ID: 906931356

View in Genome Browser
Species Human (GRCh38)
Location 1:50172797-50172819
Sequence GAGAGAATCAAATGCATAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 313}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906931353_906931356 19 Left 906931353 1:50172755-50172777 CCACATCTATAAAATGATAATTA 0: 1
1: 9
2: 102
3: 795
4: 3767
Right 906931356 1:50172797-50172819 GAGAGAATCAAATGCATAGAAGG 0: 1
1: 0
2: 3
3: 33
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906931356 Original CRISPR GAGAGAATCAAATGCATAGA AGG Intronic
905804158 1:40863816-40863838 GAGAGTGTCAAATGCGTGGAGGG - Intergenic
905853553 1:41291668-41291690 AAGAGAAACAGATGCTTAGAAGG - Intergenic
906931356 1:50172797-50172819 GAGAGAATCAAATGCATAGAAGG + Intronic
907897034 1:58701769-58701791 GAGAGAAAGAATTGCAAAGAGGG + Intergenic
908674650 1:66590212-66590234 GGGACAAGCAAATGCATACATGG + Intronic
908942643 1:69454562-69454584 AAGAGAATCATATGGATAGAAGG + Intergenic
909999073 1:82320593-82320615 CAGAAAAACAAATGTATAGAGGG - Intergenic
910732074 1:90408591-90408613 GAGACATTCAAATGCAGGGAAGG + Intergenic
910922078 1:92359058-92359080 GAGAAAATCAATTCCATAAAAGG - Intronic
913566152 1:120074507-120074529 GAGATAATCACATTCATAAAAGG - Intergenic
913631978 1:120719046-120719068 GAGATAATCACATTCATAAAAGG + Intergenic
914286740 1:146233866-146233888 GAGATAATCACATTCATAAAAGG - Intergenic
914547771 1:148684607-148684629 GAGATAATCACATTCATAAAAGG - Intergenic
914618739 1:149385746-149385768 GAGATAATCACATTCATAAAAGG + Intergenic
914753478 1:150550525-150550547 GAGAGAAGCAGAGGCAGAGAGGG + Intronic
916681926 1:167112799-167112821 GTCAGAATTAAATTCATAGAAGG + Intronic
916858721 1:168779563-168779585 GATATACTCAAGTGCATAGAAGG - Intergenic
917063678 1:171068209-171068231 GGGAAAAACAAATCCATAGAAGG - Intergenic
917730292 1:177868304-177868326 CAGACAAAGAAATGCATAGAGGG + Intergenic
918223029 1:182453478-182453500 GAGAGAACCAGATGGAGAGAAGG + Intronic
918919286 1:190686740-190686762 GAGAGAAATAAAAGTATAGATGG - Intergenic
919554658 1:199035609-199035631 GAGAAAATCAAATGCCTACGTGG + Intergenic
920049972 1:203158002-203158024 AAGAGAATAATATGGATAGAAGG - Intronic
920508804 1:206535770-206535792 GAGAGATTCAGATGCACAGGTGG + Intronic
921495417 1:215834791-215834813 AAGAGAATCAAAGGAAAAGAGGG - Intronic
921750641 1:218789220-218789242 GAAAAAATGCAATGCATAGAGGG + Intergenic
922000267 1:221470233-221470255 GTGAGAATCAGGTACATAGAAGG + Intergenic
1064640929 10:17415275-17415297 GAGAGCAGCAAATGCAGAGAAGG + Intronic
1069493356 10:68880554-68880576 AACAGTATCAAATGCTTAGAAGG - Intronic
1070051172 10:72891290-72891312 GAGAGAATTTAATGTACAGAAGG - Intergenic
1070286069 10:75084846-75084868 GAGACAATCAAGAGCACAGAAGG - Intergenic
1071933257 10:90497524-90497546 GAGAGAAGCAAATACATAATTGG - Intergenic
1073787657 10:106908134-106908156 CAGGGATTCAAATCCATAGAGGG - Intronic
1073891324 10:108105621-108105643 GAGTGAATGAAATGCATTGTTGG + Intergenic
1074150959 10:110759511-110759533 GAGAGATCCCAATGCATATATGG - Intronic
1074721019 10:116265302-116265324 GCAAGAATCAAGTGGATAGATGG - Intronic
1074952859 10:118356806-118356828 GTGAGGATCAAATGCAGAGGCGG + Intergenic
1077986582 11:7357556-7357578 GAGAAAAACAAATGCATATATGG - Intronic
1078353259 11:10613096-10613118 GAGACAACATAATGCATAGATGG - Intronic
1078387025 11:10901531-10901553 GAGAGACTCAAATAGCTAGAAGG - Intergenic
1078907373 11:15700026-15700048 GAGAGAATTAAATGCACTAAAGG - Intergenic
1079515812 11:21267417-21267439 GAGAGAAAAAAATGCATATATGG - Intronic
1080067940 11:28041903-28041925 GAGGGAATGACATGCATAAATGG - Intronic
1080925722 11:36754031-36754053 GAGAGGATCAAATGAAGTGAAGG + Intergenic
1082068397 11:47919132-47919154 GAGAGAATCAAATGAAACAATGG + Intergenic
1082225977 11:49707301-49707323 GAGCAAATCAAATGCATAGAGGG + Intergenic
1085424265 11:76389682-76389704 GTGAGAATGAAATGCAAAGGAGG - Intronic
1085499802 11:77009459-77009481 GGGAGCATCAAATCCAAAGAAGG + Intronic
1085998287 11:81948964-81948986 GAGAGAAGGAAATTCAGAGAGGG + Intergenic
1086227785 11:84532858-84532880 GAGAGACTGAACTGCATTGAAGG - Intronic
1086576677 11:88346656-88346678 TAGAGGATCAAAGGGATAGATGG - Intergenic
1086623117 11:88912439-88912461 GAGCAAATCAAATGCATAGAGGG - Intronic
1088230386 11:107668291-107668313 GAGAAATTCAGCTGCATAGATGG + Intergenic
1088271547 11:108039665-108039687 TAGATAAGCAAATTCATAGATGG - Intronic
1088626883 11:111735958-111735980 AAGTGAAACAAATGCATGGAAGG + Intronic
1090645163 11:128761237-128761259 GAGAGAGTCATATGACTAGATGG - Intronic
1091665492 12:2415791-2415813 GAGAGAAGCAAAGACAGAGAGGG - Intronic
1091804427 12:3345867-3345889 GAGGGAAGCAAAGGCACAGAAGG - Intergenic
1092094188 12:5828059-5828081 GAGAAAAACAAATGAATAAAAGG + Intronic
1093720313 12:22434809-22434831 GAGAGAATCAAATAAACAGAGGG + Intronic
1093940307 12:25047012-25047034 GAAATAAACCAATGCATAGATGG + Intronic
1094375891 12:29786693-29786715 GAGAGAAGCAAATGGCTTGATGG - Intergenic
1095273399 12:40250012-40250034 AAGAGAATCATATGTACAGATGG + Intronic
1096432165 12:51555095-51555117 GTGAGAATCAAATGGCTATATGG - Intergenic
1096952886 12:55493548-55493570 GAGAAAATCAACTGGAAAGAAGG - Intergenic
1099935162 12:89116806-89116828 CAGAGAAAGAAAAGCATAGATGG + Intergenic
1100222745 12:92523688-92523710 CTGAGAATCAGATGCAAAGATGG - Intergenic
1100297751 12:93278483-93278505 TAGGGCATCATATGCATAGAAGG - Intergenic
1100604445 12:96140116-96140138 GAGAGAATCATATGGAGAGAAGG - Intergenic
1101115279 12:101525504-101525526 GAGAGACAGACATGCATAGAAGG - Intergenic
1101141761 12:101802550-101802572 GATAGAGTCAAAGGCATAGAAGG + Intronic
1107344473 13:39444388-39444410 AAGAGATTCATATGGATAGAAGG + Intronic
1107805623 13:44151311-44151333 CAGATAATCACATACATAGAAGG + Intronic
1108110656 13:47068371-47068393 AAGAGAATCAAGTGAAAAGATGG + Intergenic
1108744813 13:53382003-53382025 AAGAGAATCAAAAAAATAGAAGG - Intergenic
1109497568 13:63193514-63193536 GAAAGCATCAAAAGCATAGCTGG + Intergenic
1109722728 13:66296310-66296332 GAGAAAATTAAATGCAAAGCTGG + Intergenic
1109888836 13:68580437-68580459 GTAATATTCAAATGCATAGATGG + Intergenic
1110741059 13:78997609-78997631 TAGAGAAACTAAAGCATAGAGGG - Intergenic
1111084441 13:83356341-83356363 GAGACAAACAAATACATAAAAGG - Intergenic
1111525478 13:89462752-89462774 CAGAAAATCAAATCCGTAGATGG - Intergenic
1111719107 13:91918886-91918908 GAGAGAGGGAAATGCAGAGAAGG - Intronic
1111801412 13:92985991-92986013 AAGAGCATCAAATGCTTACAGGG + Intergenic
1113396901 13:109956223-109956245 GAGGGCATCAAATGGAGAGAGGG + Intergenic
1114369344 14:22068650-22068672 GAGAGTAACAAAAGCAAAGATGG - Intergenic
1114392229 14:22322426-22322448 GAGAGAAACAAATGAATAAATGG + Intergenic
1115020144 14:28669973-28669995 GAGAGAATAAAGTGAATAAAGGG + Intergenic
1115138137 14:30136159-30136181 GAGAGAATCAAATCCTTTTATGG - Intronic
1115806203 14:37054911-37054933 GTGAGAAAAAAATGCACAGAGGG + Intronic
1115915553 14:38309484-38309506 CACAAAATTAAATGCATAGAAGG - Intergenic
1116371694 14:44142853-44142875 GAGAGAAACAAATACATAGAAGG - Intergenic
1116460268 14:45164689-45164711 GAGAGAATCCAATACAAAGTGGG - Intronic
1116606733 14:47008252-47008274 GAGAAAAACAAAAGCATAAAGGG + Intronic
1116891823 14:50276285-50276307 GAGAATATGAAATGCATAGTAGG + Intronic
1118320736 14:64751660-64751682 GTGAGAATCAAATACACTGATGG - Intronic
1118623882 14:67639103-67639125 GAGAGACTGAATTTCATAGAAGG - Intronic
1120520589 14:85523356-85523378 GAGAGAATAAGATGCACAGTAGG + Intergenic
1120789044 14:88562792-88562814 GAGAGAATAAAATGAATAAGCGG + Intergenic
1120939803 14:89936611-89936633 AAGACAATTAAAGGCATAGAAGG - Intronic
1122005555 14:98700583-98700605 GAGGGAATGAAATGCAGAGATGG + Intergenic
1122316904 14:100831134-100831156 GTGAGGATCAAATGAATGGACGG - Intergenic
1122944432 14:104999785-104999807 GAGTGAATGCAGTGCATAGAAGG + Intronic
1125254168 15:37744142-37744164 GAGAGAATTAATTGAATTGATGG + Intergenic
1127298812 15:57632863-57632885 GAGAGAACCAAATGGAGGGAGGG - Intronic
1128171352 15:65516801-65516823 GAGAGATTCAATAGCACAGAGGG + Exonic
1128493747 15:68177950-68177972 GAGAGAAGGAAGTCCATAGATGG + Intronic
1128992927 15:72275399-72275421 GAGAGATTCAAATGTTTGGAGGG - Intronic
1131840526 15:96431784-96431806 CAGAGAGGTAAATGCATAGATGG - Intergenic
1134477041 16:14583316-14583338 CACAGAATCAAAAGCATAAATGG + Intronic
1135612885 16:23883732-23883754 GAGGGAAGCAAATGCACAGCTGG + Intronic
1135869749 16:26138354-26138376 GAGAAAAGCAAAAGCATAAAAGG - Intergenic
1137682917 16:50366917-50366939 TAAAAAATCAAATGCATATATGG + Intronic
1141128197 16:81416136-81416158 CAGAGACAGAAATGCATAGAAGG - Intergenic
1143786696 17:9260896-9260918 GAAAGAATCAACTGGAAAGAAGG + Intronic
1144124318 17:12188261-12188283 GAAAGAATCAAATCAAAAGAGGG - Intergenic
1146548440 17:33759498-33759520 AAGAGATTCATATGGATAGAAGG + Intronic
1146939049 17:36831273-36831295 GAGAGACACAAATGGAGAGAAGG + Intergenic
1148117376 17:45184401-45184423 CAGAGACACACATGCATAGAGGG - Intergenic
1150072974 17:62168364-62168386 GAGAGAATCAGAAGGAAAGAAGG + Intergenic
1150988961 17:70232733-70232755 GAGTGAATCAAATGAGGAGAAGG + Intergenic
1151071414 17:71217269-71217291 GAAAGAAAGAAATCCATAGATGG + Intergenic
1151247743 17:72808165-72808187 CAGAGGCTCATATGCATAGAAGG + Intronic
1151567180 17:74905188-74905210 GAGTGAATCAGAGGCAGAGAGGG - Intergenic
1153447439 18:5189304-5189326 GAGAGATTACAATGGATAGAAGG - Intronic
1155835170 18:30573091-30573113 GACAGAATTACATGTATAGATGG + Intergenic
1156088504 18:33438341-33438363 CAGAGACTCAAATGCAGACAGGG - Intronic
1156974629 18:43204469-43204491 GACAGACACAAATGCAAAGAGGG - Intergenic
1157467300 18:47958275-47958297 GAGAGTATCACATGTGTAGAAGG - Intergenic
1157929460 18:51805284-51805306 GAAAGAATAAAATGCATTCAGGG + Intergenic
1158523347 18:58190146-58190168 CAAAGTATCAAATACATAGAAGG + Intronic
1158655493 18:59327222-59327244 GAAAGATTTAAATACATAGATGG - Intergenic
1158837494 18:61346363-61346385 CCCAGAATCAAATGCATAAAAGG - Intronic
1159335934 18:67066853-67066875 AAGAGAATCAATTGTATAGATGG + Intergenic
1159585201 18:70277391-70277413 GAGAGAGTCAAAAGCAGAAATGG + Intergenic
1161653108 19:5497376-5497398 GAGAGAATCAAAAGTTGAGATGG + Intergenic
1161902341 19:7128651-7128673 GTGAGAATCAACTGTCTAGAGGG + Intronic
1162288655 19:9761360-9761382 GAGTGAAGCAAATGGAAAGATGG + Intronic
1165620448 19:37241809-37241831 GAGAGAAATAAATGCATATGGGG - Intronic
1167246108 19:48374036-48374058 GAGGGAAGCAAATGCAAAGAAGG - Intronic
925067503 2:939798-939820 GACAGAATCAATTGCATGAAAGG - Intergenic
925782455 2:7394385-7394407 GAGAGAATCAGATACAGCGATGG + Intergenic
926173925 2:10572197-10572219 GAGAAAATGAAATGAGTAGAGGG + Intronic
926936576 2:18091835-18091857 GAGAGAATCCATTGAATGGATGG + Intronic
927505703 2:23612944-23612966 GAGAGAAATAAATGCAAAAAAGG + Intronic
928187814 2:29129919-29129941 CAGAGAATCTAATGCAAAGATGG - Intronic
928778902 2:34796622-34796644 TAGAGAATAAAATGAATAGCAGG + Intergenic
929361717 2:41099837-41099859 GAGAGAAACGAAGGCAGAGAAGG + Intergenic
929748541 2:44685307-44685329 GAGAGAATGAGATGGACAGAGGG + Intronic
930415473 2:51085521-51085543 TAGAGAATCAAAAGCTCAGATGG - Intergenic
931928766 2:67105244-67105266 GAGAGAGTTTAATGGATAGATGG - Intergenic
932115273 2:69041166-69041188 GAGAGAAACAAATACATGGGTGG + Intronic
932122092 2:69111314-69111336 GAGAGATTCAAATGCTAAAAAGG + Intronic
932440708 2:71732888-71732910 GAGAGAATCAAAGGCTTTGAGGG - Intergenic
932803490 2:74763655-74763677 GAGAGAATCAAAAGCAACAAAGG - Intergenic
932937039 2:76115585-76115607 AAGAGGATCAAATGTATACATGG + Intergenic
933051481 2:77608283-77608305 GATAGAATCACATGGATAAAGGG - Intergenic
933767632 2:85721077-85721099 GAGAGAAGCAAATGAATCCAAGG + Intergenic
934130376 2:88942417-88942439 GAGAAGATGAAATGCATAGTGGG - Intergenic
935998251 2:108797579-108797601 GAGAGATTCAAAATAATAGAGGG + Intronic
936434037 2:112487840-112487862 GAGAGAGACAAATGGATAAAGGG - Intronic
936809172 2:116375592-116375614 GAGAGAATGGAAAGCATAGAGGG - Intergenic
937190925 2:120097669-120097691 GAGGAAATCAAATGAGTAGAAGG + Intronic
937615288 2:123914491-123914513 GAGTGAAACAAATGCCAAGAAGG - Intergenic
938075549 2:128332069-128332091 AATAGAATCAGATGCAGAGATGG + Intergenic
939244055 2:139599924-139599946 CTGAGAAACAAATGCCTAGATGG - Intergenic
939251717 2:139689185-139689207 GAGCTAATCAGATGCTTAGATGG + Intergenic
939415467 2:141890734-141890756 GATAGAATCAGATACTTAGAAGG - Intronic
940034356 2:149297827-149297849 TGGAGAATCAAATCCATAAAAGG - Intergenic
940565930 2:155360011-155360033 GAGAGAAACAAGTCAATAGAAGG - Intergenic
943448872 2:188023356-188023378 GAGAAAATAAAATGCATTCAAGG - Intergenic
943474998 2:188343181-188343203 CATAGAATAAAATGCATGGAAGG + Intronic
944315600 2:198282138-198282160 GAGAGAATCAAAAAAGTAGAGGG - Intronic
944359904 2:198841564-198841586 GAAAGAATCATCTCCATAGATGG - Intergenic
945960328 2:216127329-216127351 GAGAAAATGAAATGTAGAGAAGG + Intronic
947386626 2:229597139-229597161 CAGAGAATTAAATGCATTGCAGG + Intronic
1169248562 20:4043089-4043111 GATATAATCAAATGAAGAGAAGG - Intergenic
1169301810 20:4448921-4448943 GAGCTAATCAAAAGCATAAAAGG + Intergenic
1169879414 20:10330172-10330194 GAGAGAACAAAATACATGGAGGG + Intergenic
1171253227 20:23666371-23666393 GTGAGAATCACAGGCCTAGAAGG + Intergenic
1172411397 20:34726201-34726223 GATGGGATCAAAGGCATAGATGG + Intronic
1172962832 20:38810559-38810581 GAGAGAAACAAGTGCAGAGGTGG - Intronic
1173427011 20:42952076-42952098 GAGAGACTCAAAGGCATAGCAGG + Intronic
1173760955 20:45560157-45560179 GAGAGATTCAAATGATGAGAAGG + Intronic
1173766259 20:45612452-45612474 AAGATAAGGAAATGCATAGATGG + Intronic
1174980027 20:55383465-55383487 GAGTGAAACAAATGCAGAGAGGG + Intergenic
1176961956 21:15169076-15169098 AAGAGAATCTAAGGCACAGAGGG - Intergenic
1177218125 21:18155424-18155446 GAGAGAAGGAAATGAATAGATGG + Intronic
1178468330 21:32869408-32869430 GAGGGATTTAAAGGCATAGAAGG - Intergenic
1179594397 21:42432378-42432400 CAGACACTCAAATGCATACATGG - Intronic
1181002605 22:19994854-19994876 GAGAAAAACAGACGCATAGATGG + Intronic
1181774494 22:25149618-25149640 AAGAGAAGCAAATGCATTTAAGG - Intronic
1182837120 22:33351248-33351270 GAGAAAAGCAAAGGCAGAGAGGG + Intronic
1184346543 22:43917146-43917168 GAGAGAAGCAAATGTTTGGAGGG + Intergenic
1184977983 22:48076612-48076634 GTGTGAATGAAATGCAGAGATGG - Intergenic
1184998892 22:48230067-48230089 GTGAGAATTAATTGCCTAGATGG + Intergenic
953574492 3:44102129-44102151 GATAGAATCAAAGGCTTAGAAGG + Intergenic
956105233 3:65810553-65810575 GAGAGAATCGAATGAACTGATGG + Intronic
956471221 3:69569066-69569088 TTGAGAATCACAAGCATAGAAGG + Intergenic
958905102 3:99933359-99933381 GAGAAAAGCAAAGGCATAGAAGG + Intronic
959380457 3:105635226-105635248 TATAGAAACAAATGCATAGAAGG - Intergenic
960523451 3:118682107-118682129 TGGAGAATCAGATGAATAGAAGG - Intergenic
962743416 3:138380127-138380149 GAGACAAACAAATGGATAGCAGG - Intronic
965402896 3:168234929-168234951 GAGAGAATGAACTGCTTAGAAGG + Intergenic
966552045 3:181216121-181216143 GTGAGGAATAAATGCATAGATGG - Intergenic
967297366 3:187978478-187978500 GATAGAAACAAAAGCAAAGAAGG - Intergenic
967394911 3:188997231-188997253 TAAAGAAAAAAATGCATAGAAGG - Intronic
969137714 4:5044057-5044079 GTGAGAATTAAATGCCTAGAAGG - Intergenic
969178179 4:5415944-5415966 GTGGGACTTAAATGCATAGATGG - Intronic
969855596 4:9996649-9996671 GAGAGATTCAAATGCCCAAAGGG - Intronic
970388476 4:15581558-15581580 TAGAGACTCAAATGCAGAGTTGG + Intronic
971038548 4:22723559-22723581 GAGAGAACAAAAACCATAGAAGG - Intergenic
971332805 4:25696349-25696371 GACAGGACCCAATGCATAGAAGG + Intergenic
972088063 4:35244443-35244465 AAAAGAATCAAATTCATAGAAGG - Intergenic
972378949 4:38500957-38500979 GAGTCAATTAAATGCAGAGAAGG - Intergenic
972824242 4:42737721-42737743 GAAAGAATTTAAAGCATAGATGG + Intergenic
972970939 4:44575389-44575411 AAAAACATCAAATGCATAGAGGG - Intergenic
973107967 4:46363355-46363377 TTTAGAATCAAATACATAGAAGG + Intronic
974574126 4:63695060-63695082 GAGAAATTCAAATGTATAAAAGG + Intergenic
976859270 4:89643545-89643567 AAGATAATCACATGCAGAGATGG + Intergenic
978297861 4:107228980-107229002 GAGAAAATCACTTCCATAGAAGG + Intronic
979437217 4:120707661-120707683 TAGAGAAAAAAATGCATAAAGGG + Intronic
979713060 4:123803451-123803473 GAGAGAGTACCATGCATAGAAGG + Intergenic
980468888 4:133224003-133224025 TAGAGAATAAAATGAAAAGAAGG - Intergenic
980533291 4:134082704-134082726 GAGAGAATGAAATAGAGAGATGG - Intergenic
980612222 4:135173971-135173993 GAGAGTAGCAAATGGAAAGAGGG - Intergenic
981838197 4:149079978-149080000 GAGTGCATCACATGCACAGACGG - Intergenic
982085792 4:151834836-151834858 TATACAATCAAATGCATTGATGG - Intergenic
983802533 4:171950905-171950927 GAGAGAATGAAATGTAAAAAAGG + Intronic
984848285 4:184127012-184127034 AACAGAATCAGATCCATAGACGG + Intronic
986095783 5:4552951-4552973 GAGAGAATCAAAGAGGTAGAGGG + Intergenic
986562655 5:9078075-9078097 GAGACAATAAAATAAATAGATGG - Intronic
986611393 5:9571401-9571423 GAGACCATCAAATGAAGAGATGG - Intergenic
987805124 5:22754615-22754637 GAGAGAGTCAAGTCCTTAGAGGG + Intronic
988099539 5:26659402-26659424 AAGAGAGTCAAAGGCAGAGAAGG + Intergenic
988673491 5:33407294-33407316 GAGAGGAGCAAAGGCACAGAGGG + Intergenic
988824845 5:34925981-34926003 TTGAGAATCAAATGCATTAATGG + Exonic
990686379 5:58306814-58306836 GAAAGAATTAAATTCATAGAGGG - Intergenic
991504462 5:67309584-67309606 TGGAGAACCAAATTCATAGAAGG + Intergenic
992258156 5:74942788-74942810 GAGAGCTTCAAATGCTTACAAGG + Intergenic
993090885 5:83424727-83424749 AACAGAATCAGATGCAGAGACGG + Intergenic
994628520 5:102251962-102251984 GAGAGAGAGAAATGGATAGAAGG + Intronic
995023190 5:107389579-107389601 GACAGAATCAAATGCTTAATTGG + Intronic
996650171 5:125866181-125866203 GTGAGAACCCACTGCATAGAAGG - Intergenic
997103333 5:130992500-130992522 TAGAGAAAAAAATGCAGAGATGG + Intergenic
1001163130 5:169338969-169338991 TAGAGAATAAAAAGCACAGAAGG + Intergenic
1001356132 5:171025101-171025123 TAAACAATCAAATACATAGAAGG - Intronic
1002338590 5:178498532-178498554 GATAGAAACAAATGAAAAGAAGG + Intronic
1002348425 5:178564239-178564261 GAGAGAAACAAAAGCACAAAAGG - Intronic
1003603437 6:7539623-7539645 GAGAGAAAGACATGCATGGAGGG - Intergenic
1006862765 6:37184079-37184101 GAGAGGATCATATAGATAGATGG - Intergenic
1007589917 6:43014682-43014704 GATAGAGTCATATGCAGAGAGGG + Intronic
1007938162 6:45752436-45752458 GTGAGAAGCAAATGCATTGACGG + Intergenic
1008758589 6:54827190-54827212 GACAGAATCCAGTACATAGATGG + Intergenic
1010206445 6:73326645-73326667 GAGATCATCAAATACATAAAAGG - Intergenic
1011008613 6:82677810-82677832 GAAAGAATCAAATTCAGAAAAGG + Intergenic
1011098786 6:83697976-83697998 GAAAGAAACAAATGCACAGGGGG + Intronic
1011329247 6:86185315-86185337 GAGAGAATAAAATAAATAAATGG - Intergenic
1012549116 6:100451667-100451689 GGGAGAATCTAATTCAAAGATGG + Intronic
1012985788 6:105875104-105875126 GAGAGAATCAAGGGCATGGAGGG + Intergenic
1013817982 6:114122000-114122022 GAGCGAAGCAAGGGCATAGAAGG - Intronic
1015606933 6:134967399-134967421 GAGAGCATCTAATACATAAATGG + Intronic
1016071374 6:139743137-139743159 AAAAGAACCAAATGCTTAGAAGG + Intergenic
1016371002 6:143374121-143374143 GAGAAAATCAGGTGCATGGATGG + Intergenic
1017362975 6:153598210-153598232 GAAAAGATCAAATGCATTGATGG - Intergenic
1017542049 6:155413206-155413228 GAGGGAGTCAAATGCTTAGGTGG + Intronic
1017561571 6:155633789-155633811 AACAGAAGCAAAGGCATAGAGGG - Intergenic
1018089921 6:160337402-160337424 GAGGAAATGAAATGCAAAGAGGG + Intergenic
1021492868 7:21238776-21238798 GAAAGAGTCATATTCATAGATGG + Intergenic
1021936410 7:25636430-25636452 GAGAGAGTCACATCCATGGAGGG + Intergenic
1022045349 7:26618181-26618203 GAGTGAATGAAAGGCATAAAGGG + Intergenic
1022591224 7:31665172-31665194 TAGAAAAGCAAATGCAAAGAGGG - Intergenic
1022601967 7:31769446-31769468 GAAAGACTCAAATTCTTAGATGG - Intronic
1022620329 7:31977265-31977287 GAGGGCATCAAATGCTGAGAGGG - Intronic
1022624611 7:32022131-32022153 GAGAGAAAAAAATGAACAGAGGG + Intronic
1022691033 7:32654775-32654797 GAGTGTATAAAATGCATGGAAGG + Intergenic
1022873892 7:34507917-34507939 GAGAGAATGAACTGTAGAGAAGG - Intergenic
1022918600 7:34988668-34988690 GAGTGTATAAAATGCATGGAAGG + Intronic
1023331259 7:39119470-39119492 GAGAGAGTCAAATGGAAGGATGG + Intronic
1023718508 7:43068798-43068820 GAAACAAACAAATACATAGAAGG + Intergenic
1024561888 7:50651729-50651751 AAGAGAGTCAAATACATACAAGG - Intronic
1024700968 7:51903853-51903875 GAGAGAATGAAGTCCAGAGATGG - Intergenic
1026135238 7:67654532-67654554 GCTAGAAACAAATGCAGAGAGGG - Intergenic
1026666515 7:72345181-72345203 AAGAGCATCACAGGCATAGAAGG + Intronic
1026761504 7:73130169-73130191 AAGACAATCAAATGGATAAATGG - Intergenic
1026858043 7:73767980-73768002 GAGAGATTCAAATGACTGGATGG - Intergenic
1027037845 7:74938980-74939002 AAGACAATCAAATGGATAAATGG - Intergenic
1027085717 7:75262491-75262513 AAGACAATCAAATGGATAAATGG + Intergenic
1027816186 7:82975431-82975453 GGGAGTCTGAAATGCATAGAAGG + Intronic
1028452272 7:90999004-90999026 GAGAGCATCAGATGGCTAGAGGG + Intronic
1029613072 7:101637759-101637781 GAGAGAAACAGATACATGGAAGG + Intergenic
1030679700 7:112422086-112422108 GAGGGAAGGAAATGCAGAGATGG + Intergenic
1030749690 7:113216201-113216223 GAGAGGAGCAGATGCATAAAAGG - Intergenic
1032919418 7:136528278-136528300 AAGAGAAACAAATGGAAAGAAGG + Intergenic
1033384307 7:140856620-140856642 GAGAGAATTAAAGGACTAGAAGG + Intronic
1033705273 7:143880721-143880743 GAGGAAATCAAATTTATAGATGG - Intronic
1033840335 7:145365646-145365668 GAGATAAGCAAATACATAGGTGG - Intergenic
1034179239 7:149125182-149125204 GGAAGAATCAAATGCAAATAAGG + Intronic
1036149223 8:6282667-6282689 GAGAGAATCAAAAAGACAGAAGG + Intergenic
1038263290 8:26016984-26017006 GAGAGAACCAGATGTCTAGAAGG + Intronic
1038962939 8:32541715-32541737 GAGAGATTCAGATGCTTTGATGG - Intronic
1039728553 8:40249753-40249775 AATGAAATCAAATGCATAGAAGG - Intergenic
1040350835 8:46565891-46565913 GAGAAATTAAAATGCATAGTTGG + Intergenic
1040458933 8:47628113-47628135 GAGAGACTCAAAAATATAGATGG + Intronic
1040676061 8:49751382-49751404 GATAGAATCAAAAGCATAAATGG + Intergenic
1040734919 8:50493225-50493247 TAAAGGATCATATGCATAGAAGG - Intronic
1041469024 8:58188254-58188276 GAGATAGTCAAATGCATATGTGG + Intronic
1042486243 8:69349199-69349221 AAGAGATACAAATGCATAGATGG - Intergenic
1043998590 8:86849574-86849596 GAGAGAATCAAAAGCAGATAAGG - Intergenic
1044137266 8:88602460-88602482 GAGACAATAAAATGAATAGAAGG - Intergenic
1044476360 8:92630918-92630940 GTGAAAATCAAATGCATATATGG - Intergenic
1044682470 8:94795849-94795871 AAGAGAATCAACTGAATGGAAGG - Intergenic
1044713420 8:95078118-95078140 GAGAGAATCAAAGGTGGAGATGG + Intronic
1044920730 8:97166933-97166955 GACAAAAACAAATGCATAAATGG - Intergenic
1046476188 8:114746917-114746939 GAGAGAACCAAGTACATAGTGGG - Intergenic
1048417081 8:134239351-134239373 GAAAGAATAAAATGTAAAGATGG + Intergenic
1050037077 9:1448042-1448064 AAGAAAATCAAATGCAGAAATGG + Intergenic
1050491119 9:6188812-6188834 GAGAGAATAAAATCCAAGGAGGG - Intergenic
1052762852 9:32610291-32610313 GAGAGAAAGAAATAGATAGATGG - Intergenic
1053149755 9:35735941-35735963 GAGAGGATCCAGTGCAGAGATGG + Intronic
1053237757 9:36470911-36470933 GAGAGAAGCAAAGGGAGAGATGG - Intronic
1054839193 9:69717623-69717645 TTGAGAATCAAATGGCTAGATGG - Intronic
1054893329 9:70277477-70277499 GAGAGAAATAAATGTAAAGATGG + Intronic
1055236219 9:74126486-74126508 GGGAGAATCTAATGCAGAAATGG - Intergenic
1056406141 9:86276958-86276980 GAGTGGATCAAAGGCACAGATGG + Intronic
1056494134 9:87139235-87139257 GTGAGCATCAAATGCATATTAGG + Intergenic
1058230670 9:102420153-102420175 GAGAAAATAAGAAGCATAGATGG - Intergenic
1058639964 9:107074033-107074055 GATTGAATAAAATGCAGAGAAGG - Intergenic
1058675877 9:107399528-107399550 GAAAGAATCAAAAACTTAGAAGG - Intergenic
1058833765 9:108842469-108842491 GTGAGAATCAAATGTAAAAAAGG + Intergenic
1059845190 9:118267816-118267838 GAAAGAAAAAAATGCATAAAGGG + Intergenic
1060749117 9:126157305-126157327 GAGACATGCAAATGCAAAGAGGG - Intergenic
1061892632 9:133630809-133630831 GAGAGAAGGAGATGCATTGATGG - Intergenic
1185978444 X:4748284-4748306 AGGAGAATCAAATGCAAAGAGGG + Intergenic
1186278352 X:7965045-7965067 GAGAGAATCCATTGCATGAAAGG + Intergenic
1186300185 X:8192226-8192248 GAGAGAATCAAATCTATTAATGG - Intergenic
1186923920 X:14311188-14311210 GGGAGAATAAAATACAGAGAGGG + Intergenic
1188692501 X:33147677-33147699 GAGATAATTACATGCCTAGAAGG - Intronic
1192131423 X:68555211-68555233 GAGAGGAAAAAATGCAAAGAGGG + Intergenic
1192591041 X:72359641-72359663 GAGAGCAGCAAATGCAAAGCTGG + Intronic
1192717117 X:73655720-73655742 GAGAGAATCAAAAGAATCAATGG - Intronic
1193589746 X:83374503-83374525 GAGAGAATCAAATGAGGTGAAGG + Intergenic
1194790501 X:98142577-98142599 AATAGAATCAAATAGATAGAGGG + Intergenic
1194865920 X:99066697-99066719 TAAAATATCAAATGCATAGAAGG + Intergenic
1196961622 X:121009284-121009306 GATAGCATGAAATGCACAGAAGG - Intergenic
1197427708 X:126318489-126318511 GAGAGAATCATATGCAGTGTTGG - Intergenic
1198874228 X:141205561-141205583 GAGAGAGTGAAATGAATAGGTGG + Intergenic
1199796070 X:151198660-151198682 GAGAGAATCACTTTCATACAAGG + Intergenic
1200411105 Y:2862406-2862428 GAGAGAATCAGAAAAATAGAAGG - Intronic
1201540067 Y:15096499-15096521 GAGAGAAACAAAGGGAGAGAGGG - Intergenic
1202606104 Y:26640980-26641002 GATAGAATCAAATGCAAAAATGG + Intergenic