ID: 906932156

View in Genome Browser
Species Human (GRCh38)
Location 1:50180623-50180645
Sequence CTTCCAATGCATAGTGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 106}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906932154_906932156 11 Left 906932154 1:50180589-50180611 CCAAAGCAGAGAAAGAGCATGAT 0: 1
1: 0
2: 1
3: 41
4: 280
Right 906932156 1:50180623-50180645 CTTCCAATGCATAGTGTGGATGG 0: 1
1: 0
2: 0
3: 8
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906932156 Original CRISPR CTTCCAATGCATAGTGTGGA TGG Intronic
902059306 1:13628765-13628787 CTGCCAATCCATTGTTTGGAAGG - Intergenic
904366343 1:30013265-30013287 CTTACAATACATCCTGTGGAGGG - Intergenic
905196699 1:36284903-36284925 TTTCAAATGAAAAGTGTGGAAGG + Intronic
906932156 1:50180623-50180645 CTTCCAATGCATAGTGTGGATGG + Intronic
907150176 1:52278484-52278506 CTTCCACAGCATAGTCTGAAAGG - Exonic
909889789 1:80990453-80990475 CTTCCCATGCACAGTGAGGGAGG - Intergenic
912452264 1:109774334-109774356 CTTCCCAGGCATGGTGTGGGTGG - Intronic
918277679 1:182969348-182969370 TTTCCAATGCATTGAGTGCAAGG + Intergenic
920278435 1:204825839-204825861 CTTCCAATCCTTAGTGTCCAGGG + Intergenic
921128501 1:212198792-212198814 CTTCCAATAAATACTGTTGAAGG - Intergenic
1065246162 10:23760238-23760260 CTTCATATGCCTAGTGTGAAAGG - Intronic
1075497477 10:122937467-122937489 CTTCCCAGGCATTTTGTGGAAGG - Intronic
1083459380 11:62800481-62800503 CTTCAACTGCAAAGGGTGGAAGG + Exonic
1083856683 11:65396502-65396524 CTTCCTTTGCAGAGTGGGGATGG - Intronic
1085758242 11:79219421-79219443 CTTCCAATTCATATTGTGCAAGG - Intronic
1088065198 11:105709329-105709351 CTTCCAATGAATAATGTAGAAGG + Intronic
1088322709 11:108569989-108570011 CTCCCAATGCTTAATGTTGATGG + Intronic
1094838498 12:34333331-34333353 CCTCACATGCACAGTGTGGAGGG - Intergenic
1107082206 13:36387231-36387253 CTGGAAATGCATAGTGGGGATGG + Intergenic
1110676256 13:78249083-78249105 GTTCCAATGGAGAGTGTGTAAGG + Intergenic
1112937201 13:104815784-104815806 ATTCCAATTCATAGTGGCGAGGG - Intergenic
1117208881 14:53474907-53474929 CTTCCAATGACTAGAATGGAGGG + Intergenic
1119490039 14:75024014-75024036 CTGACAAAGCTTAGTGTGGATGG + Intronic
1119908726 14:78330019-78330041 CTTCCATTGCATATGGTGGACGG - Intronic
1121674360 14:95740535-95740557 CTTCCAAAGCAGAGTGCAGAAGG - Intergenic
1123161604 14:106283692-106283714 CTTCAAAAGCATGGTGTGGTAGG + Intergenic
1125432224 15:39607085-39607107 CTTCCCACGGACAGTGTGGAGGG - Intronic
1126432285 15:48598781-48598803 CTCCCACTGCAGTGTGTGGATGG + Intronic
1128007667 15:64260052-64260074 CTTCCAAGGATTAGTGAGGATGG - Intronic
1132935479 16:2478408-2478430 CACCCCATGCAGAGTGTGGAGGG + Intronic
1133858613 16:9573318-9573340 CTGCAAATGCAAAGTGTGGATGG + Intergenic
1134248543 16:12558076-12558098 CATCCCATGCAAAGTGGGGACGG + Intronic
1136779875 16:32891194-32891216 ATTTCTATGCAAAGTGTGGATGG - Intergenic
1136890740 16:33970323-33970345 ATTTCTATGCAAAGTGTGGATGG + Intergenic
1137626874 16:49914667-49914689 CTCCCAGTGCCTAGTGGGGAGGG + Intergenic
1139251695 16:65502610-65502632 CTTTCAATGTATAGTGTGCTGGG + Intergenic
1139254713 16:65529801-65529823 CTTCCACCGCATAGTGGGGCTGG + Intergenic
1139454609 16:67063183-67063205 TTTTAAATGCACAGTGTGGAAGG + Intronic
1139691050 16:68642397-68642419 CTTGCCATCCAGAGTGTGGAGGG - Intronic
1203082293 16_KI270728v1_random:1153283-1153305 ATTTCTATGCAAAGTGTGGATGG - Intergenic
1144396539 17:14849386-14849408 ATTCCAATGCAATGTGGGGAGGG + Intergenic
1144419275 17:15081219-15081241 CTTGCAAAGGATAGAGTGGAAGG + Intergenic
1145825530 17:27874526-27874548 CTCACACTGCATAGTGTGTACGG + Intronic
1147050456 17:37790496-37790518 CATCCACTGCATTGTGTGGAGGG + Intergenic
1147930715 17:43978851-43978873 CTTCTGATGCAGAGTATGGAGGG - Intronic
1153582887 18:6593150-6593172 TTGCAAATGCATAGAGTGGAAGG + Intergenic
1154969072 18:21389025-21389047 CTTCCACTACATACTGTGGAAGG + Intronic
1155628546 18:27864183-27864205 CTTCCAAAGCACACAGTGGATGG + Intergenic
1158436511 18:57438294-57438316 CTTCCCATGGATCGGGTGGAGGG + Intronic
1159299469 18:66544050-66544072 CTTCAAATACATAATATGGAAGG + Exonic
1164474470 19:28564552-28564574 GTGCCACTGCAGAGTGTGGAAGG - Intergenic
925749206 2:7072359-7072381 ATTTCAAAGCAAAGTGTGGAAGG + Intergenic
930182966 2:48383244-48383266 CTTCCAGAGTTTAGTGTGGAAGG + Intergenic
930341671 2:50123831-50123853 CTTCAGATGGATATTGTGGAAGG + Intronic
930826863 2:55703847-55703869 CTCCCATTGCTTAGTTTGGAGGG + Intergenic
931737770 2:65213105-65213127 CTTGCAATTTATAGTGTGTAAGG + Intergenic
933434594 2:82231445-82231467 ATTCCAAAGCATAGTGTGTGAGG + Intergenic
937478049 2:122232477-122232499 CTTCCAAGGCACAGGATGGAGGG - Intergenic
937876509 2:126829762-126829784 GATCCAATGAATAGTGTGGGGGG + Intergenic
940401626 2:153254620-153254642 CATCCAAAGCAGTGTGTGGAGGG - Intergenic
946594551 2:221291934-221291956 CTTCCCATACATAATGAGGATGG - Intergenic
948013618 2:234670243-234670265 CATTCAATACATAGTGGGGAGGG - Intergenic
1169863460 20:10175235-10175257 CATCCAATGCATTGTCTTGATGG - Intergenic
1172148077 20:32771104-32771126 TTTTCAATACATAGTGTGCAAGG + Intronic
1181929233 22:26386256-26386278 ATTCCAAAGCAAAGTGTTGAAGG - Intergenic
949731708 3:7121377-7121399 CTTACAATGAATAGAGGGGATGG - Intronic
950785129 3:15427865-15427887 CTTACAACGAATAGTGTGGAAGG - Exonic
952164745 3:30735171-30735193 CTCCCATTGCATTGTGTAGAAGG + Intronic
953584446 3:44187052-44187074 CTTCCAATGGCCACTGTGGATGG + Intergenic
954984055 3:54774092-54774114 CTTCCAGTGCAAAGTGGGAATGG + Intronic
955229601 3:57086980-57087002 CTTCCTATGTATAGAGTTGAGGG - Intergenic
956601471 3:71027297-71027319 CTTCCATAGCATACTGGGGAGGG - Intronic
958455069 3:94320481-94320503 CTTCCATGGCATAATGTAGAAGG + Intergenic
958939124 3:100290476-100290498 CTTCCAGTGAATGCTGTGGAGGG + Intronic
962473956 3:135739727-135739749 ATTCAAATGCATAAAGTGGAGGG - Intergenic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
962991194 3:140578882-140578904 TTACCAAGGTATAGTGTGGAAGG - Intergenic
966296310 3:178427652-178427674 CTGCCCATGCATACTGTGCAGGG - Intronic
967826632 3:193882430-193882452 CTCCCAATCCAGATTGTGGAGGG - Intergenic
971429360 4:26548417-26548439 CTTCCAATGCTTAGTTTGCTGGG + Intergenic
971632063 4:29006010-29006032 CTTCCCAGGCATAGTGTGCTGGG - Intergenic
972199070 4:36691471-36691493 CTTACAAGGCATAGTTTGGCTGG + Intergenic
975598521 4:76074591-76074613 ATTCCAAGGCATAGTGTGGGGGG + Intronic
978148124 4:105401530-105401552 CTACAAATGGATAGTGTTGATGG - Intronic
978264079 4:106801315-106801337 TTTCCAATGCATAATGTAAATGG - Intergenic
981330249 4:143499913-143499935 GTTCCAATGCAGAGTGAAGAGGG - Intergenic
986834864 5:11625035-11625057 CTTACAGTGCATATTGTTGAAGG - Intronic
988320290 5:29686188-29686210 TTTCCAATACATAGTGTGACAGG + Intergenic
991900593 5:71455948-71455970 CTTCCAATCCCCAGCGTGGACGG + Exonic
992923448 5:81553162-81553184 CTTACAATCCATATTGAGGAAGG - Intronic
993650490 5:90514912-90514934 CTTCAAATGTACAGTGTCGATGG + Intergenic
993866468 5:93202488-93202510 CTTCCATTGCAAAGTTTTGAGGG - Intergenic
1002176875 5:177405602-177405624 CTTCCAAAGGGTATTGTGGAGGG + Intronic
1014558633 6:122863686-122863708 CTTCCAGGGCAAAGTGAGGAAGG + Intergenic
1018824387 6:167398234-167398256 CTCCCAATGCATATTTAGGAAGG - Intergenic
1022712114 7:32861761-32861783 CATCCAATGTACACTGTGGATGG + Intergenic
1023545010 7:41309621-41309643 CTTCCAGTGGAGTGTGTGGATGG + Intergenic
1028110771 7:86938461-86938483 TTTCCAATGTATAGTGATGATGG - Intronic
1030678295 7:112407775-112407797 CTTCCAATACATAGTAAGGTTGG - Intergenic
1033063995 7:138135249-138135271 CTTCTAATGCAAAATGTGTAGGG - Intergenic
1038227148 8:25667918-25667940 CATCTATTGCATTGTGTGGAAGG - Intergenic
1038860726 8:31386635-31386657 TTTCCATTCCATAGTGTGCAAGG - Intergenic
1042114053 8:65412355-65412377 CTTCCAATGAAAAGTGTCGGGGG - Intergenic
1056982113 9:91323827-91323849 CTTTCTATCCATAGTGTGCATGG - Intronic
1060224644 9:121783526-121783548 TTTCTAATGCATACTGTGAAAGG - Exonic
1061416796 9:130451446-130451468 CTGCCAATGCCCAGTTTGGAGGG - Intronic
1187096626 X:16155617-16155639 CTGCCAAAGCAGAGTGTGGCAGG + Intergenic
1187715320 X:22096690-22096712 CTCCCAATCTATAATGTGGATGG - Intronic
1190199174 X:48345485-48345507 GTACCATTGCACAGTGTGGAGGG - Intergenic
1190204791 X:48394262-48394284 GTACCATTGCACAGTGTGGAGGG + Intergenic
1190205745 X:48401141-48401163 GTACCATTGCACAGTGTGGAGGG - Intergenic
1191749740 X:64528909-64528931 CCTCAAATGCATAGTGAGGTAGG - Intergenic
1191962684 X:66720511-66720533 CTTACAAAGCTTAGTTTGGAAGG - Intergenic
1195958096 X:110355615-110355637 CTTCCAATCAACAGTGTGCAAGG - Intronic
1201264664 Y:12194187-12194209 GTTCCAATCCCCAGTGTGGAAGG + Intergenic