Intergenic
1149294229 17:55247174-55247196 TGTGTGCCAGGCATTGTTCTAGG + Intergenic
1149418723 17:56487600-56487622 TATATGCCAGGTACTGTGCTGGG + Intronic
1149727546 17:58911714-58911736 TGTATACTAGGTGCTGTTCTGGG + Intronic
1150333834 17:64315689-64315711 TATATTCCCAGGGTTGTTCTTGG - Intergenic
1150526356 17:65926849-65926871 TATGTGCCAGGTGCTGTCCCTGG - Intronic
1150566490 17:66345885-66345907 TATATGCCAGGCACTGTGCTTGG - Intronic
1150665128 17:67127275-67127297 TATGTGCCAGATGTTATTGTAGG - Intronic
1150758358 17:67936978-67937000 TATGTGCCAGATGCTGTTCCAGG + Intronic
1151288839 17:73133742-73133764 TATATGCTGGGTATTGTTCTAGG - Intergenic
1151768900 17:76146772-76146794 TATGGGTCAGGTGTTGTGCTGGG - Intronic
1151777033 17:76211921-76211943 TACGTGCCAGGCTTTGTTCTAGG + Intronic
1152052193 17:77988937-77988959 TATGTGCCACATGATGTTCTAGG - Intergenic
1153147416 18:2049636-2049658 TATATGCCATCTTTTGTTTTCGG - Intergenic
1153196118 18:2598321-2598343 TATATGCCAAGCACTGTTCTAGG + Intronic
1153203437 18:2670572-2670594 TATGTGCCAGGCATTGTTCTAGG - Intronic
1153381895 18:4449587-4449609 TAAGTGCCAGGTGCTGTGCTAGG + Intronic
1153396642 18:4629155-4629177 TCTCTGCCAGGCATTGTTCTGGG - Intergenic
1153868164 18:9292270-9292292 TATGTGCCAGATGTTATGCTAGG + Intergenic
1154142690 18:11839126-11839148 TATATGCCAGGCATTGTTCTAGG - Intronic
1154246762 18:12706010-12706032 TATATGTCAATTGTTGCTCTAGG - Intronic
1154371855 18:13770781-13770803 TATTTCCCAGGTTTTCTTCTAGG - Intergenic
1155111257 18:22716753-22716775 TATATGCCAGACCCTGTTCTAGG - Intergenic
1155188442 18:23408336-23408358 TATATGCCAGGCATTGTTCTTGG - Intronic
1155389688 18:25321424-25321446 TATAGGCCAGGTATTGTGCTAGG + Intronic
1155454871 18:26000681-26000703 TATATACCAGGCTCTGTTCTGGG + Intergenic
1155547369 18:26929387-26929409 TATATGTCAGGTACTGTACTAGG - Intronic
1156023431 18:32625205-32625227 AATATGCCAGGTGTCCTCCTAGG + Intergenic
1156210399 18:34934160-34934182 TATATTCCAGGCATTGTGCTTGG - Intergenic
1156219429 18:35036832-35036854 TATCTGCCAGGTCCTGTTCTAGG + Intronic
1156270030 18:35522153-35522175 CATGTGCCTGGTGTTGTGCTGGG + Intergenic
1156351601 18:36306735-36306757 TATGTGCCAGACGCTGTTCTAGG - Intronic
1156491487 18:37498913-37498935 TATATCCCAGGTGCTCTGCTGGG - Intronic
1156767744 18:40678768-40678790 TATATCCCAGGTGTTCCTATAGG - Intergenic
1156814580 18:41294463-41294485 TATAATCAAGGTGATGTTCTGGG + Intergenic
1156823008 18:41395260-41395282 CATGTGCCAGGCTTTGTTCTAGG - Intergenic
1156907637 18:42373324-42373346 TATATGCCAGGTACAGTTCTCGG + Intergenic
1157029417 18:43887332-43887354 TAGATGCCAGGTACTGTTCTAGG - Intergenic
1157469387 18:47976956-47976978 TATGTGCCAGGCACTGTTCTCGG - Intergenic
1157674016 18:49554897-49554919 TATCTGCCAGGCTTTATTCTGGG + Intergenic
1157699884 18:49755537-49755559 TATGTGCCAGGCATTGTGCTGGG + Intergenic
1157889807 18:51404823-51404845 TATATGCCAGGGCCTGTCCTAGG - Intergenic
1157947247 18:51994061-51994083 TATATGCCAGGTACTGCTCTAGG - Intergenic
1158060547 18:53335382-53335404 TATATACTAGTTGTAGTTCTAGG - Intronic
1158071145 18:53471985-53472007 CATGTGCCAGGTGCTGTTCTGGG - Intronic
1158109048 18:53919681-53919703 TGTGTGCCAGGTGTTCTCCTAGG - Intergenic
1158124288 18:54084357-54084379 TGTATGCCAGGTACTGTTGTGGG - Intergenic
1158153635 18:54400825-54400847 TATTGCCTAGGTGTTGTTCTAGG + Intergenic
1158334980 18:56406282-56406304 TGTGGGCCAGGTGTTATTCTAGG - Intergenic
1158396107 18:57079364-57079386 TATGTGCCAGGTAATTTTCTAGG - Intergenic
1158553203 18:58454578-58454600 TATGTGCCAGGTGTTCTACTGGG + Intergenic
1158584571 18:58719913-58719935 TATATGCCAGCTCCTTTTCTAGG + Intronic
1158842808 18:61406404-61406426 TATGTGCCAGGCACTGTTCTAGG + Intronic
1159116880 18:64124464-64124486 GATATGCCAGGTGTTCTACCTGG - Intergenic
1159169140 18:64740950-64740972 TATGAGCCAGGCATTGTTCTAGG + Intergenic
1159515875 18:69457243-69457265 TATTTGCTAGGTTTTCTTCTAGG + Intronic
1159669383 18:71204138-71204160 TATAAGCCAGGTATTCTCCTAGG - Intergenic
1159852256 18:73538318-73538340 TATAAGCCTGGTATTTTTCTTGG - Intergenic
1160301436 18:77684321-77684343 TATATGCCAGGTATTGTTCTAGG + Intergenic
1160704340 19:522992-523014 TAAATGACAGTTGTGGTTCTAGG + Intergenic
1161499157 19:4603832-4603854 TGCATGCCAGGTGCTCTTCTAGG + Intergenic
1161541998 19:4857612-4857634 TACAAGCCATGTGCTGTTCTGGG + Intronic
1161609651 19:5234816-5234838 TGTGTGCCAGGTGCTGTGCTGGG + Intronic
1161873378 19:6887864-6887886 TGTGTGTCAGGTGCTGTTCTAGG + Intronic
1161924582 19:7291559-7291581 TATGTGCCAGGCATCGTTCTGGG + Intronic
1161999328 19:7733056-7733078 CATATGCCAGGCATTGATCTTGG + Intronic
1162104206 19:8360349-8360371 TATATGCCAGGCACTGTACTGGG - Intronic
1162306896 19:9880308-9880330 TATGTGCCAGGCACTGTTCTAGG + Intronic
1162549236 19:11349320-11349342 TGAGTGCCAGGTGCTGTTCTAGG - Intronic
1162839022 19:13341904-13341926 TGTGTGCCAGATGTTGTCCTAGG - Intronic
1162850924 19:13430643-13430665 TATGTGCCAGGCTGTGTTCTAGG + Intronic
1162853559 19:13450607-13450629 TGTGTGCCAGGTCCTGTTCTAGG - Intronic
1164432694 19:28201698-28201720 TCTATGCCAGGCACTGTTCTAGG + Intergenic
1164798681 19:31057826-31057848 TACATGCCATGTACTGTTCTTGG + Intergenic
1165101821 19:33442967-33442989 TGTGTGCCAGATGCTGTTCTGGG - Intronic
1165171551 19:33895391-33895413 TCTGTGCCAGGTGTTGTTTGAGG - Intergenic
1165346419 19:35251171-35251193 CATATACCAGGTGCTGTTCTGGG + Intronic
1165579006 19:36846239-36846261 TCTGTGCCAGGTGCTATTCTAGG - Intronic
1165781802 19:38439064-38439086 CATGGGCCAGGTGCTGTTCTAGG - Intronic
1165789886 19:38485006-38485028 TATGTGCTAGGTGTGGTTTTAGG + Intronic
1165831366 19:38732132-38732154 TACATGCCAGGAGTTATTCCAGG - Intronic
1165958003 19:39514169-39514191 TACATGCCAGATCTTATTCTGGG + Intergenic
1165996395 19:39846775-39846797 TGTGTACCAGGTGCTGTTCTAGG + Intergenic
1166335415 19:42103359-42103381 TGGGTGCCAGGTGCTGTTCTAGG - Intronic
1166456659 19:42947054-42947076 TATATGCAAGCTTTTTTTCTGGG - Intronic
1166466615 19:43037918-43037940 TATATGCAAGCTTTTTTTCTGGG - Intronic
1166493523 19:43280975-43280997 TATATGCAAGCTTTTTTTCTGGG - Intergenic
1166669110 19:44699165-44699187 TGTTTGCCAGGTGCTGTTCTAGG - Exonic
1166800994 19:45456889-45456911 TTTCTGCCAGGTGCTGTTCTAGG + Intronic
1166807367 19:45495407-45495429 TATGTGCCAGGCACTGTTCTAGG + Intronic
1167011164 19:46809123-46809145 TATATGCCAGGTGCTTTTCTAGG - Intergenic
1167078855 19:47265652-47265674 TATGTGCCAGGTACTGTTTTAGG + Intronic
1167108163 19:47443122-47443144 TCTATGCCAGGGACTGTTCTGGG - Intronic
1167195732 19:48026821-48026843 TATATGCCTGGGATTATTCTAGG - Intergenic
1167215765 19:48163530-48163552 TATGTGCCAGGGCCTGTTCTGGG + Intronic
1167397978 19:49244008-49244030 TACATGCCAGGTTCGGTTCTGGG + Intergenic
1167551547 19:50164331-50164353 TATGTGCCAGGTGCTGTTCAAGG + Intergenic
1167600156 19:50450224-50450246 TATGTGCCAGGTACTTTTCTAGG + Intronic
1167704464 19:51071026-51071048 TGTGTACCAGGTATTGTTCTAGG - Intergenic
1167704949 19:51076370-51076392 TATACACCAGGCATTGTTCTGGG - Intergenic
1168073493 19:53965524-53965546 TAGATGCCACGTGCTGTCCTAGG - Intronic
1168096960 19:54121470-54121492 TGTGTGCCAGGTGCTGTCCTGGG + Intronic
1168143858 19:54408275-54408297 TAGGTGCCAGGCATTGTTCTAGG - Intergenic
1168291041 19:55357717-55357739 TCTGTGCCAGGCATTGTTCTAGG - Intronic
1168328512 19:55551700-55551722 TATGGGCCAGGTACTGTTCTGGG + Intergenic
1168466619 19:56607442-56607464 TAAGTGCCAGGCGCTGTTCTAGG + Intronic
1168654281 19:58116363-58116385 TGTATGCCAGGACCTGTTCTAGG + Intronic
925427847 2:3765663-3765685 TATGTGCCAGGCATGGTTCTAGG + Intronic
925497977 2:4473354-4473376 TATATGCAAAGTATTGTTCCTGG - Intergenic
925627521 2:5856106-5856128 TATATGCCAGGTATTTTTGCAGG - Intergenic
925803728 2:7627995-7628017 TATATGGCAGGCATTGTTTTAGG - Intergenic
925957581 2:8982741-8982763 TATATGCCAGGTACTGTACCAGG + Intronic
926188619 2:10710755-10710777 TTTATGCCAGGCGTGGTGCTGGG + Intergenic
926512867 2:13803982-13804004 TATTTTCCAGGTGCTGTGCTAGG - Intergenic
926513013 2:13806019-13806041 TATGTGACAGGTATTGTCCTAGG - Intergenic
926602862 2:14864847-14864869 TACATGGCAGGTTCTGTTCTAGG - Intergenic
926616752 2:15003387-15003409 CAAGTGCCAGGTGTGGTTCTAGG + Intergenic
926729043 2:16020831-16020853 TATGTGCCAGTTATTGTCCTGGG - Intergenic
926734171 2:16059908-16059930 TATGTGCCAGGCACTGTTCTTGG - Intergenic
926856056 2:17257133-17257155 TAGATGCCAGGTACTATTCTGGG - Intergenic
926902690 2:17772509-17772531 TATATGCTAGGTAGTGTGCTAGG + Intronic
927066608 2:19478013-19478035 CATGTTCCAGGTATTGTTCTAGG - Intergenic
927180746 2:20445306-20445328 TAAATGCCAGGCATTGTGCTGGG + Intergenic
927425270 2:22974605-22974627 TGTATCCCAAGAGTTGTTCTGGG - Intergenic
927770634 2:25858033-25858055 TATATGCCAGGCACTGCTCTAGG - Intronic
927800135 2:26091146-26091168 TAAATGTCAGGTATTGTTCTAGG + Intronic
928018950 2:27685753-27685775 TATGTGTCAGGTTTTGTGCTAGG - Intronic
928151633 2:28835559-28835581 TATGTGCCAGGCACTGTTCTAGG - Intronic
928213427 2:29341012-29341034 CAGGTGCTAGGTGTTGTTCTAGG - Intronic
928265637 2:29809246-29809268 TATGTGCCACATGTTGTACTTGG + Intronic
928284569 2:29978249-29978271 TGTGTGCCAGGTATTGTTCTAGG - Intergenic
928389741 2:30899962-30899984 TATGTGCCAGATGCTGTCCTGGG + Intergenic
928403078 2:30993218-30993240 TATATACTGGGTGCTGTTCTAGG + Intronic
928705540 2:33945900-33945922 TCCATCCCAGGTGTTGTTCTAGG + Intergenic
928743802 2:34388155-34388177 TATATGCCAGGCATTGTTTTAGG + Intergenic
929034256 2:37675359-37675381 TATATGCCAGGCCCTATTCTAGG - Intronic
929307290 2:40378052-40378074 TGTATGCAATGCGTTGTTCTAGG + Intronic
929323874 2:40581534-40581556 TATGTGCCAGATGATTTTCTTGG + Intronic
929467979 2:42163037-42163059 CATGTGCCAGGTGCTCTTCTAGG + Intergenic
929922100 2:46180003-46180025 TATGTGCCAGGCATTGTGCTAGG + Intronic
929955596 2:46455921-46455943 TATATGCCAGGCACAGTTCTTGG - Intronic
930151331 2:48062739-48062761 TATGTGCCAGTCATTGTTCTAGG - Intergenic
930300284 2:49607040-49607062 TATGTGCCAGATGCTGTGCTAGG - Intergenic
930300583 2:49610996-49611018 TATGTGCCAGGCATTGTTATAGG - Intergenic
930671466 2:54156040-54156062 TATATGCCAGGCACTGTTTTTGG + Intronic
930671598 2:54157584-54157606 TATATGCCAGGCACTGTTTTAGG + Intronic
930766782 2:55092562-55092584 TTTCTGCCAGGTAGTGTTCTAGG - Intronic
930886694 2:56334275-56334297 TATGTGCCAGGTATTGTTCTAGG - Intronic
930961184 2:57263661-57263683 TATGTCCCAGGTTTTCTTCTAGG - Intergenic
931101224 2:59003203-59003225 TGCAAACCAGGTGTTGTTCTAGG - Intergenic
931289167 2:60857422-60857444 TATGTGCCAGGTACTGTTCTAGG + Intergenic
931384523 2:61786092-61786114 TCTAAACAAGGTGTTGTTCTGGG + Intergenic
931520755 2:63094467-63094489 TATATACCAGGTACAGTTCTGGG - Intergenic
931563850 2:63592794-63592816 TACAGGACAGGTGTTGTTCTAGG + Intronic
931608082 2:64071661-64071683 TATAAGCCAGGTGTTGTGGTGGG - Intergenic
931700355 2:64904079-64904101 TATGTGCCAGGTATGGTGCTAGG - Intergenic
931704841 2:64938660-64938682 TAGATGCCAGGTGCTGCTCTAGG + Intergenic
931740343 2:65237075-65237097 TATGTGCCAGACGCTGTTCTAGG + Intronic
931746316 2:65294549-65294571 TATGTGCCAGATACTGTTCTAGG + Intergenic
932065951 2:68560289-68560311 TATATGCCAAGCACTGTTCTAGG - Intronic
932160059 2:69451741-69451763 TGAATGACAGGTGCTGTTCTAGG - Intergenic
932681215 2:73827463-73827485 TATGTGCCAGGTTCTGTTCTAGG - Intergenic
933579976 2:84114724-84114746 TATTTGCTAGGTTTTCTTCTAGG + Intergenic
933625595 2:84594797-84594819 TATGTTCCAGGTAATGTTCTAGG + Intronic
933839341 2:86273928-86273950 TATATGTCAGGAATTGTTTTGGG - Intronic
934584802 2:95482183-95482205 TGAGTGCCAGGTGCTGTTCTAGG - Intergenic
934594653 2:95594533-95594555 TGAGTGCCAGGTGCTGTTCTAGG + Intronic
934788121 2:97031105-97031127 TGAGTGCCAGGTGCTGTTCTAGG - Intergenic
935220173 2:101005180-101005202 TCGATGCCGGGTATTGTTCTAGG - Intronic
935290362 2:101604995-101605017 TATATGCCAGGCACTGTTCAGGG + Intergenic
935737961 2:106121144-106121166 TGTATGCTAGGTACTGTTCTAGG - Intronic
935737965 2:106121207-106121229 TGTATGCTAGGTACTGTTCTAGG - Intronic
935865433 2:107382433-107382455 TATGTGCCAGATGTTGTTCTGGG - Intergenic
936175526 2:110216751-110216773 TATATGCCAGCCCTTGTTCTAGG - Intergenic
936231242 2:110700973-110700995 TATTTGCCAGGCGGTGTGCTGGG + Intergenic
936431347 2:112466485-112466507 TATATGCCAGGCACTGTGCTAGG - Intergenic
936592671 2:113818949-113818971 TATGTGCCAGATATTTTTCTAGG - Intergenic
937087363 2:119180307-119180329 TGTGTGCCTGGTGTTTTTCTAGG + Intergenic
937152636 2:119696469-119696491 TATGTGCCAGGCTCTGTTCTGGG + Intergenic
937347988 2:121139288-121139310 TCTATGCCAGGAATTGTGCTAGG + Intergenic
937471234 2:122175605-122175627 TATATGTCAGGACTTCTTCTAGG + Intergenic
937599402 2:123711964-123711986 TGTATGGCAGGTATTGTGCTAGG - Intergenic
937661399 2:124433724-124433746 TATTTGGAATGTGTTGTTCTAGG - Intronic
937845593 2:126575465-126575487 TGTATGCCAGATGCTGTTCTAGG - Intergenic
938026540 2:127953998-127954020 TCTATTCCAGGAATTGTTCTGGG - Intronic
938136050 2:128757531-128757553 CGTGTGCCAGGTGCTGTTCTTGG - Intergenic
938381883 2:130841000-130841022 TATGCGCCAGATGTTGTTCTAGG + Intronic
938389436 2:130893378-130893400 TGTGTGCCAGGTGCTGTGCTAGG - Intronic
938557764 2:132441142-132441164 TATATGCCAGCCTCTGTTCTGGG + Intronic
938751576 2:134336128-134336150 TGTGTGCCAGGAGCTGTTCTCGG + Intronic
938841780 2:135171672-135171694 TATGTGCCAGGTACTGTTCTAGG + Intronic
939315347 2:140542355-140542377 TATATGCCATATGTAGTTCTGGG - Intronic
939560296 2:143723638-143723660 TGTATGCCAGGCACTGTTCTAGG + Intronic
939636328 2:144586783-144586805 TATGTGGCAGGCGCTGTTCTAGG + Intergenic
939826931 2:147026225-147026247 TATATGCCAGACACTGTTCTAGG + Intergenic
940110557 2:150147940-150147962 CATGTGCCAGGCCTTGTTCTGGG + Intergenic
940193666 2:151069342-151069364 TATGTGCTAGGCATTGTTCTAGG + Intergenic
940296735 2:152133684-152133706 TATGTGCCAGGCATTGTTCTAGG + Intronic
940375939 2:152958837-152958859 TCTTTGCCAGGTGCTATTCTAGG + Intergenic
940831846 2:158475360-158475382 TCTATGCCAGGTACTGTGCTGGG - Intronic
941071111 2:160955680-160955702 TATGCACCAGGTCTTGTTCTGGG + Intergenic
941230224 2:162902875-162902897 TATATGCCAAGTACTGTTTTGGG - Intergenic
941306318 2:163872756-163872778 TATATGCTAGGCACTGTTCTTGG + Intergenic
941369249 2:164643819-164643841 TGAATGCCAGGTGCTGTTCTAGG - Intergenic
941442467 2:165555308-165555330 TATATTACAGGTATTATTCTAGG - Intronic
941444838 2:165587981-165588003 TATATACAAGGCATTGTTCTAGG + Intronic
941463417 2:165797144-165797166 TAAGTGCCAGGTGCTGGTCTTGG - Intergenic
941666983 2:168251917-168251939 TCTGTGCCAGGTGTTTTTCTAGG - Intergenic
941879656 2:170468419-170468441 TATACACCTGGTGGTGTTCTTGG + Intronic
941964309 2:171285698-171285720 TATATGCCAGGCGCTATTCTTGG - Intergenic
942001100 2:171647592-171647614 TATAAGCCAGGTGTGGTGGTGGG - Intergenic
942079640 2:172387878-172387900 TACATACCAGGTGTTGTATTTGG + Intergenic
942105105 2:172625792-172625814 TATGTGCCAGGCATTGTTCGAGG - Intergenic
942230071 2:173852715-173852737 TATATGCCAGGCACTGTCCTGGG + Intergenic
942255295 2:174091071-174091093 TATGTGCCAGGCATTGTGCTAGG - Intronic
942281999 2:174375042-174375064 TCTGTGCCAGGCCTTGTTCTAGG - Intronic
942296959 2:174527261-174527283 TACATGCTAGGTACTGTTCTAGG + Intergenic
942532092 2:176922164-176922186 TATATACCAGGTGTGTTTCTAGG - Intergenic
942669829 2:178363366-178363388 TATATGCTAGGTATTGTGCAAGG + Intronic
942737152 2:179127406-179127428 TATGTGTCATGTGTTGTTCTAGG - Intronic
943049651 2:182899626-182899648 TATGTGCCAGGCACTGTTCTAGG - Intergenic
943303857 2:186235346-186235368 TATTGGCTAGGTGTTCTTCTAGG - Intergenic
943305188 2:186252730-186252752 TATTGGCTAGGTGTTCTTCTAGG - Intergenic
943559623 2:189445011-189445033 TATGTGACAGGTGTTGTGGTGGG + Intronic
943599604 2:189899239-189899261 TATAAGCTAGTTATTGTTCTGGG + Intronic
943640768 2:190355261-190355283 TATATGCCAGGCATCCTTCTAGG - Intronic
943723077 2:191225540-191225562 TATGTGCCAGGTTTTGTTCCAGG + Intergenic
943734370 2:191338425-191338447 TATATGCCAGGAGATATTATGGG + Intronic
943777131 2:191778397-191778419 TATATGCCTGGGGCTGCTCTAGG + Intergenic
943897962 2:193391704-193391726 TATTTCCCAGGTTTTCTTCTAGG + Intergenic
944131625 2:196353503-196353525 TATGTGTCAGGTTTTATTCTAGG - Intronic
944373024 2:199008801-199008823 TATTTCCCAGGTTTTCTTCTGGG + Intergenic
944388695 2:199194255-199194277 TATGTGCCAGGACTTGTTCTAGG - Intergenic
944398642 2:199299663-199299685 AATATGCCAAGTGTTATTCCAGG - Intronic
944409388 2:199423293-199423315 TATGTGTTAGATGTTGTTCTAGG - Intronic
944694132 2:202186016-202186038 TCTGTGCCAGGTCTGGTTCTGGG - Intronic
944761321 2:202818066-202818088 TATATGCAAGGCATTGTTCTAGG + Intronic
944868996 2:203891297-203891319 TATATGCCATGCATTGCTCTAGG + Intergenic
945132271 2:206585668-206585690 CACATGCCTGGTGTTGTTGTAGG + Intronic
945243057 2:207694142-207694164 TATGTGACAGGTGCTGTTCTAGG - Intergenic
945308787 2:208286184-208286206 TACATGCCATGCGCTGTTCTTGG - Intronic
945317794 2:208389853-208389875 TATGTGCCAGATGTTTGTCTAGG - Intronic
945771854 2:214053544-214053566 TGTATTCCAGGGGTTTTTCTGGG - Intronic
945911719 2:215657415-215657437 TATGTGCCAGGCACTGTTCTTGG - Intergenic
945969160 2:216219408-216219430 CATATTTCAGGTGCTGTTCTAGG - Intergenic
945978580 2:216290014-216290036 TATGTTCCAGGTTTTGTTTTAGG + Intronic
946141210 2:217692244-217692266 TGTATCCTGGGTGTTGTTCTGGG - Intronic
946142686 2:217705064-217705086 AATCTGCCAAGAGTTGTTCTAGG + Intronic
946344352 2:219096409-219096431 TATGTTCCAGGTACTGTTCTTGG + Intronic
946491701 2:220155126-220155148 TATATACCAGGTTTTGTGCAAGG + Intergenic
946845821 2:223858150-223858172 TATGTGCTAGGTGCTGTGCTAGG + Intronic
946921051 2:224582823-224582845 TATGTGCCAGGCACTGTTCTGGG - Intronic
946961752 2:224992828-224992850 TAGATGCCATGAGTTCTTCTAGG + Intronic
947073796 2:226319538-226319560 TATGTGCCAGGTACTGTTCTGGG - Intergenic
947127269 2:226882692-226882714 GATATGCCAGATGGCGTTCTGGG - Intronic
947199557 2:227602220-227602242 TCTTTGCCAGGTGTTGTGCTGGG - Intergenic
947254283 2:228144382-228144404 AATATGCCAGGCATTATTCTTGG - Intronic
947276045 2:228393491-228393513 TATATCCTAGGTTTTCTTCTAGG + Intergenic
947375621 2:229492136-229492158 TATGTGCCAGGGATTTTTCTGGG - Intronic
947378025 2:229517225-229517247 TATGTGCCAGGCACTGTTCTAGG + Intronic
947446857 2:230170881-230170903 TTTAAGCCAGCTATTGTTCTAGG + Intronic
947984484 2:234437055-234437077 TATATACCAGGGGTGATTCTAGG - Intergenic
948063650 2:235060939-235060961 TATTTGCCAGGCATTGTTCTAGG + Intergenic
948202916 2:236142668-236142690 TATATGCAAGGTGTTGTTTTGGG - Intergenic
948903870 2:240968757-240968779 TACATGCCAGGCTTTGTGCTGGG + Intronic
1168832005 20:851123-851145 TATGTGCCAGGAGCTGTGCTAGG + Intronic
1168849172 20:965064-965086 TGTATGCCAGGTGCTATTCTGGG + Intronic
1168868323 20:1108074-1108096 TGTATGCCAGGCTCTGTTCTAGG + Intergenic
1168913096 20:1466056-1466078 TATGTGCCAGGCATTGTTCCAGG + Intronic
1168961142 20:1870847-1870869 TATGTGCCAGGCATTGTTCTAGG + Intergenic
1168982614 20:2020829-2020851 TATATGTTGGGTGCTGTTCTGGG - Intergenic
1169020850 20:2329816-2329838 TATATGCCAGGCATTGCACTTGG - Intronic
1169472215 20:5896450-5896472 TATGAGCCAGGTACTGTTCTAGG + Intergenic
1169732489 20:8801534-8801556 TATATGGCAGGCGATGTTCTTGG - Intronic
1169746184 20:8945452-8945474 TATGTGCCAGGTTCTGTGCTAGG - Intronic
1169754065 20:9024638-9024660 AATATGCCAGGCACTGTTCTAGG - Intergenic
1170640403 20:18146919-18146941 TATGAACCAGGTGCTGTTCTAGG + Intronic
1170779393 20:19410674-19410696 TATGTGCCAGGCAATGTTCTTGG - Intronic
1170894117 20:20398771-20398793 TATGTGCCAGGTACTGTTTTAGG + Intronic
1170920706 20:20677090-20677112 TATATGCCAGGGATTATTCTAGG + Intronic
1171359650 20:24578069-24578091 TATGTGCCAGGCACTGTTCTGGG + Intronic
1172035722 20:32009704-32009726 TATGTGCCAGAAGTTCTTCTAGG + Intergenic
1172119016 20:32586705-32586727 TGTGTGCCAGGTGTTGTGCTAGG - Intronic
1172384452 20:34523812-34523834 CATATGCCAGACATTGTTCTAGG - Intronic
1172494369 20:35368289-35368311 TATGTGCCAGATGTTCTACTGGG + Intronic
1172586709 20:36090607-36090629 TATATCCTAGGTGCTGTGCTGGG + Intergenic
1172744078 20:37193247-37193269 CACATGCCAGGTGCTGTTCTAGG - Intronic
1172750883 20:37250337-37250359 TCTGTGCCAGGTACTGTTCTGGG - Intergenic
1172777706 20:37417068-37417090 TACATGCCAGGCGCTGTTCTAGG - Intergenic
1172908099 20:38384552-38384574 TATGTGCCAGGTGCTGTTCTAGG - Intergenic
1173025750 20:39305888-39305910 TATGTGCCAGGTACTGTGCTGGG + Intergenic
1173077876 20:39837722-39837744 TATGTGCTACGTGGTGTTCTAGG + Intergenic
1173084387 20:39901822-39901844 TATGTGCCAGGTACTTTTCTAGG - Intergenic
1173248231 20:41350490-41350512 TGTGTGCTAGGTGCTGTTCTTGG + Intronic
1173312744 20:41915000-41915022 TATTTTCCAGGTATTCTTCTAGG + Intergenic
1173377002 20:42494742-42494764 TATATGCCAGCTATGATTCTAGG - Intronic
1173504549 20:43576585-43576607 TATGTGCCAGGTATTGAGCTAGG + Intronic
1173594587 20:44250419-44250441 TATGTGCCACGTGCTATTCTAGG - Intronic
1173913988 20:46693033-46693055 TATAGGCCAGGTACTGTGCTAGG + Intergenic
1173982431 20:47235214-47235236 TACATGCCAGGCATTGTTCTAGG + Intronic
1174005161 20:47404812-47404834 TATATTCCAGGTCCTGTTCTAGG + Intergenic
1174098843 20:48111054-48111076 TATATGACAGATATTGTTCCCGG - Intergenic
1174119528 20:48252173-48252195 TATATACCAGGTACTATTCTAGG - Intergenic
1174200603 20:48804093-48804115 TATATCCCAGGCCTTCTTCTGGG - Intronic
1174200612 20:48804196-48804218 TATGTGCCAGGCACTGTTCTAGG + Intronic
1174294103 20:49531954-49531976 TAAAGGCCAAGTGTTGTTCTGGG + Intronic
1174330129 20:49811535-49811557 TATGTGCCAGGTACTGTTGTAGG + Intergenic
1174404608 20:50295182-50295204 TATATGCCAGGTCCTGGGCTGGG + Intergenic
1174430740 20:50466806-50466828 TATGTGCCAGGCAGTGTTCTAGG - Intergenic
1174506112 20:51018634-51018656 TAAGTGCCAGGTGCTGTGCTAGG + Intronic
1174703099 20:52629144-52629166 TACTTGCCAGGTGCTGTGCTAGG + Intergenic
1174728449 20:52889856-52889878 TATATGCCAGGCATGATTCTAGG + Intergenic
1174737830 20:52982566-52982588 TATGTGCCAGGTATTGTTCTAGG + Intronic
1174805977 20:53604809-53604831 TATGTACCAGGCATTGTTCTAGG + Intronic
1174929963 20:54802763-54802785 TATGTGCCAGGCATTGTGCTGGG - Intergenic
1175072346 20:56345126-56345148 CAAATGCCAGGTTTTCTTCTTGG + Intergenic
1175241354 20:57551785-57551807 TATGTGCCAGGTGTGGTTTGGGG + Intergenic
1175316116 20:58047855-58047877 TATGTTCCAGATGTTGTGCTAGG + Intergenic
1175335902 20:58196169-58196191 TACGTGCCAGGTGCTGTTCTGGG - Intergenic
1175350365 20:58313717-58313739 TATATGCCAGGTGCTAGACTGGG + Intronic
1175373478 20:58508713-58508735 TATGTGCCAGGCACTGTTCTAGG + Intronic
1175657059 20:60780153-60780175 TATGTGCCAAGTATTGTCCTGGG + Intergenic
1176359924 21:5986645-5986667 TACGTGCCAGGTCCTGTTCTAGG + Intergenic
1177966804 21:27737703-27737725 TATATGTGAGGATTTGTTCTAGG + Intergenic
1178226081 21:30720261-30720283 TAAATGCCAGGTATTGTAGTAGG + Intergenic
1178562629 21:33653352-33653374 TATATGCCTGGCATTGCTCTAGG + Intronic
1178617619 21:34147304-34147326 CATATGGCAGGTGCTGCTCTGGG + Intergenic
1178722358 21:35021299-35021321 TATGTGCCAGGAATTGTTCTAGG - Intronic
1178946420 21:36951647-36951669 TATATGCCAGATTGTGTGCTAGG - Intronic
1179113882 21:38472141-38472163 TATGTGCCAGGAGTTGTTCTAGG - Intronic
1179584551 21:42366292-42366314 TTTGTGCCAGGTGCTGTTCTAGG - Intronic
1179763594 21:43551905-43551927 TACGTGCCAGGTCCTGTTCTAGG - Intronic
1180683643 22:17647579-17647601 TATATGCCAGGTAATGTACTAGG - Intronic
1181911337 22:26240679-26240701 TGTGTGCCAGGTACTGTTCTAGG + Intronic
1181918001 22:26296401-26296423 TATGTGCCAGGTACTATTCTAGG + Intronic
1181967287 22:26666214-26666236 CATCTGCCAGGTTTTGTTTTTGG - Intergenic
1182351222 22:29701056-29701078 AAAATGCCAGGTGCTATTCTGGG - Intergenic
1182352424 22:29706340-29706362 TACGTGCCAGGTGCTGTGCTGGG - Intergenic
1182764656 22:32750061-32750083 TAAGTGCCAGGTCCTGTTCTAGG + Intronic
1182832410 22:33314563-33314585 TATGTGCCAGGCACTGTTCTCGG + Intronic
1182833944 22:33326304-33326326 TTTATGCCAAGTCTTGTGCTAGG + Intronic
1183009861 22:34936039-34936061 TATGTGCCAGGCATTGTTCTAGG + Intergenic
1183017742 22:35003577-35003599 TATATGCCAGGCACTGTTTTAGG + Intergenic
1183257930 22:36775057-36775079 TATGTTCCAGGCATTGTTCTGGG + Intronic
1183317497 22:37144934-37144956 TATGTGCCAGGCACTGTTCTAGG - Intronic
1183415651 22:37680420-37680442 CATATGCCAGGTATTGAACTTGG - Intergenic
1183501941 22:38185561-38185583 TATGTGCCAGGCAGTGTTCTTGG + Intronic
1183615067 22:38939093-38939115 TATGTGACAGGTGCTATTCTAGG - Intergenic
1183682123 22:39338072-39338094 TATGTTCCAGGCATTGTTCTAGG - Intergenic
1184185283 22:42860683-42860705 TATGTGCCAGGCATTATTCTAGG - Intronic
1184267948 22:43359944-43359966 TATATGCCAAGCACTGTTCTGGG + Intergenic
1185308285 22:50135813-50135835 TACATGCCAGGTATTGTCCTGGG + Intronic
949164983 3:929149-929171 TATATGCCAGGCATTATCCTAGG - Intergenic
949421899 3:3874671-3874693 TATGTCCCAGGTATTTTTCTAGG - Intronic
949448206 3:4158083-4158105 CCTGTGCCAGGTGTTGTACTTGG + Intronic
949493260 3:4609232-4609254 TATCTTTCAGGTGGTGTTCTGGG + Intronic
949529247 3:4937696-4937718 TTTATGCCAGGCATTTTTCTAGG - Intergenic
949672817 3:6419136-6419158 AATGTGCCAGGTGCTATTCTAGG - Intergenic
949838416 3:8293822-8293844 TCTGTGCCAGGCATTGTTCTGGG - Intergenic
949887932 3:8711274-8711296 TAAATGCCAAAAGTTGTTCTAGG - Intronic
949917261 3:8974713-8974735 TGTGTGCCAAGTGTTATTCTGGG - Intergenic
950087232 3:10268775-10268797 TATCTGCCAGGCACTGTTCTAGG + Intronic
950251775 3:11471443-11471465 TACATGCCAGGTGTTATGCTAGG - Intronic
950500600 3:13361225-13361247 TATGTGCCAGGCATGGTTCTAGG - Intronic
950580891 3:13861401-13861423 TATGTGCCAGGCACTGTTCTAGG + Intronic
950801674 3:15556856-15556878 TATATGCCAGGCATTGGGCTAGG + Intergenic
950821347 3:15762793-15762815 TATATGCCAGGGACTTTTCTAGG + Intronic
950901728 3:16504037-16504059 TCTCTGCCATATGTTGTTCTGGG - Intronic
950982868 3:17327852-17327874 TGTATACCAGGTACTGTTCTAGG - Intronic
950983230 3:17331577-17331599 TCTATGCCAGGTGCTGTTCAGGG + Intronic
951159062 3:19393956-19393978 TATGTGTCAGGTACTGTTCTAGG + Intronic
951359240 3:21704764-21704786 TATGTGTCAGGTACTGTTCTAGG - Intronic
951499492 3:23368306-23368328 TCTATGCCAGCTGCTGTACTAGG + Intronic
951553482 3:23897892-23897914 TATGTGCCAGGCATTGTTCTAGG - Intronic
951695045 3:25437635-25437657 TATAAACCAGCTGTGGTTCTTGG - Intronic
951707222 3:25555491-25555513 TATGTTCCAGGTACTGTTCTAGG - Intronic
951731819 3:25817965-25817987 ACTATGTCAGGTGCTGTTCTAGG - Intergenic
951851119 3:27140758-27140780 TATGTGCCAGATGCTATTCTAGG - Intronic
951914647 3:27787382-27787404 TATGTGCCAGGTGCTGCTCCAGG + Intergenic
952002671 3:28804604-28804626 TATATGCCAGGCTCTGTTCTAGG - Intergenic
952023121 3:29047055-29047077 TATGTACCAAGAGTTGTTCTAGG + Intergenic
952040909 3:29260837-29260859 TATGTGCCAGACATTGTTCTAGG + Intergenic
952502847 3:33980107-33980129 TATATACAAGGTATTGTTCCAGG - Intergenic
952936209 3:38400197-38400219 TGTATGCCAGATGGTGTGCTAGG + Intronic
953142781 3:40245051-40245073 TCTGTGCCAGGTATTGTGCTAGG - Intronic
953411847 3:42695004-42695026 TATGTGCCAGGCATTGTTCTAGG - Intronic
953488106 3:43321995-43322017 TATTTGCCAGGCGCTGTGCTAGG - Intronic
954183454 3:48899140-48899162 CATATGCCAGGCGTCCTTCTAGG + Intergenic
954534510 3:51349097-51349119 TATTTGTCAGGTGTTATTTTTGG - Intronic
954850654 3:53597161-53597183 TATGTGCCAGATGGTGTTCTAGG + Intronic
954996185 3:54884028-54884050 TATATGCCAGGTATGATTCTAGG - Intronic
955016724 3:55077434-55077456 TATAGGCCAGGCACTGTTCTGGG - Intergenic
955273386 3:57524352-57524374 TATGTGCCAGGTACTGTTCTAGG - Intronic
955358504 3:58251864-58251886 TCTTTGCCAGGTGATGTTTTAGG + Intronic
955444526 3:58995300-58995322 CATGTGCCAGTGGTTGTTCTGGG - Intronic
955519131 3:59757909-59757931 TATATTCCAGGCTCTGTTCTAGG + Intronic
955611933 3:60766787-60766809 TATATGCCAGGTACTGGGCTAGG + Intronic
955653281 3:61217372-61217394 TATCTGCCAGTTGTTGCTCAGGG + Intronic
955689029 3:61572607-61572629 AGCATGCCAGGTGCTGTTCTAGG + Intronic
955775029 3:62423725-62423747 TATGTACCAGGTACTGTTCTAGG - Intronic
955840109 3:63103600-63103622 TATGTGCTAGGAGCTGTTCTTGG + Intergenic
955950220 3:64236274-64236296 TATGTGCCAGGCATTTTTCTGGG - Intronic
955958842 3:64318377-64318399 TATATGCCAGGAACTGTTCTAGG + Intronic
955961535 3:64345977-64345999 TATCTGCCAGGCTCTGTTCTAGG + Intronic
955991249 3:64629756-64629778 TATGTGCCAGGCACTGTTCTAGG - Intronic
956003137 3:64750283-64750305 TTTATGTCAAGTGCTGTTCTAGG + Intergenic
956012312 3:64844777-64844799 TACATGTCTGGTGCTGTTCTAGG - Intergenic
956058095 3:65321946-65321968 AATGTGCCAGGTACTGTTCTGGG + Intergenic
956083274 3:65582208-65582230 TCTATGCCATGTACTGTTCTAGG - Intronic
956101878 3:65777011-65777033 TATGTTCCAGGTGCTGTGCTAGG - Intronic
956159125 3:66329994-66330016 TATGTGCCAGATGCTGTTCTAGG + Intronic
956197106 3:66664001-66664023 CACATGCCAGGTGCTGTGCTAGG + Intergenic
956437390 3:69247157-69247179 TATAAGCCAGATGTTGCCCTGGG + Intronic
956701062 3:71958877-71958899 TATATGTCAGGCATTGTTCTAGG + Intergenic
956736207 3:72240191-72240213 TGTATGCCAGGTACTGGTCTAGG - Intergenic
956785353 3:72637754-72637776 TATGTGTCAGGTGCTATTCTAGG - Intergenic
956898300 3:73686339-73686361 TACATGCCAGGTACTGTGCTAGG - Intergenic
956994939 3:74815321-74815343 TATATGCCAGCTGCTGTGCTAGG - Intergenic
957141500 3:76364453-76364475 TATTTGACAGGCGTTATTCTAGG - Intronic
957143081 3:76386403-76386425 TATATGTCAGGTATTGTTCTAGG + Intronic
957628480 3:82686349-82686371 TATTTTCCAGGTTTTCTTCTAGG + Intergenic
957636708 3:82795251-82795273 TATGTGCCAGGAAATGTTCTAGG - Intergenic
957894927 3:86410085-86410107 TAATTGCCAGGTTTTTTTCTTGG + Intergenic
957896840 3:86431927-86431949 TATTTCCTAGGTGTTCTTCTAGG - Intergenic
957908752 3:86592660-86592682 TCTATGCCAGTTGCTGGTCTTGG - Intergenic
958069176 3:88587284-88587306 TATACACCAGGTGCTCTTCTTGG + Intergenic
958094243 3:88921661-88921683 TATGTGCCAGATGTTGTTCTGGG + Intergenic
958491895 3:94785981-94786003 TCTATGTCAGGTATTGTGCTAGG + Intergenic
958713060 3:97741504-97741526 TATGTGCCAGTTGTGGTACTAGG + Intronic
958919886 3:100092633-100092655 TAGATACCAGGCGTTATTCTAGG - Intronic
959029844 3:101286178-101286200 TATAGGCCAGACATTGTTCTAGG - Intronic
959084338 3:101835075-101835097 TATGTGCCAGGAGTTGTGCTAGG + Intronic
959128341 3:102318888-102318910 TATATTCTAGGTTTTCTTCTAGG + Intronic
959145444 3:102538958-102538980 TATATGCCAGACTCTGTTCTAGG + Intergenic
959257729 3:104036308-104036330 TATTTCCTAGGTTTTGTTCTAGG - Intergenic
959309715 3:104718368-104718390 TATATGCTAGGTGCTGTTTTAGG - Intergenic
959352944 3:105290793-105290815 TATATACCAGATTTTCTTCTAGG - Intergenic
959567953 3:107851991-107852013 AATATTACAGGTATTGTTCTAGG + Intergenic
959621896 3:108407804-108407826 TACATGCCAGGCAATGTTCTAGG + Intronic
959810373 3:110612184-110612206 TGTGTGCCAGGCATTGTTCTAGG - Intergenic
960005820 3:112780221-112780243 TATGTACCAGGCATTGTTCTAGG - Intronic
960360762 3:116708087-116708109 TATGTGCCAGACGTTGTTCTTGG - Intronic
960548376 3:118944772-118944794 TATGTGCCAAGTATTGTTTTAGG + Intronic
960870943 3:122249141-122249163 TTTGTGCCAGGTGCTGTGCTGGG + Intronic
960885700 3:122392014-122392036 TATGTGCCAGGCATTGTTTTAGG - Intronic
960954688 3:123023845-123023867 TATGTGCCAGGCACTGTTCTAGG - Intronic
961135633 3:124507747-124507769 TTTAAGCCAGTTGTTGTGCTAGG + Intronic
961181574 3:124882157-124882179 TATGTGCCTGGTGCTGTTGTAGG + Intronic
961184453 3:124902508-124902530 TCTATGCCAGGCATTGTGCTGGG + Intergenic
961218444 3:125180385-125180407 TATGAGCCAGATATTGTTCTAGG - Intronic
961361519 3:126371026-126371048 TATGTGCCTGGTACTGTTCTGGG + Intergenic
961786540 3:129350445-129350467 TATGTGCCAGGAATTGTCCTAGG - Intergenic
961926929 3:130491160-130491182 CATATGTCAGGTATTGTGCTAGG - Intergenic
962011822 3:131399312-131399334 TATATGCCAGATGCTGTTTTAGG + Intergenic
962123962 3:132594925-132594947 TATGTGTCAGGTATTATTCTTGG + Intronic
962184695 3:133245621-133245643 CATGTGCCAGGCATTGTTCTAGG - Intronic
962283380 3:134068234-134068256 TATATGGCAGATGCTGTGCTAGG - Intronic
962336499 3:134536295-134536317 TATATGCCAGGTACTGCTTTAGG - Intronic
962440684 3:135412938-135412960 TATATGTCAGGCATTGTTCTAGG - Intergenic
962505635 3:136044330-136044352 TATATGCCAGGTATTGTGTCTGG + Intronic
962508381 3:136072229-136072251 TATATGCCAGGGAATATTCTAGG - Intronic
962675972 3:137758973-137758995 TATGTGCCAGGCATTGTGCTAGG - Intergenic
962859175 3:139382047-139382069 TATGTGCCAGGTAATGTTATAGG + Intronic
962930340 3:140030179-140030201 AATGTGCCAGGTGCTGTCCTGGG + Intronic
962948617 3:140197333-140197355 TATGTGCCTGGTGCTGTACTGGG + Intronic
963065968 3:141264873-141264895 TATGTGCCAGGTACTGTTCTGGG - Intronic
963155132 3:142088124-142088146 TATGTGCCAGGCATTTTTCTAGG - Intronic
963580186 3:147116361-147116383 TAAATGCCTGATGTTGTTCCTGG + Intergenic
963807956 3:149745379-149745401 TATATGCCAGGTATTGTGCTGGG + Intronic
963868998 3:150393605-150393627 TATGTGCCAGGTACTGTGCTAGG + Intergenic
963925006 3:150942554-150942576 TATGTGCCAGGCATTATTCTAGG + Intronic
964105265 3:153032553-153032575 TACATGTCAGGTGCTGGTCTTGG - Intergenic
964315019 3:155434489-155434511 TCTATGCCAGGTCTTGTGATAGG - Intronic
964351536 3:155807896-155807918 TATGCGCCAGGTATTGTTCTAGG + Intergenic
964379546 3:156084185-156084207 TATATGCCAGACATTGTTCTAGG - Intronic
964533763 3:157696864-157696886 TATGTGCCAGGCACTGTTCTGGG - Intergenic
964592027 3:158375883-158375905 CATATGCCAGGTATTCTTTTAGG + Intronic
964642076 3:158919185-158919207 TATTTGCCAGGTACTGTTCTTGG + Intergenic
964683763 3:159371135-159371157 TATGTTCCAAGTGTGGTTCTAGG - Intronic
964793598 3:160475027-160475049 TATGTGCCAGGTGCAATTCTGGG - Intronic
964834521 3:160922803-160922825 TATATGTCAGGTACTGTGCTAGG + Intronic
964931283 3:162027618-162027640 TATATGCCAGATTCTATTCTAGG + Intergenic
964989841 3:162795876-162795898 TATGTCCCAGGTATTGTTATGGG - Intergenic
965437085 3:168665778-168665800 TACATGCCAGGTCTTGTGCAAGG - Intergenic
966136263 3:176701798-176701820 TATATGCCAAGCACTGTTCTAGG + Intergenic
966347084 3:178991849-178991871 TATGTGCCAGGCATTATTCTGGG - Intergenic
966578545 3:181532334-181532356 TATTTGCTAGGCATTGTTCTAGG + Intergenic
966582370 3:181582411-181582433 GATATGTCATATGTTGTTCTGGG - Intergenic
966671067 3:182526652-182526674 CATGTGCCAGGTACTGTTCTAGG + Intergenic
966729888 3:183141965-183141987 TCCATGCCAGGGATTGTTCTTGG + Intronic
967071599 3:185967268-185967290 TATAGGCCAGGTGCTATGCTGGG - Intergenic
967120581 3:186379117-186379139 GATATCCCAGGTTTTCTTCTAGG + Intergenic
967302578 3:188030260-188030282 TATGTGCCAGGCATTGTGCTGGG - Intergenic
967323732 3:188218674-188218696 TGTATGCCAGGCATTGTGCTAGG + Intronic
967420034 3:189262468-189262490 TATGTGCCAGGTGCTGGGCTGGG + Intronic
967526097 3:190494640-190494662 GTTATGCCAGGTAATGTTCTGGG - Intergenic
967588820 3:191247685-191247707 TATGTGCCAGATGCTGTGCTTGG - Intronic
967679938 3:192349913-192349935 TATGTGCCAGGTATTCTTTTAGG + Intronic
967724589 3:192849832-192849854 TCTGTGCCAGGAGTTGTTCTAGG - Intronic
967772284 3:193347241-193347263 TATGTGCCAGGCATTGTTGTAGG + Intronic
967943823 3:194786775-194786797 TATATGCCAGATGCTGTGCTAGG + Intergenic
968007146 3:195250856-195250878 TATGTGCCAGGTGCTGTCCTGGG - Intronic
968036085 3:195549236-195549258 TATGTGCCAGGTCCTTTTCTAGG + Intergenic
968037402 3:195559562-195559584 TATGTGCCAGGAACTGTTCTAGG + Intergenic
968062429 3:195735833-195735855 TATGTGCCAGGTACTGTTCTTGG - Intronic
968823888 4:2878551-2878573 TGTGTGCCAGGCATTGTTCTAGG + Intronic
969067166 4:4495223-4495245 TATATGCCAGGCACTTTTCTAGG - Intronic
969146616 4:5129916-5129938 TATATGCCAGGCACTGTTCTAGG + Intronic
969160470 4:5253291-5253313 TTGAGACCAGGTGTTGTTCTTGG + Intronic
969255050 4:5995828-5995850 TGTGTGCCAGGTGTGGCTCTAGG + Intergenic
969509284 4:7608469-7608491 TACATGCCAGGTGTTGTCCTGGG - Intronic
969526640 4:7707198-7707220 TATGTGCCAGGTGCTGTTTGAGG + Intronic
969819032 4:9706953-9706975 AATAAGCCAGGTGTTGTGGTGGG + Intergenic
970015166 4:11504945-11504967 TGTATGCCAGGTATTTTGCTGGG + Intergenic
970180122 4:13383521-13383543 TATATGCCAGGTATTGTGGCAGG + Intronic
970203998 4:13637943-13637965 TATGTGCCAGGTGTTGTACTAGG + Intergenic
970303565 4:14706961-14706983 TATATGCTAGGTACTGTTCCTGG + Intergenic
970474657 4:16410103-16410125 AATTTGCCAGGTGTTGATTTTGG + Intergenic
970493559 4:16602164-16602186 TACAGGCCAGATATTGTTCTAGG + Intronic
970604791 4:17668878-17668900 TATGTGCCAGGCATTGTTCTAGG + Intronic
970827292 4:20291121-20291143 AATATGCCAGGCATTGTGCTGGG - Intronic
971000150 4:22313067-22313089 TAAATGCCAGGCACTGTTCTTGG - Intergenic
971027828 4:22606112-22606134 TATATGTCAGGTACTGTACTAGG - Intergenic
971110553 4:23580602-23580624 TTTGTGCCAGGTGTTGTGCTGGG + Intergenic
971260685 4:25054158-25054180 TATGTGCCAGGCTTTATTCTGGG + Intergenic
971354255 4:25880064-25880086 TATATGCCAAGTGTTGTGCTTGG - Intronic
971423514 4:26494543-26494565 TATATGCCAGATATTGTGGTAGG - Intergenic
971452538 4:26813552-26813574 TATATCCATGGTGTTCTTCTTGG + Intergenic
971453378 4:26820927-26820949 TGTATTCCAGGTGATGTTCTGGG - Intergenic
971461698 4:26905754-26905776 TATGTGCCAAGTGGTGTTCTGGG + Intronic
971477754 4:27088326-27088348 TATGTGCCAGGCACTGTTCTAGG - Intergenic
971517598 4:27508414-27508436 TATATGCCAGTCACTGTTCTTGG + Intergenic
971667308 4:29506071-29506093 TATATGTCAGGTATTGATGTAGG + Intergenic
971829173 4:31668072-31668094 ATAATGCCAGGAGTTGTTCTAGG + Intergenic
972214948 4:36886715-36886737 TATTTTCTAGGTGTTCTTCTAGG + Intergenic
972351420 4:38239518-38239540 TCTATGCCAGGCATTGTGCTTGG + Intergenic
972368434 4:38397589-38397611 TATGTGCCAGGCGCTGTGCTAGG + Intergenic
972454008 4:39234130-39234152 TATCTGCCAGATACTGTTCTAGG - Intronic
973155499 4:46946675-46946697 TTTGTGCCAGGCGTTGTACTAGG - Intronic
973193975 4:47418671-47418693 TATATGCCAAGTACTTTTCTTGG + Intronic
973233948 4:47876185-47876207 CATGTGCCAGGCATTGTTCTTGG + Intronic
973304842 4:48634779-48634801 TCTATGCTAGGCATTGTTCTAGG - Intronic
973345030 4:49046370-49046392 TATGTACTGGGTGTTGTTCTCGG + Intronic
973533574 4:51857895-51857917 TATGTGCCAGGTACTCTTCTAGG + Intronic
973570108 4:52230014-52230036 TATATTCCAGGTATTGTTCTAGG - Intergenic
973628594 4:52797320-52797342 TATGTGCCAAGCATTGTTCTAGG - Intergenic
973735634 4:53868999-53869021 TGTGTGCCAGGTGCTGTCCTGGG - Intronic
973755732 4:54071644-54071666 TATATGGCAGGTACTGTTGTAGG - Intronic
973793238 4:54397211-54397233 TATGTGCCAGGCACTGTTCTAGG - Intergenic
973848425 4:54936731-54936753 TATATGTCAGGCAGTGTTCTAGG - Intergenic
973849162 4:54944440-54944462 TAGATGCCTGGTGTTGCACTGGG - Intergenic
973856856 4:55020060-55020082 TATATGCCAGATGCTGCACTAGG - Intergenic
974100799 4:57414037-57414059 TTTCTGCCAGGTATTGGTCTAGG + Intergenic
974737709 4:65959689-65959711 TATTTGCCAGGACCTGTTCTAGG + Intergenic
974922381 4:68257864-68257886 TAGCTGCCAGGAGTTGTACTAGG + Intergenic
974933590 4:68387712-68387734 TCTATGCCAGCCATTGTTCTAGG - Intergenic
975101534 4:70519601-70519623 TATATGCCAGACATTGTGCTAGG + Intronic
975396784 4:73884137-73884159 TTTCTGCCAGGTATTGATCTGGG - Intergenic
975397434 4:73893318-73893340 TGTATGCTAGTTGTTTTTCTAGG - Intergenic
975793924 4:77985605-77985627 TATGTGCCAGGTACTTTTCTAGG + Intergenic
975893403 4:79056392-79056414 TATATGCCAGGTATTTTTCTAGG - Intergenic
976057277 4:81082921-81082943 TATGTTCCAGGCATTGTTCTAGG - Intergenic
976338279 4:83916201-83916223 TATGTGCCAGACATTGTTCTAGG - Intergenic
976369334 4:84268822-84268844 TATGTGCCAGCTGCTGTGCTAGG - Intergenic
976620431 4:87121324-87121346 TTTACGGCAGGTCTTGTTCTTGG + Intronic
977007615 4:91590790-91590812 TATATACCAGGCATTCTTCTGGG - Intronic
977136305 4:93309193-93309215 TATATGCCAGGTCCTATTTTAGG - Intronic
977705152 4:100062379-100062401 TATATGCCAGGCACTGTTCTAGG + Intergenic
977764850 4:100784948-100784970 TATATGCCAGGCACTGTACTGGG + Intronic
977795923 4:101164394-101164416 TATATGCCAAGTACTGTTTTAGG - Intronic
977891052 4:102312021-102312043 TCTGTGCCAGGCATTGTTCTAGG + Intronic
977914388 4:102575164-102575186 CATATGTCAGGCATTGTTCTAGG + Intronic
978078111 4:104558454-104558476 TATTTGCAAGATGCTGTTCTAGG + Intergenic
978189193 4:105894025-105894047 TATGTGCCAGGCAGTGTTCTAGG + Intronic
978672878 4:111272334-111272356 TATGTGCCAGCCGCTGTTCTAGG - Intergenic
978890959 4:113827009-113827031 TATATGCCAGTCACTGTTCTAGG + Intergenic
978915135 4:114116268-114116290 TATATGTCAGAGGCTGTTCTAGG - Intergenic
978943700 4:114469532-114469554 TATGTGCCTAGTATTGTTCTAGG + Intergenic
979209222 4:118079121-118079143 TATGTGCCAGGCATTGTTCTAGG + Intronic
979302266 4:119100560-119100582 TAAGTGCCAGGTATTCTTCTAGG + Intergenic
979316707 4:119273520-119273542 TATATGCCATGTGCTGTTCTAGG - Intronic
979319981 4:119311902-119311924 TATGTGCCAGGTGCTGATCTAGG - Intergenic
979351647 4:119650532-119650554 AAGATTCCAGGTGTTGTTATGGG + Intergenic
979353451 4:119673820-119673842 TATGTGCTAGGTATTCTTCTAGG + Intergenic
979399331 4:120228863-120228885 TATATACCAGGCTTTGTTCTAGG - Intergenic
979467192 4:121054369-121054391 TACATGCCAGGTACTCTTCTAGG + Intronic
979577125 4:122306621-122306643 TGTATGCCAGGGACTGTTCTAGG - Intronic
979698911 4:123645080-123645102 TATATGCCTGACGTTGTGCTAGG + Intergenic
979778599 4:124621874-124621896 CATATGACAGGTGTAGTTGTGGG - Intergenic
979838311 4:125403148-125403170 TATCTGTCAAGGGTTGTTCTAGG + Intronic
979952026 4:126905234-126905256 TATCTGCCAGGCCCTGTTCTAGG - Intergenic
980190467 4:129518815-129518837 TATATGCCAGGCACTGTTTTAGG + Intergenic
981015610 4:139970854-139970876 CATATGCTAGGTGCTCTTCTAGG - Intronic
981251527 4:142608561-142608583 TATCTTCCAAGTATTGTTCTAGG - Intronic
981319251 4:143372370-143372392 TGTAGGCCAGGACTTGTTCTTGG + Intronic
981331829 4:143518493-143518515 TATGTGCCAGATACTGTTCTGGG - Intronic
981360717 4:143842781-143842803 TGTAAGCCAGGTGTTACTCTTGG + Intergenic
981371476 4:143963839-143963861 TGTAAGCCAGGTGTTACTCTTGG + Intergenic
981380558 4:144067046-144067068 TGTAAGCCAGGTGTTACTCTTGG + Intergenic
981682669 4:147418099-147418121 TATCTGCCAGGCACTGTTCTGGG + Intergenic
981692782 4:147528258-147528280 TATTTGGCACTTGTTGTTCTAGG + Intronic
981769227 4:148288385-148288407 TAAATGCCAGGCACTGTTCTAGG + Intronic
981957279 4:150493395-150493417 TTTGTGCCAGGTATTTTTCTAGG - Intronic
982357362 4:154485594-154485616 TACATGCCAGGAACTGTTCTTGG - Intronic
982358565 4:154494130-154494152 TACATGCTAGGTACTGTTCTAGG - Intergenic
982419182 4:155174275-155174297 TATATACCAGGTACTGTTATAGG + Intergenic
982610627 4:157569750-157569772 TATATGCTAGGCACTGTTCTAGG + Intergenic
982653205 4:158113380-158113402 TATATGCCAGGCATTGCTTTAGG - Intergenic
982997731 4:162371289-162371311 TATGTTCCAGATGCTGTTCTTGG + Intergenic
983065062 4:163199789-163199811 CATGTGCCAGGCATTGTTCTAGG + Intergenic
983099539 4:163608086-163608108 TATCTGCCAGGCATTGTTCCAGG + Intronic
983103277 4:163652889-163652911 TATGTTCCTGGTGTTGTTCTAGG + Intronic
983636594 4:169903468-169903490 TGTGAGCCAGGTATTGTTCTAGG - Intergenic
983972636 4:173893387-173893409 TACATACCAGAGGTTGTTCTTGG - Intergenic
984504690 4:180602286-180602308 CATATGCCAGGTATTGTTTTGGG + Intergenic
984679515 4:182591069-182591091 TTTATGCCAGGCTCTGTTCTAGG - Intronic
984838896 4:184050182-184050204 TATATGCCAGGCGCTGGTCTAGG + Intergenic
985017671 4:185653624-185653646 TATATTCTAGGCATTGTTCTAGG - Intronic
985060496 4:186072849-186072871 AAAGTGCCAGGTCTTGTTCTAGG + Intronic
986364194 5:7013607-7013629 TATATGCATGCTTTTGTTCTTGG + Intergenic
986446194 5:7823657-7823679 AATATTCCGGGTGTTGTGCTGGG - Intronic
986451574 5:7869924-7869946 TTCATGCCAGGTGCCGTTCTGGG + Intronic
986619407 5:9656139-9656161 TATGTGCCAGGTACTGTGCTTGG - Intronic
987037582 5:14033477-14033499 TGTATGCCAGGCATGGTTCTAGG - Intergenic
987038316 5:14039263-14039285 TACGTGCCAGGCATTGTTCTAGG - Intergenic
987206556 5:15633642-15633664 TAAATGTCAGGTATTGTACTTGG + Intronic
987277138 5:16374112-16374134 TTTATGTCAGGTATTGTCCTGGG - Intergenic
987784576 5:22483374-22483396 ACTATGCCAGGAGCTGTTCTAGG + Intronic
987889221 5:23854455-23854477 TATTTCCCAGGTTTTCTTCTAGG + Intergenic
988055483 5:26088861-26088883 TATATGCCAGGCACTTTTCTAGG - Intergenic
988443380 5:31257586-31257608 TATGTGCCAGGCACTGTTCTTGG + Intronic
988616099 5:32776691-32776713 TATGTGCCAGGTGCTGTTCAAGG + Intronic
988930962 5:36035245-36035267 AATATGCAAGGTGTCTTTCTTGG + Exonic
988943362 5:36168631-36168653 TATATGCCAGGCCCTGTGCTAGG + Intronic
988987606 5:36636185-36636207 TATATGCCAGGTGCTTCTCTAGG + Intronic
989142133 5:38211960-38211982 TAAATGCCAGGTTTTGCTCTTGG + Intergenic
989332485 5:40276057-40276079 TCTATGCCCTGTGTTGTTTTAGG + Intergenic
989430838 5:41353569-41353591 TATATGCCAGGAATTGTTCTAGG + Intronic
989644981 5:43621409-43621431 GATATGCGAGGCATTGTTCTAGG + Intronic
989750701 5:44889414-44889436 TATATACCAGGCATTGTACTAGG - Intergenic
990097934 5:52141356-52141378 TCTATGCCAGACATTGTTCTAGG + Intergenic
990227050 5:53666579-53666601 TATATGTCAGGTTTTGTGCTAGG - Intronic
990448626 5:55915866-55915888 TACATGCCAGGTGCTGGGCTAGG + Intronic
990766238 5:59186363-59186385 TATTTGCCAGGCACTGTTCTTGG - Intronic
990900779 5:60746672-60746694 AATATGCCAGCCATTGTTCTAGG + Intergenic
990906183 5:60805873-60805895 TACATGCCAGGCGTTGGTCTAGG - Intronic
991190734 5:63870142-63870164 TATATACCAGGCATTGTACTTGG + Intergenic
991312926 5:65264799-65264821 TACATGCCAAGTGCTATTCTAGG - Intronic
991335985 5:65547811-65547833 AATTTGCCAGGTGTTGTGGTGGG - Intronic
991435001 5:66588884-66588906 CATATGCCAGATATTGTGCTAGG + Intergenic
991572808 5:68073452-68073474 TATGTGCCAGGCCTTGCTCTAGG + Intergenic
991624907 5:68590707-68590729 TATAAGCCAAGTCTTGTTTTAGG - Intergenic
991655198 5:68896998-68897020 TATATACCAGGTACTATTCTAGG - Intergenic
991936679 5:71808916-71808938 TATGAGCCAGGTGCTGTGCTGGG + Intergenic
992139968 5:73786151-73786173 TACGTGCCAGGCATTGTTCTAGG + Intronic
992764885 5:79988836-79988858 TATGTGTCAGGCCTTGTTCTGGG - Intronic
992986794 5:82238629-82238651 TATATGCCAGGCACTTTTCTAGG - Intronic
993060435 5:83031991-83032013 TATATACCAGGCGTTGTGCTTGG + Intergenic
993114677 5:83706015-83706037 TTTATTCCAGGTTTAGTTCTAGG - Intronic
993359406 5:86955535-86955557 TATATGGCAGAAATTGTTCTAGG - Intergenic
993403361 5:87480695-87480717 TGTATGCCAGTTACTGTTCTAGG - Intergenic
993453749 5:88103833-88103855 TATATGCCAGATACTATTCTAGG + Intergenic
993467168 5:88263379-88263401 TGTATGCCAGGTACTGTTTTTGG - Intronic
993725104 5:91357995-91358017 AATATGCCAGGTATTGTGCAAGG - Intergenic
994039531 5:95243267-95243289 TGTATGCCATCTATTGTTCTGGG - Intronic
994045441 5:95304152-95304174 TATGTGCCAGGCAATGTTCTAGG - Intergenic
994203624 5:97007466-97007488 TATGTGCCAGGCATTGTTCTAGG - Intronic
994760533 5:103846919-103846941 CATCTACCAGGTGTTGTTCTAGG + Intergenic
994878292 5:105452366-105452388 TATATGCCAGATGTTGCCCAAGG + Intergenic
995049236 5:107683706-107683728 TATATGCCAGGCACTGTTCCAGG + Intergenic
995060782 5:107809845-107809867 CATATGCCAGGCATTGTCCTAGG + Intergenic
995174916 5:109165127-109165149 TATTTGCCAGGCACTGTTCTAGG - Intronic
995227539 5:109718586-109718608 TATATGCCAAGTGTTCAGCTAGG - Intronic
995378702 5:111508323-111508345 TATGTGCCAGGCAGTGTTCTAGG - Intronic
995463677 5:112428902-112428924 TCTTTGCCAGATGTTGTGCTGGG - Intergenic
995476151 5:112550398-112550420 TCTATGCCAGGTACTGTGCTGGG - Intergenic
995562414 5:113396780-113396802 TATATGCCAGGTATCATTCTTGG - Intronic
995624080 5:114057517-114057539 TCTGTGCCAGGTGCTGTGCTAGG + Intergenic
995793186 5:115915487-115915509 TATGTGCCAGGCATTGTTCTGGG + Intergenic
995881104 5:116845528-116845550 CATGTGCCAGGTATTGTTTTGGG + Intergenic
996040282 5:118801535-118801557 TTTATGCCAGGTACTGTGCTAGG + Intergenic
996658270 5:125967502-125967524 GAAATGCCAGGGGTTGTTCTAGG + Intergenic
996877983 5:128260985-128261007 TATATGTCAGGCATTGTTCCAGG + Intronic
996894856 5:128469044-128469066 TATATACTAGATATTGTTCTGGG + Intronic
997201998 5:132016108-132016130 TATGTGCAAGGCATTGTTCTAGG + Intergenic
997258751 5:132449271-132449293 TATATGCCAGGCACTGTCCTAGG - Intronic
997787258 5:136724855-136724877 TGTGTGCCAGGTATTATTCTAGG + Intergenic
998006856 5:138662787-138662809 TATGTGCCAGGCGCTGTCCTGGG - Intronic
998013234 5:138711976-138711998 TGTGTGCCAAGTGGTGTTCTGGG + Intronic
998096406 5:139397985-139398007 TATGTGCCAGGTGCTGTTTTAGG - Intronic
998431453 5:142073990-142074012 TGTATGCCAGGCACTGTTCTAGG - Intergenic
998551261 5:143080171-143080193 TATATACCAAGTGCTATTCTAGG + Intronic
998587895 5:143447540-143447562 TATATGCCAGAAGCAGTTCTAGG - Intergenic
998625661 5:143842923-143842945 CATGTGGCAGGTATTGTTCTAGG + Intergenic
998637056 5:143967277-143967299 TCTATGCCAGGCATTATTCTTGG + Intergenic
998833805 5:146185207-146185229 CATATGCCAAGTATTGTTTTAGG - Intergenic
998895285 5:146792414-146792436 TATATGCCAAGTACTGTCCTAGG + Intronic
998943458 5:147311421-147311443 TATATGCCAGGGGTTGCTGATGG + Intronic
998985719 5:147754303-147754325 TATATGCCAGGATGTGTCCTGGG + Intronic
999241037 5:150127461-150127483 CATGTGCCAGGTGTGGTTTTAGG - Intronic
999291248 5:150427884-150427906 TTTATGCCAGGCACTGTTCTAGG + Intergenic
999326404 5:150646907-150646929 TGTATGACAGGTGCTGTTCTAGG + Intronic
999509172 5:152230029-152230051 TATGTGCCAGGTGCTGAGCTTGG - Intergenic
999525648 5:152403276-152403298 TATATGTCAGCTGTAGATCTGGG + Intronic
999635398 5:153616624-153616646 TATATGCTAGGGGCTGTGCTAGG - Intronic
999693860 5:154171213-154171235 TATGTGCTGGGTGTTGTGCTGGG + Intronic
999797740 5:155004153-155004175 TATATACCAGGCATTGTTCTGGG + Intergenic
999833090 5:155339250-155339272 TCTGTGCCAGGCATTGTTCTAGG + Intergenic
1000128574 5:158272255-158272277 TATATGCTAGGCACTGTTCTGGG - Intergenic
1000239465 5:159396046-159396068 TGTGTGCCAGGTTTTGTTCTAGG + Intergenic
1000349412 5:160341485-160341507 TATATGCCAGGCTCTGTTCTGGG - Intronic
1000478400 5:161741810-161741832 TAAATGCCAGGTTTTTTGCTAGG + Intergenic
1000682020 5:164196863-164196885 TATGTTCCAGATGCTGTTCTAGG + Intergenic
1000691137 5:164322642-164322664 TAAATGTCAGGCATTGTTCTAGG + Intergenic
1001054471 5:168437589-168437611 TATGTGCCAGGCACTGTTCTGGG - Intronic
1001249059 5:170132095-170132117 TTTATGCCATGTGCTGATCTGGG + Intergenic
1001278389 5:170367480-170367502 TCTATGCCAGGTCTTGTGCTGGG - Intronic
1001423911 5:171610856-171610878 TATATGCCAAGCATTGTTCTAGG - Intergenic
1001675704 5:173513098-173513120 TATATGCCAGATATTGACCTAGG - Intergenic
1001701455 5:173709601-173709623 CATATGCCAGGCAGTGTTCTAGG - Intergenic
1001786203 5:174415899-174415921 TATATGCCAGGTACTGATCATGG + Intergenic
1001875736 5:175198787-175198809 TACATGCCAGGTGGTGTTTTAGG + Intergenic
1001903548 5:175451939-175451961 TATTGGCCAGGTACTGTTCTAGG + Intergenic
1002156119 5:177281466-177281488 TATGTGCCAGGTATTGTGCTGGG + Intronic
1002366469 5:178716498-178716520 TATGGGCCAGGTAATGTTCTGGG + Intronic
1002616673 5:180460586-180460608 CATACACCAGGTGCTGTTCTAGG - Intergenic
1002659031 5:180777764-180777786 TCTGTGCCAGGCATTGTTCTAGG + Intergenic
1003362775 6:5444642-5444664 TATGTGCTAGGCATTGTTCTAGG - Intronic
1003477304 6:6495408-6495430 TATATGCCAGATATTATGCTAGG - Intergenic
1003577249 6:7308799-7308821 TATGTGCCAGGCACTGTTCTTGG - Intronic
1003635788 6:7830358-7830380 TATGTGCCAGGTGCTGTGCTGGG + Intronic
1003822155 6:9910737-9910759 TATAAGCCAGGTAATATTCTAGG - Intronic
1003844407 6:10157781-10157803 TATGTGTCAGGTGTTGTTCCAGG - Intronic
1003940301 6:11017852-11017874 TATGTGCCAGGCATTGTTCTTGG - Intronic
1004237485 6:13887212-13887234 TATGTGCCAGGTACTGTCCTAGG - Intergenic
1004268279 6:14169176-14169198 TATATGCAAAGTTCTGTTCTAGG - Intergenic
1004287158 6:14331946-14331968 TATGTACCAGGCATTGTTCTAGG - Intergenic
1004326434 6:14677764-14677786 AAAATGCCAGGTACTGTTCTAGG - Intergenic
1004505648 6:16244698-16244720 TAAGTGCCAAGTGTTGTTCCTGG + Intronic
1004548743 6:16626116-16626138 TATGTGTCAGGCGTTGTACTAGG - Intronic
1004623374 6:17351359-17351381 TATATGTCAGGTGCTATTCTAGG + Intergenic
1004985616 6:21078926-21078948 TCTATGCCAGGTATTGTGCTAGG - Intronic
1005130509 6:22502096-22502118 TTTGTGCCAGGCCTTGTTCTAGG + Intergenic
1005652949 6:27901632-27901654 GATGTGCCAGGACTTGTTCTAGG + Intergenic
1005883673 6:30078562-30078584 TGTGTGCCAGGTGCTATTCTAGG - Intergenic
1005884596 6:30087068-30087090 TATGTACCATGCGTTGTTCTAGG + Intergenic
1006305774 6:33217608-33217630 CATGTGTCAGGAGTTGTTCTGGG + Intergenic
1006529582 6:34639917-34639939 TATTTGCCAGGTATTATTTTGGG - Intronic
1006564947 6:34947775-34947797 TTTTAGCCAGGTGTTTTTCTAGG + Intronic
1006640872 6:35489170-35489192 CATATGCCAGGCACTGTTCTGGG + Intronic
1006923236 6:37639789-37639811 TATATGCCAGGCACTGTTCTAGG - Intronic
1006958806 6:37904799-37904821 TATGTGCCAGGCACTGTTCTAGG - Intronic
1007013336 6:38438687-38438709 TATGTACCAGGTATAGTTCTAGG + Intronic
1007029558 6:38615766-38615788 TCTATGCCAGGTACTTTTCTAGG - Intronic
1007111530 6:39315813-39315835 TATGTGCCAGGTGCTGTGCCAGG - Intronic
1007138001 6:39541551-39541573 TAGATGCCAGGCCCTGTTCTAGG + Intronic
1007324874 6:41052351-41052373 TCTATGCCAGGTGCTGTTTCAGG - Intronic
1007560640 6:42805599-42805621 TATGTGCCAGGGGCTATTCTGGG + Intronic
1007598354 6:43065895-43065917 TATGTGCCAGGTACTGTGCTAGG + Intronic
1007746679 6:44047487-44047509 TCTGTGCCAGGTGCTGTGCTTGG - Intergenic
1007958403 6:45937623-45937645 TATGTGCCAGGTACTGTGCTAGG - Intronic
1007960016 6:45950198-45950220 TATATGCCAGGCATGGTTCTGGG - Intronic
1007971700 6:46058171-46058193 TATATGCCAGATTTTCTGCTAGG - Intronic
1008153314 6:47982814-47982836 TATCTGCTAGGTGTTGTGCTAGG - Intronic
1008720670 6:54346989-54347011 TATATGCAAGATACTGTTCTAGG + Intronic
1008772380 6:54994237-54994259 TATATGTTAGGTTTTGCTCTTGG - Intergenic
1008794682 6:55288526-55288548 TATGTGCCAGGCATTGTTCTAGG - Intergenic
1008810885 6:55497467-55497489 TTTATGGCAGGTGCTGTGCTAGG + Intronic
1008868952 6:56248601-56248623 TATATTCCAGGTATTGTTCTAGG - Intronic
1008998188 6:57683153-57683175 TCTCTGCCAGGTTTTGTTATCGG - Intergenic
1009186686 6:60582517-60582539 TCTCTGCCAGGTTTTGTTATCGG - Intergenic
1009226277 6:61022979-61023001 TAATTCCCAGGTGTTCTTCTAGG - Intergenic
1009284802 6:61803491-61803513 TATATGCCAGGAATTGTTCATGG + Intronic
1009337476 6:62510199-62510221 TATGTGCCAGGCTTAGTTCTAGG + Intergenic
1009991778 6:70852196-70852218 TATATGCCAGGCACTGTTCTGGG - Intronic
1010009647 6:71035743-71035765 TATATGTCAGGTGCTGTGCTAGG + Intergenic
1010012049 6:71059379-71059401 TATATGCCAGGCATTGTGCTAGG - Intergenic
1010042055 6:71396570-71396592 TATCTGCCAGGAACTGTTCTAGG - Intergenic
1010087052 6:71932959-71932981 TATGTGCAAGGTGCTGTTCTAGG + Intronic
1010171203 6:72977894-72977916 TATGTGCCAGGCAGTGTTCTAGG - Intronic
1010182722 6:73106608-73106630 AATATGACTGGTGTTCTTCTAGG - Intronic
1010358913 6:74969541-74969563 TATATGCTATTTGGTGTTCTTGG - Intergenic
1010410258 6:75553315-75553337 TATATGCAAGGTATTGTCTTAGG - Intergenic
1010531268 6:76970254-76970276 TATATCCTAGGTTTTCTTCTAGG - Intergenic
1010622386 6:78092162-78092184 TATGTGCCAGGTACTTTTCTAGG + Intergenic
1010720368 6:79276630-79276652 TGCATGCCAGGCATTGTTCTGGG + Intergenic
1010952994 6:82058933-82058955 TATATGCCAGGAACTGTTCTAGG + Intergenic
1010985582 6:82420218-82420240 CATATGCCAGACATTGTTCTAGG + Intergenic
1011062000 6:83280850-83280872 CATATGGCAGGTTTTGTTCTAGG - Intronic
1011463442 6:87630492-87630514 TATGTGCCCGGTGTTAATCTAGG + Intronic
1011508827 6:88077868-88077890 TATGTACCAGGTGCTGTGCTAGG - Intergenic
1011587602 6:88943517-88943539 TATGTACCAGGCATTGTTCTAGG + Intronic
1011592865 6:88987271-88987293 TATGTTCCAGGTATTGTTCTAGG - Intergenic
1011689996 6:89858371-89858393 TATATGTCATGGGTTCTTCTAGG + Intronic
1011791495 6:90903779-90903801 TATGTGCCAGGCACTGTTCTAGG + Intergenic
1011843743 6:91535184-91535206 TATATGGCAGGCACTGTTCTAGG + Intergenic
1011909622 6:92420518-92420540 AATATGCTAAGTGTTGTTCCTGG - Intergenic
1011985279 6:93435950-93435972 TATGTCCCAGGTTTTCTTCTAGG - Intergenic
1012250129 6:96970618-96970640 CCTGTGCCAGGTGTTGTGCTGGG - Intronic
1012408202 6:98924972-98924994 AATGTGCTAGGTGTTGTTCTAGG - Intronic
1012414817 6:99001843-99001865 TATGTGCCAGGCATTGTGCTAGG + Intergenic
1012541343 6:100365870-100365892 TATGTGCCAGATGTTGTTCTAGG + Intergenic
1012786080 6:103627817-103627839 TATGTGCCAGGATTTATTCTAGG + Intergenic
1013185936 6:107758117-107758139 TATGTGCCAGGAACTGTTCTAGG + Intronic
1013197132 6:107854589-107854611 TATATGTAAGGTGTATTTCTGGG + Intergenic
1013260566 6:108437263-108437285 TTTATGCCAGGTCTTATTATGGG + Intronic
1013459643 6:110362949-110362971 TACATGCCAGATACTGTTCTAGG - Intergenic
1013588054 6:111596944-111596966 TATGTGCCAGGTGCAGTTCTAGG - Intronic
1013620672 6:111885498-111885520 TATATGGGAGGCATTGTTCTAGG + Intergenic
1013658209 6:112267368-112267390 TATGTGCCAGGCATTATTCTGGG - Intergenic
1013926111 6:115474744-115474766 TAAATGGAAGGTGTTTTTCTAGG - Intergenic
1013976654 6:116086814-116086836 TATGTGCCAGGTTGTGTGCTAGG + Intergenic
1014007830 6:116441847-116441869 TATATGCCAAGTATTGTTTTAGG + Intergenic
1014090806 6:117401684-117401706 TATATACCAGACATTGTTCTAGG - Intronic
1014090967 6:117402985-117403007 TATGTGCCAGGTAGTATTCTAGG - Intronic
1014182155 6:118396903-118396925 CATGTGCCAGGTGCTGTTTTAGG - Intergenic
1014184400 6:118418807-118418829 TATGTGCCAGGCACTGTTCTAGG - Intergenic
1014602636 6:123433472-123433494 TATATGCCAAGCTTTGTACTAGG - Intronic
1014664552 6:124220798-124220820 TATATCCCAGGAATTATTCTAGG - Intronic
1014727752 6:124993322-124993344 TATCTGCCAGTTATTGTTCTAGG - Intronic
1015684230 6:135841553-135841575 TACATGCCAGGTACTGTGCTAGG + Intergenic
1015819227 6:137242875-137242897 TATATACCAGGTACTATTCTAGG - Intergenic
1015897765 6:138033750-138033772 CATATACCAGGTATTGTTCTAGG - Intergenic
1016010061 6:139130172-139130194 TATATGCCAGGCCCTGTTTTAGG + Intergenic
1016234768 6:141850798-141850820 TATATACCAGGGTTTGTTCTTGG + Intergenic
1016387530 6:143542975-143542997 TATGTGCCAGGTACTGTTCCAGG + Intronic
1016721935 6:147308492-147308514 TATATGGCAGGTACTGTTCCAGG + Intronic
1016825060 6:148380948-148380970 TATATTCCGAGTGTTGTGCTAGG - Intronic
1016929944 6:149395164-149395186 TATGTGTCAGATGTTGTTGTAGG - Intronic
1017209645 6:151840897-151840919 TACATGCCAGGTACTGTGCTGGG + Intronic
1017557368 6:155585933-155585955 TATATGAGAGGTGTTTTTATTGG + Intergenic
1017741804 6:157413132-157413154 TGTATGCCAGGCACTGTTCTTGG - Intronic
1017869069 6:158470803-158470825 TGTATGCCAAGCATTGTTCTAGG + Intronic
1017877898 6:158538626-158538648 TATGTTCCTGCTGTTGTTCTAGG + Intronic
1017940039 6:159044578-159044600 TATATGCCAGCTGTCGTAGTAGG + Intronic
1018152781 6:160955917-160955939 TTTCTGCCAGGCGCTGTTCTAGG + Intergenic
1018314221 6:162541126-162541148 TAGGTGCCAGAGGTTGTTCTGGG + Intronic
1018326272 6:162673266-162673288 TCTGTGGCAGGTGCTGTTCTGGG - Intronic
1018342343 6:162864401-162864423 TATGTGCCAGGCCTTATTCTAGG + Intronic
1018356326 6:163021334-163021356 TAGAAGCCAGGAGTTGTCCTTGG + Intronic
1018722933 6:166587510-166587532 TCTATGCCAGGTACTGTTCTGGG - Intronic
1018809803 6:167290017-167290039 TATATATCGGGTGCTGTTCTAGG + Intronic
1019837813 7:3407726-3407748 TATGTGTCAGGTACTGTTCTAGG + Intronic
1020234102 7:6342100-6342122 CAGGTGCCAGGTGCTGTTCTAGG + Intronic
1020263592 7:6545698-6545720 TATGTGCCAGGCGCTGTGCTTGG - Intronic
1020383853 7:7576245-7576267 TATATGCCAGGAGTTATCCTAGG + Intronic
1020490701 7:8780403-8780425 TATATGCCAGGCATTGTTACAGG + Intergenic
1020673413 7:11148675-11148697 TATGTGTCAGGTTCTGTTCTAGG - Intronic
1020694492 7:11396796-11396818 TATCTGCCAGGTTTTGGTATCGG - Intronic
1020967949 7:14896306-14896328 TGCATGCCAGATGTTCTTCTGGG + Intronic
1021216186 7:17918180-17918202 TATTTCCTAGGTTTTGTTCTAGG - Intronic
1021546570 7:21820203-21820225 TATATGCCAGGTACTATACTGGG + Intronic
1021576855 7:22112891-22112913 TGTATGCCAGGTACTATTCTAGG - Intergenic
1021623340 7:22569273-22569295 TATATCCCAGGTACTGTACTAGG - Intronic
1021653340 7:22852612-22852634 TCTATGCCAGGTGCTGTGATTGG - Intergenic
1021803299 7:24329674-24329696 TATGTGCCAGGAGCTGTTCCAGG - Intergenic
1021812663 7:24418339-24418361 TATGTGCCAGGTGCTGTCCTGGG + Intergenic
1021863109 7:24926840-24926862 CATATGACAGGTGTTTTGCTAGG - Intronic
1022031050 7:26492253-26492275 TATGTGCCAGGGATTGTTCTAGG + Intergenic
1022109756 7:27220986-27221008 TATATGACAGGTGCTGTGCTAGG + Intergenic
1022191011 7:28016839-28016861 TATGTGCCAGGTACTGTTCTAGG + Intronic
1022299593 7:29090595-29090617 TATGTGCCAGCTGCTGTTCTTGG - Intronic
1022567503 7:31417804-31417826 TATGTGCCAGGTCCTGTCCTAGG - Intergenic
1022711415 7:32854414-32854436 CATATGCCACGTGTTCCTCTGGG - Intergenic
1022767330 7:33428264-33428286 TTTTTGACAGGTGTGGTTCTAGG + Intronic
1022809027 7:33850668-33850690 TATGTGCCAAGTGCTGTGCTAGG - Intergenic
1022813269 7:33889713-33889735 TATATGCTAGGTACTGTTTTAGG - Intergenic
1022913242 7:34920547-34920569 CATATGCCACGTGTTCCTCTGGG + Intergenic
1023046064 7:36211194-36211216 AATGTGCCAGGTATAGTTCTGGG - Intronic
1023072970 7:36455945-36455967 TATGTGCCAGGCGTTATTCTTGG + Intergenic
1023474371 7:40561507-40561529 TATGTGCCAGGCATTGTGCTTGG + Intronic
1023585166 7:41722205-41722227 TATGTGCCAGATGCTCTTCTAGG - Intergenic
1023680850 7:42685738-42685760 TCTATGCCAGGTATTGTGATGGG + Intergenic
1023954500 7:44873422-44873444 TATATTCCAGGTATTGTACTAGG - Intergenic
1024359895 7:48457039-48457061 TATATGCTAGCTACTGTTCTAGG + Intronic
1024692520 7:51818616-51818638 GATATGTCAGGAATTGTTCTTGG + Intergenic
1024868013 7:53925978-53926000 TGCATGCCAGGTCCTGTTCTGGG - Intergenic
1024943051 7:54782135-54782157 TATATTCCAGGTATTGTATTAGG + Intergenic
1025072893 7:55916579-55916601 TATATGCCAGGCATGGTGCTTGG - Intronic
1025244074 7:57303005-57303027 TATGTGCCAGGCAGTGTTCTAGG + Intergenic
1025868616 7:65409301-65409323 TTTATGCCAGGGTTTTTTCTGGG - Intergenic
1026305470 7:69136538-69136560 AATTTGCCAGGTGTGGTTGTGGG + Intergenic
1026362977 7:69619726-69619748 TCTATGCCAGGTTCTGTTCTAGG + Intronic
1026394958 7:69942243-69942265 AATATGTCAGGTATTGATCTAGG - Intronic
1026408649 7:70095555-70095577 TGTATGCCAGGTATTATGCTAGG + Intronic
1026557101 7:71418028-71418050 CATATCCCTGGTGCTGTTCTAGG + Intronic
1026569589 7:71517701-71517723 TCTTTGCCAGGGGCTGTTCTAGG + Intronic
1026640982 7:72125373-72125395 TATGTGCCAGGCACTGTTCTAGG + Intronic
1027200085 7:76058521-76058543 TATATACCATGTGTTTTCCTAGG + Intronic
1027579407 7:79975588-79975610 TATATGCCAGGCACTGTTGTAGG + Intergenic
1027672923 7:81124507-81124529 TATTTCCCAGGTTTTTTTCTAGG + Intergenic
1027745370 7:82066928-82066950 TATAAGACAGCTGTTTTTCTTGG + Intronic
1027848687 7:83420869-83420891 TATATCCTAGGTTTTCTTCTAGG - Intronic
1028169283 7:87576543-87576565 TATTTGCTGGGTCTTGTTCTTGG - Intronic
1028342849 7:89744458-89744480 TATTTGCAAGGTGTTGTGCTAGG - Intergenic
1028596267 7:92548565-92548587 TATCAGCCAGGCATTGTTCTAGG + Intergenic
1028704139 7:93818033-93818055 TCTATGCCAGTCGTTGTCCTAGG - Intronic
1028940687 7:96519285-96519307 TATCTGCCAGGCGTTGCTTTAGG + Intronic
1028993899 7:97078478-97078500 TCTGTGCCAGGCGTGGTTCTAGG - Intergenic
1029190192 7:98766460-98766482 TATGTGCCAGGACCTGTTCTAGG - Intergenic
1029468213 7:100739351-100739373 AATATGCCAGGTGCTGTCCTAGG + Intronic
1029999991 7:105049508-105049530 TATATGCCAGCTACTGTTTTGGG + Intronic
1030023261 7:105296751-105296773 TATGTGCCAGGTACTGTTGTGGG + Intronic
1030190209 7:106803190-106803212 TATGTGCCAGGTACTATTCTGGG + Intergenic
1030322513 7:108183878-108183900 TATATGCTAGGCACTGTTCTAGG + Intronic
1030333420 7:108297579-108297601 TACATGCCAGGCAGTGTTCTTGG + Intronic
1030548768 7:110932208-110932230 TATGTAACTGGTGTTGTTCTAGG - Intronic
1030569389 7:111203258-111203280 TATATACCAGGTGCTGATCTTGG + Intronic
1030729623 7:112971213-112971235 TATGAGCCAGGTACTGTTCTAGG + Intergenic
1030840327 7:114344066-114344088 TATATACAAGGTAATGTTCTAGG - Intronic
1031209555 7:118805191-118805213 TCTATGCCAGGCACTGTTCTAGG + Intergenic
1031257627 7:119475926-119475948 TACATGCCAGGTACTGTTCTCGG - Intergenic
1031319982 7:120312646-120312668 TTTTTCCCAGGTGTTGTTCACGG + Intronic
1031572836 7:123380364-123380386 TATATGGCAGGTTCTGCTCTGGG + Intergenic
1031839020 7:126714352-126714374 TTTGTGCCAGATGTTGTGCTTGG + Intronic
1031930693 7:127682816-127682838 TATGTGCCAGGCATTGTTCTAGG - Intronic
1032102203 7:128990462-128990484 TATGTGCCAGGCACTGTTCTAGG - Intronic
1032102429 7:128993654-128993676 TATATGCCAGGCAGTGTGCTAGG + Intronic
1032131187 7:129229364-129229386 TATGTGCCAGGAGTTGTCATAGG + Intronic
1032326901 7:130937286-130937308 TCTATGCCAGGCACTGTTCTAGG - Intergenic
1032876189 7:136040884-136040906 AATATGCCAGTTGTCTTTCTGGG + Intergenic
1032879292 7:136072042-136072064 TAGATGCCAGGCATTGCTCTGGG + Intergenic
1033023451 7:137750429-137750451 TATGTGCCAGGCTTTGTTCTAGG - Intronic
1033269726 7:139919954-139919976 TGTGTGCCAGGTGCTGTACTGGG - Intronic
1033273365 7:139952316-139952338 TATGAGCCAGGCGCTGTTCTAGG + Intronic
1033389549 7:140913332-140913354 TATATGCCAGGTAGTGATCTAGG - Intronic
1033454731 7:141492485-141492507 TATGTGCCAGGCATTGTGCTAGG - Intergenic
1033718148 7:144024609-144024631 TATATCCCAGGTGCTATGCTAGG - Intergenic
1033834199 7:145288833-145288855 TATATGGCTGGTCTTGTTCTGGG - Intergenic
1034204409 7:149303051-149303073 TATGTGCCAGGCATTATTCTAGG - Intergenic
1034434388 7:151056257-151056279 TGTGTGCCAGGTGCTTTTCTAGG - Intronic
1034933384 7:155182113-155182135 TATTTGCCAGATGTCCTTCTGGG - Intergenic
1035060580 7:156066436-156066458 TGTATGCCAGATGGTATTCTGGG + Intergenic
1036219311 8:6908028-6908050 TGTATGCCAGGTTCTGTGCTAGG + Intergenic
1036493103 8:9245938-9245960 TATGTGCCAGATGCTATTCTGGG + Intergenic
1036566101 8:9939353-9939375 TATGTACCAGGCATTGTTCTAGG + Intergenic
1036733968 8:11291286-11291308 TATATGCTAGGTGCTGTACTAGG + Intronic
1036910000 8:12749937-12749959 TATATACCAGGCATTGTTTTAGG - Intronic
1037216664 8:16462555-16462577 TATGTGTCAGATGCTGTTCTAGG - Intronic
1037422285 8:18715860-18715882 TATGTGACAGGCATTGTTCTAGG + Intronic
1037652602 8:20852640-20852662 TCTGTGCCAGGTGATTTTCTAGG - Intergenic
1037708583 8:21336565-21336587 TACATGCCAGGCACTGTTCTAGG - Intergenic
1038013719 8:23495659-23495681 TATGTGCCAGGTACTGTTCCAGG + Intergenic
1038151771 8:24947968-24947990 TAAATGCCAGATGCTGTTCAAGG - Intergenic
1038429437 8:27487937-27487959 TATGTGCCAGGCACTGTTCTAGG - Intergenic
1038625021 8:29183680-29183702 TATGTGCCAGGACTTGTGCTAGG - Intronic
1038919815 8:32070157-32070179 TATATGCCAGATACTGTCCTGGG + Intronic
1039028431 8:33283449-33283471 TATGTGCCAGGCACTGTTCTTGG - Intergenic
1039165368 8:34673467-34673489 TATGTGCTAGGCATTGTTCTAGG + Intergenic
1039406232 8:37315035-37315057 AATTAGCCAGGTGTTGTTGTGGG + Intergenic
1039471890 8:37818644-37818666 TATGTGCCAGGCTCTGTTCTAGG + Intronic
1039509328 8:38078282-38078304 TATGTGCCAGGCATGGTTCTAGG + Intergenic
1039533593 8:38287066-38287088 TATGTGGCAGGTATTATTCTTGG - Intronic
1039993382 8:42509211-42509233 TACATACCAGGTACTGTTCTTGG - Intronic
1040356604 8:46624574-46624596 TATGTGCCAGGCATTGTGCTTGG - Intergenic
1040481198 8:47829011-47829033 TATATGCCAGGAACTGTTGTTGG - Intronic
1040618983 8:49068149-49068171 TATCTGTCAGGTTTTGTGCTGGG + Intronic
1040930882 8:52733912-52733934 TGTATGCCAGGTGTTGTTTTTGG - Intronic
1041121777 8:54593164-54593186 TATTTGCCAGTTGCTTTTCTGGG - Intergenic
1041137686 8:54778104-54778126 TATGTGCCAAGTGTTGTATTAGG + Intergenic
1041340867 8:56844117-56844139 TATGTGCCAGATGTTGTGCTGGG - Intergenic
1041370392 8:57153528-57153550 TATGTGCCAGGTCCTGTACTAGG - Intergenic
1041493065 8:58455871-58455893 TATATGTAAGATATTGTTCTGGG - Intergenic
1041512439 8:58666785-58666807 TGTATGCCAGGAAATGTTCTAGG + Intergenic
1041528576 8:58836872-58836894 TATGTGCCAGGCACTGTTCTGGG - Intronic
1041576889 8:59407854-59407876 TCTATGCCAGGTGCTGTGTTTGG - Intergenic
1041664682 8:60430904-60430926 TATGTTCCAGGCCTTGTTCTAGG - Intergenic
1042353409 8:67800793-67800815 TAGATGCCAGGCACTGTTCTAGG + Intergenic
1042379762 8:68100300-68100322 TATGTGCCAAGTACTGTTCTAGG + Intronic
1042406920 8:68416425-68416447 TATATGCCAGTTTCTGTTCCAGG - Intronic
1042676461 8:71327212-71327234 TATATGCCAAGCAATGTTCTAGG - Intronic
1042684128 8:71418688-71418710 TATATGCTAGGCATTGTTCTAGG + Intronic
1042777676 8:72451921-72451943 TATATGCCAGATCCTGTTCTAGG - Intergenic
1042813914 8:72857115-72857137 TATATGCCAGACCTTGTGCTAGG + Intronic
1042849078 8:73197936-73197958 TAGGTGCCAGGCATTGTTCTAGG - Intergenic
1043060465 8:75494917-75494939 TATAAGCAAGGTGATGTTTTTGG + Intronic
1043348111 8:79324048-79324070 TATATGCCAGCTATTATTCTAGG + Intergenic
1043388739 8:79770924-79770946 TATGTGCCATGTGCTGTGCTAGG + Intergenic
1043503364 8:80877717-80877739 CAAGTGCCAGGTCTTGTTCTTGG + Intergenic
1043685299 8:83077369-83077391 TATATGTCAGGAATTATTCTTGG + Intergenic
1043768778 8:84170307-84170329 TATTTCCTAGGTTTTGTTCTAGG + Intergenic
1043837153 8:85061064-85061086 TACATGCCAGGAACTGTTCTAGG + Intergenic
1044701275 8:94967453-94967475 TGTGTGCCAGGTTTTTTTCTAGG + Intronic
1044721701 8:95156792-95156814 TATGTGCCAGGCATTGTTCTAGG + Intergenic
1044784436 8:95779657-95779679 TATATGTCAGGTGCTTTGCTAGG + Intergenic
1044830526 8:96243350-96243372 TTAGTGCCAGGTGTAGTTCTAGG + Intronic
1045206803 8:100050862-100050884 TATGTGCCAGGCACTGTTCTAGG + Intronic
1045213459 8:100123196-100123218 ATTATGCCAGGCTTTGTTCTAGG - Intronic
1045572756 8:103386529-103386551 TATTTCCCAGGTTTTCTTCTAGG - Intergenic
1045619265 8:103955266-103955288 TCTCTGCCAGGTTTTGTTATCGG - Intronic
1045828776 8:106432804-106432826 TTTATGTCAGTTATTGTTCTAGG - Intronic
1045878631 8:107012434-107012456 TAGATGCCAGACATTGTTCTAGG + Intergenic
1046088017 8:109463112-109463134 TATATGCCATGCATTGTTCCAGG - Intronic
1046109572 8:109706090-109706112 TATATGCAGGGAATTGTTCTAGG - Intergenic
1046251793 8:111642475-111642497 TATATGCCAGGCATTGCTCTAGG + Intergenic
1046331643 8:112723902-112723924 TCTAAGCCATGTATTGTTCTAGG + Intronic
1046715331 8:117560755-117560777 TACCGGCCAAGTGTTGTTCTAGG - Intergenic
1046791287 8:118324899-118324921 CATGTGCCAGGTACTGTTCTAGG - Intronic
1046812162 8:118544870-118544892 TATGTGCCAGGCATTGTGCTAGG + Intronic
1046847444 8:118933865-118933887 TATGTGCCAGACTTTGTTCTGGG + Intronic
1046884566 8:119351108-119351130 TATATGCTTGGTGGTGTTTTAGG - Intergenic
1046963239 8:120132150-120132172 TATTTGCTAGGTTTTCTTCTAGG + Intronic
1047015960 8:120723803-120723825 TATGTGCTAGGTATTGTCCTGGG - Intronic
1047095150 8:121616983-121617005 TCTGTGCCAGGTGTTGTTGTTGG - Intronic
1047110396 8:121782847-121782869 TATATGTCAGGCATTGATCTAGG - Intergenic
1047121095 8:121906350-121906372 TATATGGCAGGTACTGTTTTAGG + Intergenic
1047163777 8:122413019-122413041 TATGTGCCAGGTACTGTCCTTGG + Intergenic
1047183607 8:122612619-122612641 TCTATGCCAGGTATTATTCTGGG + Intergenic
1047192189 8:122688152-122688174 TATTTGCCAGATATTGTTCTAGG - Intergenic
1047212735 8:122853248-122853270 TATGTGCCAGGAATTTTTCTGGG + Intronic
1047269629 8:123343490-123343512 TTTCTCCCAGGTGTGGTTCTAGG - Intronic
1047277603 8:123417351-123417373 TATATGCCACGCGTTGTTCTGGG + Intronic
1047307937 8:123668382-123668404 TATGTGCCAGGCATTGTTCTAGG + Intergenic
1047483474 8:125306937-125306959 TATATGCCATGTACAGTTCTAGG - Intronic
1047582018 8:126226172-126226194 TATGTGCCAGGCATAGTTCTAGG + Intergenic
1047813195 8:128432873-128432895 TATTTCCTAGGTGTTTTTCTAGG - Intergenic
1047953116 8:129951918-129951940 TATATGCCAGACATTGTTCTAGG - Intronic
1047969968 8:130076222-130076244 TACATGCCAGGTGCTGCTCTAGG + Intronic
1048031426 8:130636723-130636745 TATGTGCCAGGCCCTGTTCTTGG - Intergenic
1048065056 8:130958964-130958986 TATAAACCAGGTGTTATTCTAGG - Intronic
1048095179 8:131284350-131284372 TATTTACCAGATGTTGTTCCAGG + Intergenic
1048308724 8:133301724-133301746 TATATGCCAGGGACTGTTCTAGG - Intronic
1048379348 8:133850885-133850907 TCTATGCCGGGTGGCGTTCTAGG - Intergenic
1048394894 8:134004612-134004634 TTTGTGCCAAGTGTTTTTCTAGG - Intergenic
1048615075 8:136065274-136065296 TATTTCCCAGGTTTTCTTCTAGG - Intergenic
1048636104 8:136297059-136297081 TTTATGTCAGGCATTGTTCTAGG - Intergenic
1048749741 8:137658752-137658774 TCTGTGCCAGGTGCTGTTCATGG - Intergenic
1048774743 8:137933263-137933285 TGTATGCTAGGCATTGTTCTAGG - Intergenic
1048883443 8:138888850-138888872 TACATGCTAGGAGCTGTTCTAGG - Intronic
1049045298 8:140146060-140146082 TATATTCCAGGTATTTTACTAGG - Intronic
1049214112 8:141399789-141399811 TACCTGCCAGGTTGTGTTCTTGG + Intronic
1050050767 9:1599125-1599147 TGTATGCCAGGCATTGTACTAGG - Intergenic
1050120270 9:2300461-2300483 TATATGCCAGGGGTTATGCTAGG - Intergenic
1050267189 9:3903615-3903637 CATATGCCAGGCACTGTTCTAGG + Intronic
1050284428 9:4086464-4086486 TATGTGCCAGGTGCTGTGTTAGG - Intronic
1050413335 9:5388865-5388887 TATGTGCCAGATGCTGTTGTAGG - Intronic
1050518161 9:6467520-6467542 TGTGTGCCAGGCCTTGTTCTAGG + Intronic
1050643549 9:7694194-7694216 AATATACCAGGTATAGTTCTGGG + Intergenic
1051256236 9:15216755-15216777 TATGTGCCAGGTACTCTTCTAGG + Intronic
1051340384 9:16104776-16104798 TATATGCCAGGCATTGGGCTAGG + Intergenic
1051374689 9:16391153-16391175 TGCATGCCAGGCATTGTTCTAGG - Intergenic
1051575659 9:18612466-18612488 TGTATGCCAGGCACTGTTCTAGG + Intronic
1051634751 9:19171505-19171527 TATATGCCAGGTGCTATTTTAGG - Intergenic
1051681955 9:19616643-19616665 TATGTACCAGGTATTCTTCTAGG + Intronic
1051685440 9:19653715-19653737 TATATGCCAGGCATTGTGCCAGG - Intronic
1051866311 9:21687138-21687160 TATATGCCAGCCTCTGTTCTAGG + Intergenic
1051916342 9:22212524-22212546 TATATGCCAGACGCTGTACTAGG + Intergenic
1052031187 9:23630718-23630740 TGTAAGCCAGGTATTGTTCTAGG + Intergenic
1052405962 9:28061173-28061195 TAGATGCCAGGTTCTGTGCTAGG - Intronic
1052458868 9:28736907-28736929 GATGTTCCAGGTGTTATTCTAGG + Intergenic
1052683271 9:31721832-31721854 TATGTGCCAGGCATTGTACTAGG - Intergenic
1052717564 9:32135648-32135670 TATTTGCCTTGTGTTGTTTTAGG + Intergenic
1052847897 9:33353521-33353543 TAAGTGCCAAGTGTTGCTCTAGG + Intronic
1052900524 9:33790786-33790808 GATATTCCAGGAGTTCTTCTAGG - Intronic
1052981461 9:34452966-34452988 TCTCTGCTAGATGTTGTTCTGGG - Intronic
1052983009 9:34462515-34462537 TATATTCCAGGTATTGTGCTAGG - Intronic
1053091638 9:35283562-35283584 TACATTCCAGGTTTTGTTCTAGG + Intronic
1053272314 9:36758923-36758945 TATATGCCAAGTGTTGGGCCAGG - Intergenic
1053363473 9:37506054-37506076 TCTATGTCAGGTATTGTGCTAGG - Intergenic
1053463113 9:38285909-38285931 TATATGCCAGTCATTGTTCTAGG - Intergenic
1054883817 9:70174227-70174249 TATGTGCCAGGTACTGTTTTAGG + Intronic
1055075519 9:72211478-72211500 TATGTGCCAGGTACTGTGCTGGG - Intronic
1055186358 9:73460064-73460086 TAGAAGCCAGATGTTTTTCTGGG - Intergenic
1055494282 9:76839253-76839275 TCTGTGCCAGGTACTGTTCTAGG + Intronic
1055759035 9:79587121-79587143 TATATTCCAGGCATTGTTTTAGG - Intronic
1056259852 9:84837039-84837061 TCTGTGCCAGGAATTGTTCTGGG - Intronic
1057324992 9:94054036-94054058 TATGTGCCAGGTCCTGTTCTAGG + Intronic
1057325271 9:94057548-94057570 TAAAAGCCAGGTGTTGTGGTAGG + Intronic
1057960804 9:99454827-99454849 TGTGTGCCAGGCATTGTTCTAGG - Intergenic
1057987348 9:99730551-99730573 TATATGCCAGACACTGTTCTAGG - Intergenic
1058099060 9:100898410-100898432 AAAATGCCAGATGTTTTTCTTGG + Intergenic
1058137804 9:101326684-101326706 TCTGTGTCAGGTGATGTTCTTGG - Intergenic
1058419266 9:104819109-104819131 TATATGCCAGGCATTGTGCTAGG + Intronic
1058573700 9:106377043-106377065 TATGTGCCAGGTGTTGTACTAGG - Intergenic
1058586396 9:106511023-106511045 TATATGCCAGGTACTATTCTAGG - Intergenic
1058712678 9:107694448-107694470 TATATGCCAGGCTCTGTGCTAGG - Intergenic
1058805703 9:108589361-108589383 GATATGTCAGATGCTGTTCTGGG - Intergenic
1058946993 9:109866663-109866685 TCTGTGCCAGGTATTGTTCTAGG + Intronic
1058958525 9:109971173-109971195 TATGTGCCAGGCATGGTTCTAGG - Intronic
1058980351 9:110163267-110163289 TATGTGTCAGGCATTGTTCTAGG + Intronic
1058990415 9:110250249-110250271 TATATACCAGGCACTGTTCTGGG - Intronic
1059049936 9:110913151-110913173 TATATCCCAGATGGTTTTCTAGG - Intronic
1059311686 9:113392589-113392611 TATGTGCCAAGTACTGTTCTAGG + Intronic
1059613412 9:115923398-115923420 TATATGCCTGGCACTGTTCTAGG + Intergenic
1059713960 9:116896102-116896124 TATATTCCAGGTTCTGTGCTTGG - Intronic
1059719303 9:116944038-116944060 CATGTGCCAGGTACTGTTCTCGG + Intronic
1059726951 9:117018138-117018160 TATATGCCAGGCATACTTCTAGG - Intronic
1059938992 9:119339492-119339514 TATGTGCTAGGCATTGTTCTAGG - Intronic
1059959576 9:119551905-119551927 TATATACAAGGTGTACTTCTGGG - Intergenic
1059984284 9:119806832-119806854 TATGTACCAGGTGCTGTCCTAGG - Intergenic
1059990755 9:119862993-119863015 GATATGTCAGGTATTGTGCTGGG + Intergenic
1059999448 9:119944889-119944911 TATATGCCAGGGCCTGTACTAGG - Intergenic
1060038506 9:120279957-120279979 TATATCCCAGGAGCTGTACTAGG - Intergenic
1060130501 9:121093188-121093210 TATGGGCCAGGAGCTGTTCTAGG - Intronic
1060162302 9:121375477-121375499 TATGTGCCAGGCATTGTTCCAGG + Intergenic
1060510737 9:124230131-124230153 TGTGTGCCAGGCATTGTTCTAGG + Intergenic
1060622915 9:125083725-125083747 TATGTGCCAGGTATTTTTCCAGG + Intronic
1060948995 9:127588777-127588799 TATGTGCCAGGACCTGTTCTAGG - Intergenic
1061134820 9:128727688-128727710 CATGTGCCAGGTTTTGTGCTGGG + Intergenic
1061206809 9:129168971-129168993 TATATGCCAGGCACTGTGCTAGG - Intergenic
1061217327 9:129229312-129229334 TCTTTGCCAGGTGTGGTGCTGGG + Intergenic
1061346349 9:130029108-130029130 TATGTGCCAAGCATTGTTCTAGG - Intronic
1061552652 9:131346849-131346871 TATGTCCCAGGTACTGTTCTGGG - Intergenic
1061637270 9:131920462-131920484 TATGTGCCAGGCATTCTTCTAGG + Intronic
1061697257 9:132385951-132385973 TATATGCCAGGCATTTTTCTAGG - Intronic
1061704446 9:132442059-132442081 TATGTGCCAGGAGCTGATCTAGG + Intronic
1062658706 9:137617435-137617457 TGTACACCAGGTATTGTTCTAGG + Intronic
1185870606 X:3662049-3662071 TATGTGCCAAGTAATGTTCTCGG + Intronic
1186335436 X:8582027-8582049 TATGTGTCAGGTACTGTTCTAGG + Intronic
1186458304 X:9728197-9728219 TACATGCCAGGTGTTGTCTGGGG - Intronic
1186560148 X:10602858-10602880 TATATGCCAAGTGTTTCTCAAGG + Intronic
1186562711 X:10630108-10630130 TATGTGCCAGGCATTGTTCTAGG + Intronic
1186650503 X:11555197-11555219 TATATGCCATGCACTGTTCTAGG + Intronic
1186667051 X:11727944-11727966 TATTTCCCAGGTTTTCTTCTAGG + Intergenic
1187051407 X:15699833-15699855 TATATGCCAGCTACTCTTCTAGG + Intronic
1187123911 X:16435443-16435465 TATGTTCCAGGTAATGTTCTAGG + Intergenic
1187230465 X:17416707-17416729 TAGATGCCAGGTGCTATGCTGGG - Intronic
1187238739 X:17493524-17493546 TATATGCCAGGCACTGTGCTGGG - Intronic
1187325610 X:18284312-18284334 TATTTGCTAGGTTTTCTTCTAGG - Intronic
1187519155 X:19998590-19998612 TGTGTGGCAGGTGCTGTTCTCGG + Intergenic
1187543006 X:20216930-20216952 TATGGGCCAGGTATTGTACTAGG + Intronic
1187583579 X:20635694-20635716 TATGTGCCAGAAGCTGTTCTAGG + Intergenic
1187615133 X:20985111-20985133 TCTCTGCCAGGTTTTGTTATTGG - Intergenic
1187693045 X:21891396-21891418 TATGTGCCAGGCACTGTTCTAGG + Intergenic
1187781241 X:22828263-22828285 TTTATGCCAGGTATTGCTGTGGG + Intergenic
1187872198 X:23773943-23773965 TATATGTCAGGTATTATGCTGGG - Intergenic
1187967661 X:24628317-24628339 TATATGCCAGGTACTGCCCTGGG - Intronic
1187980269 X:24749199-24749221 TGCATGCCAGGCATTGTTCTAGG + Intronic
1188319486 X:28718162-28718184 TATATGCCTGGTATAGTTGTAGG + Intronic
1188350299 X:29121905-29121927 TATTTGCCAGGTGTTATGCTAGG + Intronic
1188560054 X:31457386-31457408 TATATGCCAGGGAATGTTCTAGG + Intronic
1188613698 X:32131306-32131328 TATATGCCAAATGTTTTTCTAGG - Intronic
1188627435 X:32303336-32303358 TAAGTGCTAGGTGCTGTTCTAGG + Intronic
1189046341 X:37595662-37595684 TAGATGTCAGGTATTGTACTAGG - Intronic
1189119112 X:38375077-38375099 TATTTGCCAGGTTTTATTCTAGG + Intronic
1189119439 X:38378619-38378641 TATGTGCCTGGTGCTGTTCTAGG - Intronic
1189125944 X:38446313-38446335 TATTTGCTAGGTTTTGTTCTAGG + Intronic
1189177663 X:38974192-38974214 TATATGCCAAGTATTATTCTTGG + Intergenic
1189297323 X:39928280-39928302 TCTGTGCCAGGCATTGTTCTAGG + Intergenic
1189406703 X:40731908-40731930 TGTGTGCCAGGCATTGTTCTAGG + Intronic
1190014373 X:46814093-46814115 TATGTGCCAAGTACTGTTCTGGG - Intergenic
1190216623 X:48483231-48483253 TGTATGTCAGGTGTTGTTCTAGG + Intronic
1190446992 X:50535788-50535810 TATATGCCAGGCACTGTGCTAGG + Intergenic
1190899711 X:54658510-54658532 TATTTCCCAGGTTTTCTTCTAGG + Intergenic
1191047130 X:56150484-56150506 TACATCCCAGGTGTTGTACCAGG - Intergenic
1191675875 X:63791984-63792006 TATATGCCAAGGTCTGTTCTAGG + Intergenic
1191906604 X:66098991-66099013 TATATGTAAGGTATTGTTCTGGG - Intergenic
1192083341 X:68069570-68069592 TGTATACCAGGAGTTGTTCTAGG + Intronic
1192083669 X:68072771-68072793 TATGTGCCAGGTACTGTGCTAGG - Intronic
1192179675 X:68908701-68908723 TATGTGCCAGGTGTTATGCTAGG + Intergenic
1192280871 X:69683302-69683324 TATATGCCAGGCACTGTTGTAGG - Intronic
1192315992 X:70052251-70052273 TATATGCCAGGCACTCTTCTGGG + Intergenic
1192608095 X:72540956-72540978 TATGTGCCAGGTAGAGTTCTAGG + Intronic
1192655478 X:72988886-72988908 CATGTGCCAGGTGCTCTTCTAGG + Intergenic
1192719667 X:73678857-73678879 TATATGACAGGTATTGTGCCAGG + Intronic
1192889442 X:75373437-75373459 TATATGCCAGATATTGTTTCAGG - Intronic
1192947036 X:75975256-75975278 TATTTTCCAGGTTTTCTTCTAGG - Intergenic
1192957649 X:76090337-76090359 TATTTGCTAGGTTTTCTTCTAGG + Intergenic
1193472225 X:81920456-81920478 TATATGCCAGTCACTGTTCTTGG - Intergenic
1193775027 X:85630865-85630887 TATGTGCCAGGCACTGTTCTAGG - Intergenic
1193844998 X:86457558-86457580 TACATGCTAGGTTTTGTTTTAGG + Intronic
1193913961 X:87342624-87342646 TCTTTGCCAGGTATTGTGCTAGG + Intergenic
1193997903 X:88389521-88389543 TATATCCTAGGTTTTCTTCTAGG - Intergenic
1194118473 X:89932588-89932610 TATTGTCCAGGTTTTGTTCTAGG + Intergenic
1194390925 X:93317032-93317054 TCTCTGCCAGGTTTTGTTATTGG + Intergenic
1194562746 X:95443320-95443342 TATAGGCCAGGTATTGTGCTTGG - Intergenic
1194581013 X:95670839-95670861 GATATTGCAGGTTTTGTTCTAGG + Intergenic
1194668469 X:96701844-96701866 AGTATTTCAGGTGTTGTTCTAGG + Intronic
1194673366 X:96764065-96764087 TATATGCCAAGAATTATTCTAGG + Intronic
1195002904 X:100659307-100659329 TTTATGCCAGGATTTTTTCTGGG + Intronic
1195270957 X:103230532-103230554 TATGTGCCTGGTGCTGTCCTAGG + Intergenic
1195427508 X:104751256-104751278 TATATGATAGGTGCTGTGCTAGG + Intronic
1195737863 X:108032380-108032402 TATGTGCCAGGCCCTGTTCTAGG + Intergenic
1196049282 X:111288273-111288295 TATGTGCCAGGTGCTGTGCTAGG - Intergenic
1196086329 X:111686428-111686450 TATGTGCCAGGCATTGTTCTAGG + Intronic
1196133184 X:112179663-112179685 TATGAGCCAGGTGCTATTCTAGG + Intergenic
1196230346 X:113214345-113214367 TATATGGCTTGTGTTTTTCTAGG + Intergenic
1196519672 X:116658623-116658645 TATATACCAGACATTGTTCTAGG - Intergenic
1196768191 X:119268711-119268733 TATATGTTAGGTACTGTTCTAGG - Intergenic
1196799980 X:119533689-119533711 TATATGCCAGATATTGCACTAGG - Intergenic
1197051668 X:122066421-122066443 TATTTCCCAGGTTTTCTTCTAGG - Intergenic
1197098905 X:122628176-122628198 TATTTGCCAGATCTTGTTTTAGG - Intergenic
1197130804 X:123003408-123003430 CATGTGCCAGGAGTAGTTCTAGG - Intergenic
1197152266 X:123233032-123233054 TCTATGCCAATTATTGTTCTCGG - Intronic
1197315171 X:124957115-124957137 TATGTACCAGGTACTGTTCTAGG - Intronic
1197333371 X:125181114-125181136 TATATGCCAGGCATTGTGCAAGG + Intergenic
1197709913 X:129658373-129658395 TATGTGCCAGGCATTGTGCTAGG - Intergenic
1197713022 X:129685790-129685812 TATATGCCAGGCACTGTGCTCGG - Intergenic
1197950465 X:131890503-131890525 TATGTGCCATGTGCTGTGCTAGG - Intergenic
1198016818 X:132619935-132619957 TGTATGCCAGGTGCTCTTCTTGG - Intergenic
1198086941 X:133290850-133290872 TATGTGCCAGGTATTGTGCTAGG - Intergenic
1198319801 X:135509299-135509321 TATATTCCAGGCATTTTTCTAGG - Intergenic
1198425490 X:136515725-136515747 TATGTGCCAGGCACTGTTCTAGG - Intergenic
1198483623 X:137064485-137064507 TATTTGCCAGGGACTGTTCTAGG + Intergenic
1198520440 X:137447024-137447046 TATATGCCAGGCATTGTGCTAGG + Intergenic
1198567694 X:137921689-137921711 TATATGCCAGGCTTTGTTAAAGG + Intergenic
1198681247 X:139184723-139184745 TATGTGCCAGGCAGTGTTCTAGG - Intronic
1198845861 X:140909773-140909795 TATATGACAGATGCTATTCTAGG + Intergenic
1198959513 X:142169467-142169489 TATATGTCAGGCATTGTTCCAGG - Intergenic
1199069884 X:143463540-143463562 TATGTGCCAACTGTAGTTCTAGG - Intergenic
1199403709 X:147430611-147430633 TATATGCAAGATGTTGTGTTTGG + Intergenic
1199427208 X:147716821-147716843 TATATGCAAGGTATTATCCTAGG - Intergenic
1199428389 X:147730349-147730371 TATGTGCCAGGAATTGTTCTAGG + Intergenic
1199456643 X:148036821-148036843 TATATTCCAGGCACTGTTCTGGG + Intergenic
1199470900 X:148194591-148194613 TATTTGCCAAGCATTGTTCTAGG - Intergenic
1199564612 X:149201406-149201428 TATATTCCTGTGGTTGTTCTTGG + Intergenic
1199799261 X:151233190-151233212 TATATGCCAGGTACTTCTCTAGG - Intergenic
1199840992 X:151648918-151648940 TGTATCCCAGATGTTGTTCAGGG + Intronic
1199931410 X:152526827-152526849 TATGTTCCAAGTGTTGTACTAGG - Intergenic
1200305681 X:155023985-155024007 TATATGCCAGGAACTGTTCTAGG + Intronic
1200471355 Y:3590154-3590176 TATTGTCCAGGTTTTGTTCTAGG + Intergenic
1201360966 Y:13148434-13148456 TAAATGCCAGGAGTTGTACCTGG + Intergenic
1201428113 Y:13876266-13876288 TATGTGTCAGGTACTGTTCTAGG - Intergenic
1201751390 Y:17435786-17435808 TATATGCAAGGCGTGGTTGTGGG + Intergenic
1201901480 Y:19048828-19048850 TATATAGCAGGTGCTGTTCCAGG + Intergenic
1202301350 Y:23418961-23418983 TATTTGCCAGATATTGTTCGAGG + Intergenic
1202569461 Y:26251637-26251659 TATTTGCCAGATATTGTTCGAGG - Intergenic